Houston, TX, United States
Houston, TX, United States

Baylor College of Medicine , located in the Texas Medical Center in Houston, Texas, US, is a health science university. It includes a medical school, Baylor College of Medicine; the Graduate School of Biomedical science; the School of Allied Health science; and the National School of Tropical Medicine. The school, located in the middle of the world's largest medical center, is part owner of Baylor St. Luke's Medical Center, part of the CHI St. Luke's Health system, and has hospital affiliations with: Harris Health System, Texas Children's Hospital, The University of Texas MD Anderson Cancer Center, Memorial Hermann - The Institute for Rehabilitation and Research, Menninger Clinic, the Michael E. DeBakey Veterans Affairs Medical Center and Children's Hospital of San Antonio.The medical school has been consistently considered in the top-tier of programs in the country, and is particularly noted for having the lowest tuition among all private medical schools in the US. Its Graduate School of Biomedical science is among the top 30 graduate schools in the United States. Within the School of Allied Health science, the nurse anesthesia ranks 5th and the physician assistant program ranks 6th. A program in Orthotics and Prosthetics began in 2013, with 18 students in the first class. The National School of Tropical Medicine is the only school in the nation dedicated exclusively to patient care, research, education and policy related to neglected tropical diseases.On June 21, 2010, Dr. Paul Klotman was named as the new President and CEO of the Baylor College of Medicine. In January 2014, the College and CHI St. Luke's became joint owners of Baylor St. Luke's Medical Center. Wikipedia.


Time filter

Source Type

Patent
Baylor College of Medicine | Date: 2016-10-13

The present invention concerns immunotherapy for cancers having cells that comprise the ganglioside GD2 antigen. In specific embodiment, T cells having a chimeric receptor that targets GD2 is employed. In particular cases, the chimeric receptor comprises antibody, cytoplasmic signaling domain from the T cell receptor, and/or costimulatory molecule(s).


Patent
Rice University, Baylor College of Medicine and Texas Heart Institute | Date: 2015-02-20

Systems and methods for deploying and securing conductive materials to a region of tissue may utilize a catheter. The catheter may provide a tip with one or more detachable sections or may provide an adjustable opening. A lumen of the catheter may provide a conductive material, such as a filament, fiber, network or patch of carbon nanotubes (CNTs) or carbon nanofibers (CNFs). In some embodiments, the conductive materials may be coupled to securing mechanisms, such as screws, clips, anchors, alligator clips, or anchors with barbs, which can be actuated to attach the conductive materials to desired regions of tissue. In some embodiments, the catheter may provide a needle tip that allows the conductive material to be embedded into desired regions of tissue by inserting the needle into the tissue.


Patent
Actuated Medical, Baylor College of Medicine and Texas Heart Institute | Date: 2016-09-16

A system, device and method for insertion of a penetrating member into tissue is disclosed, which may be handheld and automated. A detector obtains data regarding subdermal locations of tissue structures, including cavities such as blood vessels. A processor calculates the distance between a preselected target point below the tissue surface, such as within a blood vessel, and the tissue surface, and adjustment data for vertical, angular and extension adjustment of the penetrating member. Vertical, angular and extension actuators carry out the adjustments in real-time as calculated and directed by the processor. Changes in the location of the target point result in automatic recalculation and adjustment by the processor and various actuators. A vibrational actuator induces vibration to the penetrating member during insertion, overcome tissue deformation and vein rolling. A guidewire may be inserted through or by the device, for dilator and catheter insertion once the penetrating member is removed.


Patent
Baylor College of Medicine | Date: 2016-12-08

A novel network of tumorigenic prognostic factors is identified that plays a critical role in advanced pancreatic cancer (PC) pathogenesis. This interactome is interconnected through a central tumor suppressive microRNA, miR-198, which is able to both directly and indirectly modulate expression of the various members of this network to alter the molecular makeup of pancreatic tumors, with important clinical implications. When this tumor signature network is intact, miR-198 expression is reduced and patient survival is dismal; patients with higher miR-198 present an altered tumor signature network, better prognosis and increased survival. Further, according to the present disclosure, MiR-198 replacement reverses tumorigenicity in vitro and in vivo. As such, an embodiment of the disclosure is a method of treating cancer in an individual, comprising the step of increasing the level of active microRNA-198 molecules in the pancreatic cancer tumor cells of the individual by an amount sufficient to cause an improvement in the pancreatic cancer in the individual


Patent
Baylor College of Medicine | Date: 2016-10-21

Embodiments of the disclosure concern methods and compositions for immunotherapy for human papillomavirus infection and diseases associated therewith. In specific embodiments, methods concern production of immune cells that target one or more antigens of HPV16 and/or HPV18, including methods with stimulation steps that employ IL-7 and IL-15, but not IL-6 and/or IL-12. Other specific embodiments utilize stimulations in the presence of certain cells, such as costimulatory cells and certain antigen presenting cells.


Patent
Baylor College of Medicine | Date: 2015-05-05

Embodiments of the disclosure include methods and compositions for treatment of prostate cancer, including metastatic prostate cancer or prostate cancer at risk for developing into metastatic prostate cancer, by providing an effective therapy to an individual that has been determined to have elevated levels of SRC-2 (also known as NCOA2, GRIP1 TIF2). In particular cases, sample from an individual known to have prostate cancer is assayed for the risk for developing metastatic prostate cancer and the individual is provided an effective therapy upon determination of elevated levels of SRC-2.


Patent
Baylor College of Medicine | Date: 2017-03-22

The present invention relates to an intraosseous nerve ablation system comprising: a boring device adapted to form a passageway in bone, thereby providing access to an intraosseous nerve within the bone; an intraosseous nerve ablation device adapted to ablate the intraosseous nerve within the bone, wherein the intraosseous nerve ablation device comprises a shaft having a first end and a second end and a length defined therebetween, wherein the first end of the shaft comprises a tip formed of an electrically conductive material, wherein the tip of the shaft is blunt; a sleeve adapted to receive the intraosseous nerve ablation device and to facilitate alignment of the nerve ablation device with the passageway; and an electric power source operatively associated with the intraosseous nerve ablation device such that electrical current from the electric power source is transmitted to the first end of the intraosseous nerve ablation device, wherein the electrical current provided by the electric power source is sufficient to ablate the intraosseous nerve.


Zitnik M.,University of Ljubljana | Zupan B.,University of Ljubljana | Zupan B.,Baylor College of Medicine
IEEE Transactions on Pattern Analysis and Machine Intelligence | Year: 2015

For most problems in science and engineering we can obtain data sets that describe the observed system from various perspectives and record the behavior of its individual components. Heterogeneous data sets can be collectively mined by data fusion. Fusion can focus on a specific target relation and exploit directly associated data together with contextual data and data about system's constraints. In the paper we describe a data fusion approach with penalized matrix tri-factorization (DFMF) that simultaneously factorizes data matrices to reveal hidden associations. The approach can directly consider any data that can be expressed in a matrix, including those from feature-based representations, ontologies, associations and networks. We demonstrate the utility of DFMF for gene function prediction task with eleven different data sources and for prediction of pharmacologic actions by fusing six data sources. Our data fusion algorithm compares favorably to alternative data integration approaches and achieves higher accuracy than can be obtained from any single data source alone. © 2014 IEEE.


Alan Harris R.,Baylor College of Medicine
Epigenetics | Year: 2013

Metastable epialleles (MEs) are mammalian genomic loci where epigenetic patterning occurs before gastrulation in a stochastic fashion leading to systematic interindividual variation within one species. Importantly, periconceptual nutritional influences may modulate the establishment of epigenetic changes, such as DNA methylation at MEs. Based on these characteristics, we exploited Infinium HumanMethylation450 BeadChip kits in a 2-tissue parallel screen on peripheral blood leukocyte and colonic mucosal DNA from 10 children without identifiable large intestinal disease. This approach led to the delineation of 1776 CpG sites meeting our criteria for MEs, which associated with 1,013 genes. The list of ME candidates exhibited overlaps with recently identified human genes (including CYP2E1 and MGMT, where methylation has been associated with Parkinson disease and glioblastoma, respectively) in which perinatal DNA methylation levels where linked to maternal periconceptual nutrition. One hundred and eighteen (11.6%) of the ME candidates overlapped with genes where DNA methylation correlated (r > 0.871; p < 0.055) with expression in the colon mucosa of 5 independent control children. Genes involved in homophilic cell adhesion (including cadherin-associated genes) and developmental processes were significantly overrepresented in association with MEs. Additional filtering of gene expression-correlated MEs defined 35 genes, associated with 2 or more CpG sites within a 10 kb genomic region, fulfilling the ME criteria. DNA methylation changes at a number of these genes have been linked to various forms of human disease, including cancers, such as asthma and acute myeloid leukemia (ALOX12), gastric cancer (EBF3), breast cancer (NAV1), colon cancer and acute lymphoid leukemia (KCNK15), Wilms tumor (protocadherin gene cluster; PCDHAs) and colorectal cancer (TCERG1L), suggesting a potential etiologic role for MEs in tumorigenesis and underscoring the possible developmental origins of these malignancies. The presented compendium of ME candidates may accelerate our understanding of the epigenetic origins of common human disorders. © 2013 Landes Bioscience.


Savoldo B.,Baylor College of Medicine
Current Opinion in Infectious Diseases | Year: 2012

Purpose of Review: The continuous and successful expansion of organ transplants is unfortunately associated with increased incidence of severe opportunistic viral infections and Epstein-Barr virus (EBV)-related lymphomas secondary to immunosuppression. Here, we review the strengths and limitations of T-cell-based strategies used to treat viral infections in immunocompromised individuals. Recent Findings: While current antiviral drugs are often suboptimal because of associated toxicities, a promising approach in the management of infections with viruses like cytomegalovirus (CMV), adenovirus (AdV) and EBV is the adoptive transfer of T cells targeting these viruses that can be directly isolated from the peripheral blood of the donor or expanded ex vivo prior to infusions in patients. Summary: T-cell-based immunotherapies are now being included in the clinical practice of transplant recipients to prevent and treat infections and complications associated with CMV, AdV and EBV. Improvement of current limitations will enable the extension of these approaches to all patients at risk and to other clinically relevant viruses and pathogens that are emerging as significant complications for immunocompromised patients. © 2012 Wolters Kluwer Health | Lippincott Williams & Wilkins.


Chen D.,Columbia University | Shan J.,Columbia University | Zhu W.-G.,Peking University | Qin J.,Baylor College of Medicine | Gu W.,Columbia University
Nature | Year: 2010

The tumour suppressor ARF is specifically required for p53 activation under oncogenic stress. Recent studies showed that p53 activation mediated by ARF, but not that induced by DNA damage, acts as a major protection against tumorigenesis in vivo under certain biological settings, suggesting that the ARF-p53 axis has more fundamental functions in tumour suppression than originally thought. Because ARF is a very stable protein in most human cell lines, it has been widely assumed that ARF induction is mediated mainly at the transcriptional level and that activation of the ARF-p53 pathway by oncogenes is a much slower and largely irreversible process by comparison with p53 activation after DNA damage. Here we report that ARF is very unstable in normal human cells but that its degradation is inhibited in cancerous cells. Through biochemical purification, we identified a specific ubiquitin ligase for ARF and named it ULF. ULF interacts with ARF both in vitro and in vivo and promotes the lysine-independent ubiquitylation and degradation of ARF. ULF knockdown stabilizes ARF in normal human cells, triggering ARF-dependent, p53-mediated growth arrest. Moreover, nucleophosmin (NPM) and c-Myc, both of which are commonly overexpressed in cancer cells, are capable of abrogating ULF-mediated ARF ubiquitylation through distinct mechanisms, and thereby promote ARF stabilization in cancer cells. These findings reveal the dynamic feature of the ARF-p53 pathway and suggest that transcription-independent mechanisms are critically involved in ARF regulation during responses to oncogenic stress. © 2010 Macmillan Publishers Limited. All rights reserved.


Metzker M.L.,Baylor College of Medicine | Metzker M.L.,LaserGen
Nature Reviews Genetics | Year: 2010

Demand has never been greater for revolutionary technologies that deliver fast, inexpensive and accurate genome information. This challenge has catalysed the development of next-generation sequencing (NGS) technologies. The inexpensive production of large volumes of sequence data is the primary advantage over conventional methods. Here, I present a technical review of template preparation, sequencing and imaging, genome alignment and assembly approaches, and recent advances in current and near-term commercially available NGS instruments. I also outline the broad range of applications for NGS technologies, in addition to providing guidelines for platform selection to address biological questions of interest. © 2010 Macmillan Publishers Limited. All rights reserved.


Yoshimura T.,Baylor College of Medicine | Yoshimura T.,National Institute for Physiological science | Rasband M.N.,Baylor College of Medicine
Current Opinion in Neurobiology | Year: 2014

The axon initial segment (AIS) is a structurally and molecularly unique neuronal compartment of the proximal axon that functions as both a physiological and physical bridge between the somatodendritic and axonal domains. The AIS has two main functions: to initiate action potentials and to maintain neuronal polarity. The cytoskeletal scaffold ankyrinG is responsible for these functions and clusters ion channels at the AIS. Recent studies reveal how the AIS forms and remarkable diversity in its structure, function, and composition that may be modulated by neuronal activity and posttranslational modifications of AIS proteins. Furthermore, AIS proteins have been implicated in a variety of human diseases. Here, we discuss these findings and what they teach us about the dynamic AIS. © 2014 Elsevier Ltd.


Sittig D.F.,University of Texas Health Science Center at Houston | Singh H.,Baylor College of Medicine
New England Journal of Medicine | Year: 2012

To create a coordinated, consistent, national strategy that will address the safety issues posed by EHRs, we propose that a concerted effort be made to improve health care safety in the context of technology use. This effort should address preventable risks that may hamper endeavors to create a safer EHR-enabled health care system. Further discussion and consensus among national agencies (e.g., the Office of the National Coordinator for Health Information Technology [ONC], the AHRQ, the Joint Commission, the Centers for Medicare and Medicaid Services) is clearly necessary for the adoption of future national patient-safety goals specific to EHR use. However, this approach must be given immediate priority considering the rapid pace of EHR adoption and the resulting changes in our nation's health care system. National EHR-related patient-safety goals are needed to address current problems with existing EHR implementations and failures to leverage current EHR capabilities. For instance, the ONC has recently taken several important steps in this direction with release of the revised 2014 EHR certification criteria (e.g., emphasis on user-centered design and application of quality management systems in the EHR design and development process58). Such efforts should be expanded in the future. Goals must be technically feasible, financially prudent, and practically achievable within current constraints and be accompanied by specific guidance on achieving them. Input on these goals must be sought not only from EHR developers and clinical end users but also from cognitive scientists, human-factors engineers, graphic designers, and informaticians with expertise in patient safety in complex health care environments. Creating unique EHR-related national patient-safety goals will provide new momentum for patient-safety initiatives in an EHR-enabled health system. Copyright © 2012 Massachusetts Medical Society.


Nolan M.S.,Baylor College of Medicine | Murray K.O.,Baylor College of Medicine
Emerging Infectious Diseases | Year: 2013

We conducted an epidemiologic analysis to document West Nile virus infections among humans in Texas, USA, during 2002-2011. West Nile virus has become endemic to Texas; the number of reported cases increased every 3 years. Risk for infection was greatest in rural northwestern Texas, where Culex tarsalis mosquitoes are the predominant mosquito species.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-FP | Phase: HEALTH.2013.2.3.0-1 | Award Amount: 7.67M | Year: 2013

Approximately 600-700 million people are infected by hookworm, primarily in sub-Saharan Africa, Southeast Asia, and Latin America. Hookworm infection ranks number one in terms of Years Lost from Disability from a neglected infectious disease, and among the top 3 in terms of lost Disability-Adjusted Life Years. HOOKVAC will be developing the first and only vaccine for human hookworm infection. A bivalent, low-cost vaccine candidate will be clinically tested for the first time in an African disease endemic population. This will be done in Gabon in a very typical setting within the Central African rainforest belt, where the incidence of hookworm infections is 30%. Inspired by preparatory research, HOOKVAC believes that it can develop the vaccine with at least 80% efficacy against moderate and heavy hookworm infections that lasts at five years after immunization. Cost effectiveness modelling has shown that such a vaccine will significantly improve the efficacy of the current mass drug administration programs. HOOKVAC will play a crucial role in advancing toward large scale efficacy studies in African endemic areas. Via a program of 48 months with 6 work packages, HOOKVAC will address 4 main objectives: (1) establish safety and immunogenicity of the vaccine candidate in an endemic population (2) improve the manufacturing process (3) provide clinical proof of concept (4) improve accessibility of the vaccine in endemic areas. The involvement of European SMEs in the project is a critical component to advancing a successful vaccine, and an integral part of adding private sector know-how and scientific expertise to the project. This will inspire other European SMEs to become more involved in public/private vaccine product development for neglected infectious diseases. By doing so, HOOKVAC will fuel a follow-up programme for further development of the vaccine towards into a licensed product.


Grant
Agency: Cordis | Branch: FP7 | Program: CSA-CA | Phase: HEALTH.2010.2.1.1-2 | Award Amount: 2.29M | Year: 2011

A detailed understanding of human biology will require characterisation of the human-associated microorganisms, the human microbiome, and of the roles these microbes play in health and disease. Large projects in Europe, the United States, China and Canada target these objectives, using high throughput omics approaches. Given the complexity of our microbial communities, composed of thousands of species and differing considerably between individuals, as well as the multitude of effects they have on our biology, none of the projects can hope to achieve their comprehensive characterisation. To progress most efficiently towards this ambitious goal it is of utmost importance that the data generated in each individual project be optimally comparable across all the current projects and those yet to come. Our proposal seeks to coordinate development of standard operating procedures and protocols, which will optimize data comparisons in the human microbiome field and thus improve the synergy between all the projects. It focuses on three key aspects of data generation: (i) human sample collection, processing and identification via the associated metadata; (ii) DNA sequence quality obtained by the new generation methods from complex microbial mixtures; (iii) analysis of DNA sequence in conjunction with the metadata. Importantly, it organises public access to the standard operating procedures and protocols and enables exchanges between the users and providers of the standards. It gathers very strong international partnership that includes leaders in the field and represents the current large projects, which span three continents, Europe, Asia and America. Furthermore, it interfaces via the International Human Microbiome Consortium with additional projects from Africa and Australia. The proposal is thus highly congruent with the focus of the call, which targets omics, standards and international context.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-IP | Phase: KBBE.2013.2.2-02 | Award Amount: 13.01M | Year: 2013

Emerging evidence indicates that the gut microbiome contributes to our ability to extract energy from the diet and influences development and function of the immune, endocrine and nervous systems, which regulate energy balance and behaviour. This has led to hypothesize that developing microbiome-based dietary interventions can be cost-effective measures to prevent diet-related and behavioural disorders. Yet this approach is restricted in practice by a lack of understanding of the specific species that contribute to these disorders and their interactions with host and lifestyle determinants. To progress beyond the state of the art, the MyNewGut proposal aims to: (1) shed light on the contribution of the human microbiome to nutrient metabolism and energy expenditure; (2) identify microbiome-related features that contribute to or predict obesity and associated disorders in human epidemiological studies; (3) understand how the microbiome is influenced by environmental factors and its role in brain and immune development and function in humans; and (4) provide proof-of-concept of the disease risk-reduction potential of dietary intervention with new foods/ingredients targeting the gut microbiome in humans. To this end, a translational multidisciplinary research strategy will be developed, combining experts in omic-technologies and all other scientific disciplines required. Consequently, the MyNewGut proposal will contribute to developing new approaches to prevent diet-related diseases (metabolic syndrome and obesity) and behavioural disorders through lifestyle changes, intake of pro- and prebiotics and semi-personalised and innovative food products. This will ultimately contribute to increasing the competitiveness of the European food industry and provide consumers with reliable claims on foods. Results will also help inform new strategies on public health, support EU legislation and improve the position of the EU in the field of food-related disease prevention.


News Article | December 16, 2016
Site: www.eurekalert.org

HOUSTON - (Dec. 16, 2016) - Neuroscience and artificial intelligence experts from Rice University and Baylor College of Medicine have taken inspiration from the human brain in creating a new "deep learning" method that enables computers to learn about the visual world largely on their own, much as human babies do. In tests, the group's "deep rendering mixture model" largely taught itself how to distinguish handwritten digits using a standard dataset of 10,000 digits written by federal employees and high school students. In results presented this month at the Neural Information Processing Systems (NIPS) conference in Barcelona, Spain, the researchers described how they trained their algorithm by giving it just 10 correct examples of each handwritten digit between zero and nine and then presenting it with several thousand more examples that it used to further teach itself. In tests, the algorithm was more accurate at correctly distinguishing handwritten digits than almost all previous algorithms that were trained with thousands of correct examples of each digit. "In deep-learning parlance, our system uses a method known as semisupervised learning," said lead researcher Ankit Patel, an assistant professor with joint appointments in neuroscience at Baylor and electrical and computer engineering at Rice. "The most successful efforts in this area have used a different technique called supervised learning, where the machine is trained with thousands of examples: This is a one. This is a two. "Humans don't learn that way," Patel said. "When babies learn to see during their first year, they get very little input about what things are. Parents may label a few things: 'Bottle. Chair. Momma.' But the baby can't even understand spoken words at that point. It's learning mostly unsupervised via some interaction with the world." Patel said he and graduate student Tan Nguyen, a co-author on the new study, set out to design a semisupervised learning system for visual data that didn't require much "hand-holding" in the form of training examples. For instance, neural networks that use supervised learning would typically be given hundreds or even thousands of training examples of handwritten digits before they would be tested on the database of 10,000 handwritten digits in the Mixed National Institute of Standards and Technology (MNIST) database. The semisupervised Rice-Baylor algorithm is a "convolutional neural network," a piece of software made up of layers of artificial neurons whose design was inspired by biological neurons. These artificial neurons, or processing units, are organized in layers, and the first layer scans an image and does simple tasks like searching for edges and color changes. The second layer examines the output from the first layer and searches for more complex patterns. Mathematically, this nested method of looking for patterns within patterns within patterns is referred to as a nonlinear process. "It's essentially a very simple visual cortex," Patel said of the convolutional neural net. "You give it an image, and each layer processes the image a little bit more and understands it in a deeper way, and by the last layer, you've got a really deep and abstract understanding of the image. Every self-driving car right now has convolutional neural nets in it because they are currently the best for vision." Like human brains, neural networks start out as blank slates and become fully formed as they interact with the world. For example, each processing unit in a convolutional net starts the same and becomes specialized over time as they are exposed to visual stimuli. "Edges are very important," Nguyen said. "Many of the lower layer neurons tend to become edge detectors. They're looking for patterns that are both very common and very important for visual interpretation, and each one trains itself to look for a specific pattern, like a 45-degree edge or a 30-degree red-to-blue transition. "When they detect their particular pattern, they become excited and pass that on to the next layer up, which looks for patterns in their patterns, and so on," he said. "The number of times you do a nonlinear transformation is essentially the depth of the network, and depth governs power. The deeper a network is, the more stuff it's able to disentangle. At the deeper layers, units are looking for very abstract things like eyeballs or vertical grating patterns or a school bus." Nguyen began working with Patel in January as the latter began his tenure-track academic career at Rice and Baylor. Patel had already spent more than a decade studying and applying machine learning in jobs ranging from high-volume commodities training to strategic missile defense, and he'd just wrapped up a four-year postdoctoral stint in the lab of Rice's Richard Baraniuk, another co-author on the new study. In late 2015, Baraniuk, Patel and Nguyen published the first theoretical framework that could both derive the exact structure of convolutional neural networks and provide principled solutions to alleviate some of their limitations. Baraniuk said a solid theoretical understanding is vital for designing convolutional nets that go beyond today's state-of-the-art. "Understanding video images is a great example," Baraniuk said. "If I am looking at a video, frame by frame by frame, and I want to understand all the objects and how they're moving and so on, that is a huge challenge. Imagine how long it would take to label every object in every frame of a video. No one has time for that. And in order for a machine to understand what it's seeing in a video, it has to understand what objects are, the concept of three-dimensional space and a whole bunch of other really complicated stuff. We humans learn those things on our own and take them for granted, but they are totally missing in today's artificial neural networks." Patel said the theory of artificial neural networks, which was refined in the NIPS paper, could ultimately help neuroscientists better understand the workings of the human brain. "There seem to be some similarities about how the visual cortex represents the world and how convolutional nets represent the world, but they also differ greatly," Patel said. "What the brain is doing may be related, but it's still very different. And the key thing we know about the brain is that it mostly learns unsupervised. "What I and my neuroscientist colleagues are trying to figure out is, What is the semisupervised learning algorithm that's being implemented by the neural circuits in the visual cortex? and How is that related to our theory of deep learning?" he said. "Can we use our theory to help elucidate what the brain is doing? Because the way the brain is doing it is far superior to any neural network that we've designed." The research was funded by the Director of National Intelligence's Intelligence Advanced Research Projects Activity, the National Science Foundation, the Air Force Office of Science and Research, the Army Research Office and the Office of Naval Research. High-resolution IMAGES are available for download at: http://news. CAPTION: From left, Richard Baraniuk, Tan Nguyen and Ankit Patel. (Photo by Jeff Fitlow/Rice University) http://news. CAPTION: From left, Richard Baraniuk, Tan Nguyen and Ankit Patel. (Photo by Jeff Fitlow/Rice University) This release can be found online at news.rice.edu. Located on a 300-acre forested campus in Houston, Rice University is consistently ranked among the nation's top 20 universities by U.S. News & World Report. Rice has highly respected schools of Architecture, Business, Continuing Studies, Engineering, Humanities, Music, Natural Sciences and Social Sciences and is home to the Baker Institute for Public Policy. With 3,910 undergraduates and 2,809 graduate students, Rice's undergraduate student-to-faculty ratio is 6-to-1. Its residential college system builds close-knit communities and lifelong friendships, just one reason why Rice is ranked No. 1 for happiest students and for lots of race/class interaction by the Princeton Review. Rice is also rated as a best value among private universities by Kiplinger's Personal Finance. To read "What they're saying about Rice," go to http://tinyurl. .


HOUSTON - (March 2, 2017) - The University of Texas Health Science Center at Houston (UTHealth), in collaboration with the Human Genome Sequencing Center at Baylor College of Medicine (HGSC), is a participant in a $500 million program of the National Heart, Lung, and Blood Institute (NHLBI) Trans-Omics for Precision Medicine (TOPMed) program to bring whole genome sequencing and other "omic" technologies that monitor the expression of the genome in response to the environment to the forefront of clinical research. Through its TOPMed program, NHLBI is expanding its dedication to advancing the understanding of the underpinnings of complex diseases and how they develop. Previously, the HGSC was awarded funding by NHLBI to sequence whole genomes for TOPMed studies such as sickle cell disease, and venous thromboembolism and will continue to expand this effort in the next phase of the program. The new contract will span five years. In addition to the whole genome sequencing component, the TOPMed program will also provide analysis of other datatypes over the course of the contract period, including RNA transcription sequencing, DNA methylation, metabolomics profiles, and other "omics," including analysis of the microbiome. The initial award from NHLBI supports the whole genome sequencing of 20,000 samples at the HGSC in the first year of the program. To support this trans-omic approach, the HGSC will continue its ongoing collaboration with the Alkek Center for Metagenomics and Microbiome Research (CMMR) at Baylor and UTHealth School of Public Health, which would aid in executing the methylation and metabolomics tasks. The team was deemed eligible to perform all elements of these additional analyses. "The TOPMed program and resulting data will allow us to better understand the link between pediatric and adult disease genes, thereby creating enhanced diagnostics for adult diseases and disorders. There are direct clinical applications to improve and individualize care for these adult diseases within the Texas Medical Center," said Eric Boerwinkle, Ph.D., dean of UTHealth School of Public Health and associate director of the HGSC. "There is a significant need for large sample sizes; a need that goes beyond the research setting and into the clinic," said Richard Gibbs, Ph.D., director of the HGSC and professor of molecular and human genetics at Baylor. "We are grateful to be a part of the TOPMed program which will allow us to access this large sample number and obtain valuable insights into adult heart disease, sickle cell disease, atrial fibrillation and other heart, lung and hematologic disorders." The HGSC has been operational for more than 20 years, gaining international recognition as a large-scale DNA sequencing and analysis center, and is currently a Center for Complex Disease Genomics supported by the National Institutes of Health and the National Human Genome Research Institute. A key mission of the HGSC is to use genetic approaches to guide discovery and diagnosis of human disease, which offers insight into new therapeutic strategies, echoing the bench-to-bedside framework that is the foundation of the national Precision Medicine Initiative. This mission has been greatly enhanced and facilitated by a collaboration with Boerwinkle, who leads a group of population and data scientists at UTHealth with expertise in analyzing genomic information to discover new disease genes and improve diagnosis. The TOPMed project will better enable the HGSC and UTHealth to pursue this mission to move adult whole genome sequencing into the clinical setting, supporting the advance of precision medicine. The whole genome and other data made available by TOPMed has the capability to be analyzed to provide a more comprehensive picture of what factors may lead to, or protect against, common disease development. The UTHealth team is one of four analysis centers in the country catalyzing new discoveries using this data. The flow of data will begin with the HGSC, which will receive samples from NHLBI investigators. The HGSC will perform the whole genome sequencing, and is eligible for RNA sequencing, operably distributing the samples to UTHealth for methylation and metabolomics profiling, and to Baylor's CMMR for metagenomic analysis as program needs dictate. The data from all three sources would then be funneled into a data sharing portal and relayed back to TOPMed. -Adapted from a news release by Baylor College of Medicine


News Article | November 21, 2016
Site: www.eurekalert.org

A cellular component known as the Golgi apparatus may play a role in how lung cancer metastasizes, according to researchers at The University of Texas MD Anderson Cancer Center whose findings were reported in the Nov. 21 online issue of the Journal of Clinical Investigation. The Golgi apparatus, often referred to as a cellular "post office" for its ability to package proteins into vesicles for transportation to other sites within or outside the cell, may offer a new therapeutic approach for preventing metastasis. Think of vesicles as miniature mail trucks composed of a fatty shell filled with secretory liquids that travel from the Golgi to destinations within the cell where their contents are put to use. The Golgi can appear as a compacted membranous "stack" near the cell's nucleus or as a dispersed system of interconnected membranes. Vesicles can "bud" from the Golgi in either form. "Our findings show that certain proteins in the Golgi that control Golgi compaction may actually promote vesicle budding and transport and enhance the tumor cell's ability to metastasize" said Jonathan Kurie, M.D., professor of Thoracic Head and Neck Medical Oncology. "These findings highlight the potential utility of targeting certain cellular processes in the Golgi." According to Kurie, tumor cells gain their metastatic ability through a Golgi-related process driving the budding and transport of secretory vesicles. Unknown before this study was whether Golgi compaction was responsible for vesicular trafficking leading to metastasis. This study shows that Golgi compaction is associated with EMT or epithelial-to-mesenchymal transition, a process that allows a cell to detach and move away from its neighbors during wound healing and other normal processes and is thought to play a role in cancer cell migration. Using lung adenocarcinoma cell lines isolated from mice and patients, Kurie's team found that EMT depends on a Golgi protein called PAQR11 for successful tumor cell migration and metastasis in lung cancers. "We concluded that, through PAQR11, tumor cells can hijack a normal Golgi compaction process in order to gain metastatic ability," said Kurie. MD Anderson study team participants included Xiaochao Tan, Ph.D.; Priyam Banerjee; Ph.D., Hou-Fu Guo, Ph.D.; Daniela Pankova, Ph.D.; Xin Liu, Ph.D.;Yongming Xue, Jonathon Roybal and Don Gibbons, M.D., all of Thoracic Head and Neck Medical Oncology; Tomasz Zal, Ph.D., Immunology; and Chad Creighton, Ph.D., Bioinformatics and Computational Biology. Other participating institutions include the University of Michigan, Ann Arbor, Mich.; Ewha Woman's University School of Medicine, Seoul, South Korea; University of York, York, U.K.; Harbin Medical University Cancer Hospital, Harbin, China; University of Houston and Baylor College of Medicine, Houston. The study was funded by the National Institutes of Health (R01CA181184, R01CA125123, GM087364, GM105920, GM112786P30, EY007551, K08CA151661, NRF-2010-0027945, CA015672, 1S10OD012304-01, and 1S10RR09552-01), the American Cancer Society (RGS-09-278-01-CSM), the Cancer Prevention Research Institute of Texas (RP120713), and MCubed and the Fastforward Protein Folding Disease Initiative at the University of Michigan.


News Article | November 22, 2016
Site: www.rdmag.com

Scientists from Rice University, Baylor College of Medicine and other institutions are using synthetic biology to capture elusive, short-lived snippets of DNA that healthy cells produce on their way to becoming cancerous. Researchers said the work could lead to the development of new drugs that could prevent cancer by neutralizing "DNA intermediates," key pieces of genetic code that are produced when healthy cells become cancerous. The research is described in a new paper in the open-access journal Science Advances. "In my lab we study how the genome -- the genes in an organism -- changes, in particular, how the genome of normal cells changes to transform the cells into cancerous cells," said project lead scientist Susan Rosenberg, Baylor's Ben F. Love Chair in Cancer Research and the leader of the Cancer Evolvability Program at Baylor's Dan L Duncan Comprehensive Cancer Center. When cells divide and make copies of the instructions encoded in their DNA, the DNA unwinds and becomes vulnerable to damage that must be repaired. Sometimes the process of repairing the DNA can also cause mutations and errors. When these errors accumulate, the cells may acquire characteristics of cancer. "The process of editing the DNA is carried out by specific enzymes -- proteins that work on DNA to fix the mistakes," said Rosenberg, who is also an adjunct professor in Rice's Department of BioSciences. She said DNA repair usually takes several steps to complete. Between the original DNA and the final product, cells produce DNA reaction intermediates, which are crucial to the reaction but are difficult to study because they are present for just a fraction of a second as an enzyme catalyzes the changing of one molecule into another. "The intermediate molecules are the most important parts of biochemical reactions," said Rosenberg, who holds appointments in Baylor's departments of Molecular and Human Genetics, Molecular Virology and Microbiology, and Biochemistry and Molecular Biology. "They define what the reaction is and how it will proceed. But because they are transient and elusive, it's really difficult to study them, especially in living cells. We wanted to do that. We decided to invent synthetic proteins that would trap DNA reaction intermediates in living cells." Qian Mei, a graduate student in Rice's Systems, Synthetic and Physical Biology program and a research assistant in the Rosenberg lab, took on the task of applying the synthetic protein that could capture the short-lived intermediates. Using the tools of synthetic biology, Rosenberg and colleagues created and added packages of genes to Escherichia coli, an organism that Rosenberg's group and others have shown to be a reliable model of the genetic changes that occur in animal cells. Rosenberg said other investigators also have attempted to trap intermediates, but they have only succeeded in a few biochemical reactions. "We want to use synthetic proteins to study mechanisms that change DNA sequence," she said. "We do that now with genetics and genomics in my lab. But genomics, which allows us to compare the genes of normal cells with those of cancerous cells, is like reading the fossil record of these processes. We want to see how the real-time processes that change DNA happen, including all the intermediate steps, which our synthetic proteins allow us to freeze in time and isolate." In their tests on , Mei, Rosenberg and colleagues from Baylor, the University of Texas at Austin and the University of Texas MD Anderson Cancer Center found they could discover molecular mechanisms underlying genome instability, a hallmark of cancer. In one instance, they discovered a new role for an protein that is related to five human cancer proteins. They then analyzed gene-expression data from human cancers and were able to implicate two of the five -related human cancer proteins in potentially promoting cancer by a similar mechanism -- one not previously implicated. "The most exciting part in this paper for me is that we can learn something new about the mechanisms of cancer from the model," said Mei, co-first author of the new paper. "Even though bacteria and human cells are very different, many DNA repair proteins are highly conserved through evolution; this makes a good model to study how cells repair DNA or accumulate mutations." Rosenberg and colleagues think that their approach offers significant advantages. For instance, with the synthetic proteins, they have been able to identify specific DNA-repair intermediate molecules, their numbers in cells, rates of formation and locations in the genome and the molecular reactions in which they participate. "It is most exciting that we are now able to trap, map and quantify transient DNA reaction intermediates in single living cells," said co-first author Jun Xia, graduate student in the Rosenberg lab and in the Integrative Molecular and Biomedical Sciences program at Baylor. "This new technology helps us reveal the origins of genome instability." "When you know these reactions and the role each intermediate plays in the mechanisms that change DNA, you can think about making drugs that will stop them," Rosenberg said. "In the future, we hope we will be able to design drugs that target specific types of cancers -- drugs that block the cells' ability to evolve into cancer cells, instead of, or in addition to, traditional chemotherapies that kill or stop cancer cells from growing."


News Article | November 18, 2016
Site: www.eurekalert.org

HOUSTON -- (Nov. 18, 2016) -- Scientists from Rice University, Baylor College of Medicine and other institutions are using synthetic biology to capture elusive, short-lived snippets of DNA that healthy cells produce on their way to becoming cancerous. Researchers said the work could lead to the development of new drugs that could prevent cancer by neutralizing "DNA intermediates," key pieces of genetic code that are produced when healthy cells become cancerous. The research is described in a new paper in the open-access journal Science Advances. "In my lab we study how the genome -- the genes in an organism -- changes, in particular, how the genome of normal cells changes to transform the cells into cancerous cells," said project lead scientist Susan Rosenberg, Baylor's Ben F. Love Chair in Cancer Research and the leader of the Cancer Evolvability Program at Baylor's Dan L Duncan Comprehensive Cancer Center. When cells divide and make copies of the instructions encoded in their DNA, the DNA unwinds and becomes vulnerable to damage that must be repaired. Sometimes the process of repairing the DNA can also cause mutations and errors. When these errors accumulate, the cells may acquire characteristics of cancer. "The process of editing the DNA is carried out by specific enzymes -- proteins that work on DNA to fix the mistakes," said Rosenberg, who is also an adjunct professor in Rice's Department of BioSciences. She said DNA repair usually takes several steps to complete. Between the original DNA and the final product, cells produce DNA reaction intermediates, which are crucial to the reaction but are difficult to study because they are present for just a fraction of a second as an enzyme catalyzes the changing of one molecule into another. "The intermediate molecules are the most important parts of biochemical reactions," said Rosenberg, who holds appointments in Baylor's departments of Molecular and Human Genetics, Molecular Virology and Microbiology, and Biochemistry and Molecular Biology. "They define what the reaction is and how it will proceed. But because they are transient and elusive, it's really difficult to study them, especially in living cells. We wanted to do that. We decided to invent synthetic proteins that would trap DNA reaction intermediates in living cells." Qian Mei, a graduate student in Rice's Systems, Synthetic and Physical Biology program and a research assistant in the Rosenberg lab, took on the task of applying the synthetic protein that could capture the short-lived intermediates. Using the tools of synthetic biology, Rosenberg and colleagues created and added packages of genes to Escherichia coli, an organism that Rosenberg's group and others have shown to be a reliable model of the genetic changes that occur in animal cells. Rosenberg said other investigators also have attempted to trap intermediates, but they have only succeeded in a few biochemical reactions. "We want to use synthetic proteins to study mechanisms that change DNA sequence," she said. "We do that now with genetics and genomics in my lab. But genomics, which allows us to compare the genes of normal cells with those of cancerous cells, is like reading the fossil record of these processes. We want to see how the real-time processes that change DNA happen, including all the intermediate steps, which our synthetic proteins allow us to freeze in time and isolate." In their tests on , Mei, Rosenberg and colleagues from Baylor, the University of Texas at Austin and the University of Texas MD Anderson Cancer Center found they could discover molecular mechanisms underlying genome instability, a hallmark of cancer. In one instance, they discovered a new role for an protein that is related to five human cancer proteins. They then analyzed gene-expression data from human cancers and were able to implicate two of the five -related human cancer proteins in potentially promoting cancer by a similar mechanism -- one not previously implicated. "The most exciting part in this paper for me is that we can learn something new about the mechanisms of cancer from the model," said Mei, co-first author of the new paper. "Even though bacteria and human cells are very different, many DNA repair proteins are highly conserved through evolution; this makes a good model to study how cells repair DNA or accumulate mutations." Rosenberg and colleagues think that their approach offers significant advantages. For instance, with the synthetic proteins, they have been able to identify specific DNA-repair intermediate molecules, their numbers in cells, rates of formation and locations in the genome and the molecular reactions in which they participate. "It is most exciting that we are now able to trap, map and quantify transient DNA reaction intermediates in single living cells," said co-first author Jun Xia, graduate student in the Rosenberg lab and in the Integrative Molecular and Biomedical Sciences program at Baylor. "This new technology helps us reveal the origins of genome instability." "When you know these reactions and the role each intermediate plays in the mechanisms that change DNA, you can think about making drugs that will stop them," Rosenberg said. "In the future, we hope we will be able to design drugs that target specific types of cancers -- drugs that block the cells' ability to evolve into cancer cells, instead of, or in addition to, traditional chemotherapies that kill or stop cancer cells from growing." Other contributors to the work include Li-Tzu Chen, Chien-Hui Ma, Jennifer Halliday, Hsin-Yu Lin, David Magnan, John Pribis, Devon Fitzgerald, Holly Hamilton, Megan Richters, Ralf Nehring, Xi Shen, Lei Li, David Bates, P.J. Hastings, Christophe Herman and Makkuni Jayaram. The research was supported by the WM Keck Foundation, the National Institutes of Health, NASA, the Cancer Prevention and Research Institute of Texas, the National Science Foundation, the Welch Foundation, Baylor College of Medicine, the Dan L Duncan Comprehensive Cancer Center and the John S. Dunn Gulf Coast Consortium for Chemical Genomics. VIDEO is available at: High-resolution IMAGES are available for download at: CAPTION: (From left) Baylor College of Medicine's Susan Rosenberg discusses research aimed at capturing elusive, short-lived "DNA intermediates," key pieces of genetic code that are produced when healthy cells become cancerous, with Baylor graduate student Jun Xia and Rice University graduate student Qian Mei, who are co-first authors on a new paper about the work in Science Advances. (Photo courtesy of Baylor College of Medicine) CAPTION: The orange wheel shows the circular chromosome or genome of bacteria. The spikes indicate where a molecular intermediate in DNA repair -- four-way DNA junctions -- accumulate near a reparable double strand break in the genome. (Image courtesy of Jun Xia and Qian Mei) The DOI of the Science Advances paper is: 10.1126/sciadv.1601605 A copy of the paper is available at: http://advances. This release can be found online at news.rice.edu. Located on a 300-acre forested campus in Houston, Rice University is consistently ranked among the nation's top 20 universities by U.S. News & World Report. Rice has highly respected schools of Architecture, Business, Continuing Studies, Engineering, Humanities, Music, Natural Sciences and Social Sciences and is home to the Baker Institute for Public Policy. With 3,910 undergraduates and 2,809 graduate students, Rice's undergraduate student-to-faculty ratio is 6-to-1. Its residential college system builds close-knit communities and lifelong friendships, just one reason why Rice is ranked No. 1 for happiest students and for lots of race/class interaction by the Princeton Review. Rice is also rated as a best value among private universities by Kiplinger's Personal Finance. To read "What they're saying about Rice," go to http://tinyurl. .


News Article | November 11, 2016
Site: www.eurekalert.org

The feeding habits responsible for the ecological success of the Asian long-horned beetle have been pinned down to their unique genes, according to new research published by the open access journal Genome Biology. By comparing the genome of the Asian long-horned beetle with 14 other insects, the researchers were able to identify a suite of genes, some unique to this species, that aid the digestion of woody plant material and are likely responsible for the beetles ability to thrive in woodland regions all over the world. The Asian long-horned beetle is a globally invasive species capable of inflicting severe damage on many economically important trees. The potential economic impact in the United States, if uncontrolled, has been estimated at $889 billion. Dr Duane McKenna, co-lead author from the University of Memphis, said: "Our detailed genomic analysis reveals that the Asian long-horned beetle has over 1,000 genes that aren't present in any other arthropod. We identified a total of 86 genes for enzymes called glycoside hydrolases - more than have been found in any other insect. These enzymes enable the beetle to digest woody plant material and detoxify plant chemicals and so indicate a genetic reason for their apparent success in feeding on trees worldwide". Wood is a poor source of nutrients so any organism capable of surviving on a diet of woody plant material must have evolved unique characteristics that allow effective digestion and maximum extraction of energy. Dr McKenna added: "The arsenal of glycoside hydrolase enzymes that the Asian long-horned beetle has allows it to degrade all of the main polysaccharides present in plant cell walls, releasing the sugars it needs for energy. Importantly, the range of enzymes this beetle has is highly diverse, which we believe allows it to breakdown many different molecules present across a wide range of woody plants." The Asian long-horned beetle completes its entire development living and feeding within the wood of trees. In its earliest stage the larvae are specialized wood-borers, feeding on plant tissue under the bark. Later in its life cycle the larvae tunnel deeper into the wood where they continue to feed throughout their development. Adult beetles emerge from the tree and spend their relatively short life-span feeding on external parts of the tree. Dr Stephen Richards, co-lead author from Baylor College of Medicine Human Genome Sequencing Center in Texas, United States, said: "In this case, when we fed beetle larvae on wood material from sugar maple trees we found that the activity of the glycoside hydrolase genes was increased, something not seen in larvae fed on an artificial diet. This experiment, along with our complementary analysis of the beetle genome, also revealed the specific set of genes, called CYP450 genes, which are involved in the detoxification of compounds encountered by the beetle when feeding on plant tissues." The Asian long-horned beetle, also known as Anoplophora glabripennis, belongs to the longhorn beetle family, which contains over 35,000 different species, making it the most diverse group of wood-feeding animals on Earth. According to the researchers this study has established a genomic basis for the invasiveness of the Asian long-horned beetle as well as the evolutionary success of beetles that feed on woody plants. Additionally, the identification of genes linked to key digestive and detoxification processes will ultimately provide novel tools for management of the Asian long-horned beetle and other invasive wood-boring pests. Dr Richards added: "This publically available genome is part of a larger group as a pilot for the i5K initiative to sequence 1000's of insects. We hope that in the long term this foundation information about how any species works can be made available to anyone interested in biology, from researchers addressing specific questions to high-school students and hobbyist entomologists at home." 1. Images of the Asian long-horned beetle are available here: https:/ Please credit image 1, 2 and 3 to David Lance. Please credit image 4 to Yunke Wu. 2. Research article: Genome of the Asian longhorned beetle (Anoplophora glabripennis), a globally significant invasive species, reveals key functional and evolutionary innovations at the beetle-plant interface Stephen Richards, Duane McKenna et al. Genome Biology 2016 During embargo period please contact Matthew Lam for a copy of the article. After the embargo lifts, the article will be available at the journal website here: https:/ Please name the journal in any story you write. If you are writing for the web, please link to the article. All articles are available free of charge, according to BioMed Central's open access policy. 3. Genome Biology publishes outstanding research in all areas of biology and biomedicine studied from a genomic and post-genomic perspective. The current impact factor is 11.313 and the journal is ranked 4th among research journals in the Genetics and Heredity category by Thomson Reuters. Genome Biology is the highest ranked Open Access journal in the category. 4. BioMed Central is an STM (Science, Technology and Medicine) publisher which has pioneered the open access publishing model. All peer-reviewed research articles published by BioMed Central are made immediately and freely accessible online, and are licensed to allow redistribution and reuse. BioMed Central is part of Springer Nature, a major new force in scientific, scholarly, professional and educational publishing, created in May 2015 through the combination of Nature Publishing Group, Palgrave Macmillan, Macmillan Education and Springer Science+Business Media. http://www.


News Article | November 18, 2016
Site: www.eurekalert.org

HOUSTON - (Nov. 17, 2016) - Texas has experienced a roughly 6 percentage-point increase in health insurance coverage from the Affordable Care Act (ACA), according to new research by experts at Rice University and the Episcopal Health Foundation (EHF). This translates into just under 1 million Texans who have gained coverage due to President Barack Obama's health care law. The new findings published in the American Journal of Public Health examined the effects of the ACA's Marketplace on Texas residents and determined which population subgroups benefited the most and the least. "The recent criticism of the program's high premiums for next year ignores the benefits the legislation has provided to many Texans and the fact that policymakers are now identifying options to slow that premium growth," said research co-author Vivian Ho, the chair in health economics at Rice's Baker Institute for Public Policy and director of the institute's Center for Health and Biosciences. The researchers analyzed insurance coverage rates among nonelderly Texas adults using the Health Reform Monitoring Survey-Texas from September 2013, just before the first open-enrollment period in the marketplace, through March 2016. They found that gains have been uneven and that the four subgroups with the largest increases in adjusted insurance coverage between 2013 and 2016 were people ages 50 to 64 years (12.1 percentage points), Hispanics (10.9 percentage points), people reporting fair or poor health status (10.2 percentage points) and those with a high school diploma as their highest educational attainment (9.2 percentage points). "Even with these gains, 3 million Texans between the ages of 19 and 64 remain uninsured," said co-author Elena Marks, EHF's president and CEO and a nonresident health policy fellow at the Baker Institute. "An estimated 766,000 of these would likely have gained coverage if Texas had elected the Medicaid expansion offered under the ACA." President-elect Donald Trump and congressional Republicans have announced their intent to repeal Obamacare. "Moving quickly to repeal the law would jeopardize the policies of the 1 million Texans who have already gained coverage, and would do nothing for the 3 million who are still uninsured," Ho said. "The ACA was designed to be budget neutral for the federal government -- subsidies for people to buy coverage were covered by taxes on insurance companies, medical device makers and others, as well as lower increases in reimbursement rates for Medicare providers. A Republican alternative that is equally successful in covering so many individuals will require careful thought on how this coverage can be paid for without adding to the federal debt." On the federal level, policymakers should focus on reining in price growth from drug manufacturers, as well as physicians and hospitals, Ho said. "At the state level, Texas may have an improved chance at obtaining an extension on its Medicaid waiver beyond 2017 that will allow it to continue receiving federal dollars to provide health care for the poor, without a formal link to President Barack Obama's Medicaid expansion," she said. "This approach is likely economically inefficient, but politically expedient to those in office." "Gain in Insurance Coverage and Residual Uninsurance Under the Affordable Care Act: Texas, 2013-2016" was also co-authored by Stephen Pickett, a doctoral student in Rice's Economics Department. Ho is also a professor of economics at Rice and a professor of medicine at Baylor College of Medicine. For more information, to receive a copy of the study or to schedule an interview with Ho, contact Jeff Falk, associate director of national media relations at Rice, at jfalk@rice.edu or 713-348-6775. Follow the Center for Health and Biosciences via Twitter @BakerCHB. Founded in 1993, Rice University's Baker Institute ranks among the top five university-affiliated think tanks in the world. As a premier nonpartisan think tank, the institute conducts research on domestic and foreign policy issues with the goal of bridging the gap between the theory and practice of public policy. The institute's strong track record of achievement reflects the work of its endowed fellows, Rice University faculty scholars and staff, coupled with its outreach to the Rice student body through fellow-taught classes -- including a public policy course -- and student leadership and internship programs. Learn more about the institute at http://www. or on the institute's blog, http://blogs. .


SAN ANTONIO -- A sentinel lymph node biopsy (SLNB) during surgery that showed no signs of cancer was associated with a low risk for breast cancer recurrence in the axillary (armpit) lymph nodes for patients with large, operable breast tumors and no clinical signs of the cancer in the axillary lymph nodes prior to neoadjuvant (presurgery) chemotherapy, according to data from the GANEA 2 clinical trial presented at the 2016 San Antonio Breast Cancer Symposium, held Dec. 6-10. "Axillary lymph node dissection (ALND), which is an invasive surgical procedure in which many of the lymph nodes in the armpit are removed, is often performed to check whether a patient's cancer has spread outside the breast after neoadjuvant chemotherapy," said Jean-Marc Classe, MD, PhD, head of surgery at the Institut de Cancerologie de l'Ouest René Gauducheau in Nantes, France. "ALND has a high risk for serious complications and long-term sequelae. So we wanted to assess the feasibility and safety of the less invasive procedure of SLNB for patients treated with neoadjuvant chemotherapy for a large breast cancer. "We found that for patients with no proof of cancer in the axillary lymph nodes before neoadjuvant chemotherapy, SLNB during the surgery after neoadjuvant chemotherapy was safe because those who had a negative SNLB and did not have an ALND had a very low risk of an axillary relapse at three years after surgery," continued Classe, who is also professor of oncology at the Medical University in Nantes. "We had expected more axillary lymph node relapses than we observed, so this is very exciting and will hopefully mean that more patients are spared the potential complications of invasive ALND." Classe and colleagues enrolled in the trial 590 patients with large, operable breast tumors who had no cancer in the lymph nodes as determined by axillary sonography with fine needle cytology. All patients received neoadjuvant chemotherapy and then underwent surgery and SLNB. Cancer cells were detected in the SLNB samples from 139 patients. These patients all then underwent ALND. No cancer cells were detected in the SLNB samples from 432 patients. Among these 432 patients, follow-up was available for 416. Median follow-up for these patients was 35.8 months. At three years, disease-free survival in the patients who had no cancer in the SLNB sample and, therefore, did not receive ALND was 94.8 percent. One patient had homolateral axillary lymph node relapse. The other nine relapses were metastatic (n=3) or recurrences in the breasts (n=6). Overall survival was 98.7 percent. "The disease-free and overall survival results we observed for the patients who underwent only an SLNB after neoadjuvant chemotherapy are comparable with the historical survival rates for patients in this situation who have ALND rather than SLNB," said Classe. "Therefore, an ALND could be avoided by patients who have no signs of cancer in the axillary lymph nodes following a sonographic axillary assessment prior to neoadjuvant chemotherapy and SLNB during surgery after neoadjuvant chemotherapy." Classe noted that longer follow-up of the patients is needed to further confirm the safety of SLNB for these patients. This study was funded by a grant from the Institut National du Cancer. Classe declares no conflicts of interest. Title: Sentinel node detection after neoadjuvant chemotherapy in patient without previous axillary node involvement (GANEA 2 trial): follow-up of a prospective multi-institutional cohortPresentation: Wednesday, Dec. 7, General Session 2 - Hall 3, 4:45 p.m. CT To interview Jean-Marc Classe, contact Julia Gunther at julia.gunther@aacr.org or 267-250-5441. The mission of the 2016 San Antonio Breast Cancer Symposium is to produce a unique and comprehensive scientific meeting that encompasses the full spectrum of breast cancer research, facilitating the rapid translation of new knowledge into better care for patients with breast cancer. The Cancer Therapy & Research Center (CTRC) at The University of Texas Health Science Center at San Antonio, the American Association for Cancer Research (AACR), and Baylor College of Medicine are joint sponsors of the San Antonio Breast Cancer Symposium. This collaboration utilizes the clinical strengths of the CTRC and Baylor and the AACR's scientific prestige in basic, translational, and clinical cancer research to expedite the delivery of the latest scientific advances to the clinic. For more information about the symposium, please visit http://www. .


-       Breakthrough Prize celebra su 5 aniversario con los principales logros en ciencias y otorga premios por 25 millones de dólares en una ceremonia de gala celebrada en Silicon Valley New Horizons in Physics Prize otorgado a Asimina Arvanitaki, Peter W. Graham y Surjeet Rajendran; Simone Giombi y Xi Yin y Frans Pretorius New Horizons in Mathematics Prize otorgado a Mohammad Abouzaid, Hugo Duminil-Copin y Benjamin Elias y Geordie Williamson La segunda edición anual del International Breakthrough Junior Challenge se ha otorgado a las estudiantes femeninas Antonella Masini, 18 (Perú) y Deanna See, 17 (Singapur) 2016 Special Breakthrough Prize in Fundamental Physics, otorgado en mayo a los fundadores y miembros del equipo de LIGO, otorgado a Kip Thorne, Rainer Weiss y la familia de Ronald Drever Los premiados serán galardonados en la resplandeciente gala de premios hospedada por medio Morgan Freeman, con actuaciones en directo de Alicia Keys y presentaciones a cabo de Daniel Ek (consejero delegado de Spotify), Jeremy Irons, Mark y Scott Kelly, Hiroshi Mikitani (consejero delegado de Rakuten), Sienna Miller, Bryce Dallas Howard, Vin Diesel, Kevin Durant, Dev Patel, Sundar Pichai (consejero delegado de Google), Alex Rodriguez, Will.i.am, Susan Wojcicki (consejera delegada de YouTube) y los fundadores del Breakthrough Prize SAN FRANCISCO, 9 de diciembre de 2016 /PRNewswire/ -- El Breakthrough Prize y los fundadores Sergey Brin y Anne Wojcicki, Yuri y Julia Milner, y Mark Zuckerberg y Priscilla Chan, anunciaron anoche a los receptores de los 2017 Breakthrough Prizes, marcando así el 5 aniversario de la organización que reconoce los logros principales en Ciencias de la Vida, Física Fundamental y Matemáticas. Una cifra combinada total de 25 millones de dólares se otorgó en la ceremonia de gala en Silicon Valley, hospedada por medio de Morgan Freeman. Cada uno de los Breakthrough Prizes tiene un valor de 3 millones de dólares, el premio en metálico individual más grande dentro de la ciencia. Este año, se han otorgado un total de siete premios a nueve personas, junto con un Special Breakthrough Prize in Fundamental Physics de 3 millones de dólares, que se dividió entre los tres fundadores y más de 1.000 miembros del equipo LIGO. Además, se otorgaron tres New Horizons in Physics Prizes de 100.000 dólares para seis físicos en sus inicios de carrera, y otros tres New Horizons in Mathematics Prizes de 100.000 dólares otorgados a cuatro jóvenes matemáticos. Y este año, hubo dos ganadores del Breakthrough Junior Challenge, recibiendo cada uno de ellos hasta 400.000 dólares en premios de formación para ellos, su profesor y su escuela. Desde su creación en el año 2012, el Breakthrough Prize ha otorgado cerca de 200 millones de dólares para honrar el avance de la investigación del paradigma en los campos de la física fundamental, ciencias de la vida y matemáticas. "Nunca ha habido un momento más importante en el que apoyar la ciencia", destacó el fundador de Facebook, Mark Zuckerberg. "Los premiados con el 2017 Breakthrough Prize representan a los líderes en los campos de la investigación científica en física, matemáticas y ciencias de la vida. Sus descubrimientos desvelarán nuevas posibilidades y ayudarán a conseguir que el mundo sea un lugar mejor para todos". El 2017 Breakthrough Prize in Life Sciences fue otorgado a Stephen J. Elledge (Harvard Medical School); Harry F. Noller (University of California, Santa Cruz); Roeland Nusse (Stanford University); Yoshinori Ohsumi (Tokyo Institute of Technology); Huda Yahya Zoghbi (Baylor College of Medicine). El 2017 Breakthrough Prize in Fundamental Physics fue otorgado a Joseph Polchinski (University of California, Santa Barbara); Andrew Strominger (Harvard University) y Cumrun Vafa (Harvard University). Los tres premiados se unieron a los receptores del Special Prize in Fundamental Physics anunciados anteriormente, lanzado en mayo de 2016. Ronald Drever (California Institute of Technology, Pasadena), Kip Thorne (California Institute of Technology, Pasadena) y Rainer Weiss (Massachusetts Institute of Technology), fueron reconocidos en mayo por su detección de las olas gravitacionales, abriendo con ello nuevos horizontes en astronomía y física. Los tres ganadores del Special Prize compartirán un premio de 1 millón de dólares, y los 1.012 miembros del equipo LIGO compartirán 2 millones de dólares. El 2017 Breakthrough Prize in Mathematics fue otorgado a Jean Bourgain (Institute for Advanced Study). La ceremonia de este año marcará el 5 aniversario de la organización, y los premiados tomarán el escenario esta noche durante una gala exclusiva celebrada de forma conjunta con los fundadores Sergey Brin y Anne Wojcicki, Yuri y Julia Milner, Mark Zuckerberg y Priscilla Chan, además del editor de Vanity Fair, Graydon Carter. El actor ganador del Academy Award®, Morgan Freeman, hospedará el show, que contará con la actuación de la ganadora de 15 Grammy Award®, Alicia Keys, y los famosos presetadores Jeremy Irons, Mark y Scott Kelly, Hiroshi Mikitani (consejero delegado de Rakuten), Sienna Miller, Bryce Dallas Howard, Vin Diesel, Kevin Durant, Dev Patel, Sundar Pichai (consejero delegado de Google), Alex Rodriguez, Will.i.am, Susan Wojcicki (consejera delegada de YouTube), además de los fundadores del Breakthrough Prize. El tema de la noche será "the universal reach of ideas". "La ciencia es universal", destacó Yuri Milner. "Esta noche ha reunido a algunos de los mejores actores, deportistas, músicos, académicos, empresarios, astronautas y finalmente pero no por ello menos importante, científicos, para celebrar lo que la mente humana puede conseguir. Y lo ha hecho por medio de un evento en directo emitido en todo el planeta". Uno de estos puntos álgidos serán los discursos de dos estudiantes femeninas que han ganado el Breakthrough Junior Challenge, Antonella Masini, 18 (Perú) y Deanna See, 17 (Singapur). El Breakthrough Junior Challenge es una competición de video de ciencias de nivel mundial diseñado para inspirar el pensamiento creativo acerca de los conceptos fundamentales en las ciencias de la vida, física o matemáticas. Como reconocimiento a sus envíos ganadores, ambas estudiantes recibieron hasta 400.000 dólares en premios de formación, incluyendo una beca con un valor de 250.000 dólares, 50.000 dólares para un profesor inspirador y un laboratorio de última tecnología valorado en 100.000 dólares. Las participaciones procedentes de 146 países fueron recibidas en la entrega de 2016 de la competición final, que se puso en marcha el 1 de septiembre de 2016. El Breakthrough Junior Challenge cuenta con los fondos Mark Zuckerberg y Priscilla Chan, y Yuri y Julia Milner, a través de la Breakthrough Prize Foundation, basándose en una beca del fondo de Mark Zuckerberg en la Silicon Valley Community Foundation, además de una beca de la Milner Global Foundation. "El Breakthrough Junior Challenge insta a los estudiantes a comprender mejor los mundos de la ciencia y las matemáticas y divertirse durante ese viaje", destacó la cofundadora del Breakthrough Prize, la doctora Priscilla Chan. "Antonella y Deanna cuentan ambas con un futuro brillante en ciencias, y estoy emocionada de honrar su trabajo. Se trata además de dos increíbles contadoras de historias, cuya capacidad para capturar estas ideas complejas de forma accesible y emocionante es realmente inspiradora. No encuentro el momento de ver cómo van a cambiar el mundo". Además, se han otorgado seis premios New Horizons – un premio anual de 100.000 dólares cada uno, que reconocen los logros de los médicos de carrera primaria y matemáticos. El New Horizons in Physics Prize fue otorgado a: El New Horizons in Mathematics Prize fue otorgado a: La ceremonia estará dirigida y producida, por cuarta ocasión, por medio de Don Mischer junto a los productores ejecutivos Charlie Haykel y Juliane Hare de Don Mischer Productions. La emisión en directo corre a cargo de NATIONAL GEOGRAPHIC a las 10/9c del domingo 4 de diciembre, con una versión editada de una hora de la ceremonia emitida además por medio de FOX el domingo 18 de diciembre a las 7:00-8:00 PM ET/PT y a nivel mundial en NATIONAL GEOGRAPHIC en 171 países y 45 idiomas. El Breakthrough Prize in Life Sciences honora los avances transformadores hacia el conocimiento de los sistemas de vida y ampliación de la vida humana, con un premio dedicado al trabajo que contribuye al conocimiento de cara a las enfermedades neurológicas. Cada uno de los cinco ganadores de Life Science recibió un premio de 3 millones de dólares. Stephen J. Elledge, profesor Gregor Mendel de Genética y Medicina del Departamento de Genética de la Harvard Medical School y de la División de Genética del Brigham and Women's Hospital e investigador del Howard Hughes Medical Institute, por esclarecer cómo las células eucariotas sienten y responden a los daños en su ADN y proporcionar visiones sobre el desarrollo y tratamiento del cáncer. Harry F. Noller, director del Center for Molecular Biology of RNA, profesor Robert L. Sinsheimer de Biología Molecular y Profesor Emérito de Biología MCD de la University of California, Santa Cruz, por descubrir la centralidad del ARN en la formación de centros activos del ribosoma, la maquinaria fundamental de síntesis de proteína en todas las células, conectando con ello la biología moderna al origen de la vida y explicando además cómo muchos de los antibióticos naturales interrumpen la síntesis de proteínas. Roeland Nusse, profesor de Biología de Desarrollo de la Stanford University e investigador del Howard Hughes Medical Institute, por ser pionero en la investigación de la ruta Wnt, uno de los sistemas de señalización intercelular más importantes en la biología de desarrollo, cáncer y células madre. Yoshinori Ohsumi, profesor honorario del Institute of Innovative Research del Tokyo Institute of Technology por descubrir la autofagia, sistema de reciclaje que usan las células para generar nutrientes por sí mismas en componentes esenciales o dañados. Huda Yahya Zoghbi, profesor de los Departamentos de Pediatría, Molecular y genetic Humana, Neurología y Neurociencias del Baylor College of Medicine, investigador del Howard Hughes Medical Institute y director del Jan and Dan Duncan Neurological Research Institute (NRI) del Texas Children's Hospital, por sus descubrimientos de las causas genéticas y mecanismos bioquímicos de la ataxia espinocerebral y síndrome Rett, descubrimientos que han proporcionado visión dentro de la patogénesis de las enfermedades neurodegenerativas y neurológicas. El Breakthrough Prize in Fundamental Physics reconoce las mayores visiones dentro de las preguntas más profundas acerca del universo. Los tres ganadores, que comparten el premio de 3 millones de dólares, son: Joseph Polchinski, profesor del Departamento de Física y Miembro del Kavli Institute for Theoretical Physics de la University of California, Santa Bárbara; Andrew Strominger, director del Center for the Fundamental Laws of Nature de la Harvard University; y, Cumrun Vafa, profesor donner de Ciencias del Departamento de Física de la Harvard University, Los tres recibieron el premio por los avances transformadores en la teoría del campo cuántico, teoría de cuerdas y gravedad cuántica. El Breakthrough Prize in Mathematics honra a los mejores matemáticos del mundo, que han contribuido de cara a los avances más importantes en el campo. Jean Bourgain, profesor IBM von Neumann en la Escuela de Matemáticas del Institute for Advanced Study, Princeton, Nueva Jersey, por sus múltiples contribuciones de transformación para el análisis, combinatoria, ecuaciones diferenciales parciales, geometría de alta dimensión y teoría de números. El New Horizons in Physics Prize se otorga a los investigadores prometedores que empiezan sus carreras que yah an producido un trabajo importante en la física fundamental. El New Horizons in Mathematics Prize se concede a los investigadores prometedores en el principio de sus carreras que ya han producido importantes trabajos en matemáticas. La segunda edición anual del Breakthrough Junior Challenge reconoce a dos ganadores este año - Antonella Masini, 18, de Perú, y Deanna See, 17, de Singapur. Antonella y Deanna recibirán cada una hasta 400.000 dólares en premios de formación. El video de Antonella, enviado en la categoría de física, se centra en la implicación cuántica. El video de las ciencias de la vida de Deanna, titulado "Superbugs! And Our Race against Resistance", hace frente a la resistencia a los antibióticos. Las imágenes y video seleccionado de la 2017 Breakthrough Prize Gala – alfombra roja y ceremonia – se pueden descargar para su uso de medios a través de: Por quinto año, los premios Breakthrough Prize darán su reconocimiento a los mejores científicos del mundo. Cada premio tiene una dotación de 3 millones de dólares y se presenta en las áreas de Ciencias de la Vida (hasta cinco por año), Física Fundamental (máximo uno por año) y Matemáticas (máximo uno por año). Además, cada año se entregan hasta tres premios New Horizons de Física y hasta tres New Horizons de Matemáticas a jóvenes investigadores. Los ganadores asisten a una ceremonia de entrega de premios que se emite por televisor pensada para celebrar sus logros e inspirar a la nueva generación de científicos. Como parte de la programación de la ceremonia, también entran en un programa de ponencias y debates. Los premios al descubrimiento fueron fundados por Sergey Brin y Anne Wojcicki, Mark Zuckerberg y Priscilla Chan, y Yuri y Julia Milner. Los comités de selección están compuestos por ganadores anteriores de los premios Breakthrough Prize y quienes eligen a los ganadores. Información acerca de los Breakthrough Prizes disponible a través de www.breakthroughprize.org.


Implantable, ultra-narrow, silicon-based photonic probes described in journal from SPIE, the international society for optics and photonics BELLINGHAM, Washington, USA, and CARDIFF, UK -- The ability to stimulate neural circuits with very high precision light to control cells -- optogenetics -- is key to exciting advances in the study and mapping of the living brain. In the current state of the art, spatially patterned light projected via free-space optics stimulates small, transparent organisms and excites neurons within superficial layers of the cortex. However, light scattering and absorption in neural tissue cause light penetration to be extremely short, making it impossible to employ free-space optical methods to probe brain regions deeper than about 2 mm. In "Patterned photostimulation via visible-wavelength photonic probes for deep brain optogenetics," published today by SPIE, the international society for optics and photonics, in the journal Neurophotonics, principal author Eran Segev of professor Michael Roukes' group at Caltech, along with coauthors from Caltech, Baylor College of Medicine, and Stanford University, describe a solution. The article is available via open access. Their approach combines nanophotonics and microelectromechanical systems (MEMS) in an implantable, ultra-narrow, silicon-based photonic probe to deliver light deep within brain tissues. This minimally invasive technique avoids major tissue displacement during implantation. Using techniques of optogenetics, a protein in the brain serves as a sensory photoreceptor and can be controlled by specific wavelengths of light. These combined techniques provide a new approach to stimulation of brain circuits with remarkable resolution, enabling observation and control of individual neurons. These breakthroughs present widespread and promising applications for the neuroscience and neuromedical research communities. From characterizing the role of specific neurons and identifying neural circuits responsible for behavior to enabling new methods of operant conditioning through reward-induced circuit activations, optogenetics has become a new path for neuroscientists seeking advances in research capabilities. The article appears in a special section in Neurophotonics, Brain Mapping and Therapeutics, with Shouleh Nikzad, Jet Propulsion Laboratory, Caltech, serving as senior guest editor. The special section is part of an SPIE partnership with the Society for Brain Mapping and Therapeutics (SBMT), serving as a multidisciplinary approach for using advanced technology to solve neurological disorders and disease and to understand neuroscience. The effort was initiated during Nikzad's term as SBMT president in 2015. David Boas of Massachusetts General Hospital, Harvard Medical School, is the editor-in-chief of Neurophotonics. Launched in 2014, Neurophotonics is published digitally in the SPIE Digital Library and in print. The journal covers advances in optical technology applicable to the study of the brain and their impact on basic and clinical neuroscience applications. The SPIE Digital Library contains more than 458,000 articles from SPIE journals, proceedings, and books, with approximately 18,000 new research papers added each year. Abstracts are freely searchable, and a number of journal articles are published with open access. SPIE, the international society for optics and photonics, is an educational not-for-profit organization founded in 1955 to advance light-based science, engineering and technology. The Society serves nearly 264,000 constituents from approximately 166 countries, offering conferences and their published proceedings, continuing education, books, journals, and the SPIE Digital Library. In 2016, SPIE provided $4 million in support of education and outreach programs. http://www.


2017 Breakthrough Prize in Life Sciences an Stephen J. Elledge, Harry F. Noller, Roeland Nusse, Yoshinori Ohsumi und Huda Yahya Zoghbi verliehen 2017 Breakthrough Prize in Grundlagenphysik geht an Joseph Polchinski, Andrew Strominger und Cumrun Vafa New Horizons in Physics Prize an Asimina Arvanitaki, Peter W. Graham und Surjeet Rajendran; Simone Giombi und Xi Yin sowie Frans Pretorius verliehen New Horizons in Mathematics Prize geht an Mohammad Abouzaid, Hugo Duminil-Copin sowie Benjamin Elias und Geordie Williamson Zweiter jährlich verliehener International Breakthrough Junior Challenge von zwei Schülerinnen gewonnen Antonella Masini, 18 (Peru) und Deanna See, 17 (Singapur) Im Mai 2016 an Gründer und Teammitglieder von LIGO verliehener Special Breakthrough Prize in Grundlagenphysik an Kip Thorne, Rainer Weiss und die Familie von Ronald Drever überreicht Ehrung der Preisträger mit glanzvoller, von Morgan Freeman moderierter Awards Gala mit Live-Auftritt von Alicia Keys und Preisübergabe durch Daniel Ek (CEO von Spotify), Jeremy Irons, Mark und Scott Kelly, Hiroshi Mikitani (CEO von Rakuten), Sienna Miller, Bryce Dallas Howard, Vin Diesel, Kevin Durant, Dev Patel, Sundar Pichai (CEO von Google), Alex Rodriguez, Will.i.am, Susan Wojcicki (CEO von YouTube) und die Gründer des Breakthrough Prize. SAN FRANCISCO, 6. Dezember 2016 /PRNewswire/ -- Der Breakthrough Prize und seine Begründer Sergey Brin und Anne Wojcicki, Yuri und Julia Milner sowie Mark Zuckerberg und Priscilla Chan haben am heutigen Abend die Empfänger der Breakthrough Prizes 2017 bekanntgegeben. Dies steht zugleich für den fünften Jahrestag der Organisation, die Spitzenleistungen in den Biowissenschaften, der Grundlagenphysik und der Mathematik würdigt. Insgesamt wurden auf der von Morgan Freeman moderierten Gala-Veranstaltung in Silicon Valley 25 Millionen USD vergeben. Jeder der der Breakthrough Prizes ist mit einer Summe von 3 Millionen USD dotiert, der finanziell höchstdotierte Einzelpreis im Bereich der Wissenschaften. Diesjährig wurden, neben einem mit 3 Millionen USD dotierten, zwischen drei Gründern und mehr als tausend Mitgliedern des LIGO Team aufgeteilten Special Breakthrough Prize in Grundlagenphysik, insgesamt sieben Preise an neun Personen verliehen. Zusätzlich wurden drei mit 100.000 USD ausgeschriebene „New Horizons in Physics"-Preise an sechs Physiker, die am Anfang ihrer Karriere stehen und weitere drei mit 100.000 USD dotierte „New Horizons in Mathematics"-Preise an vier junge Mathematiker vergeben. In diesem Jahr gab es zwei Gewinner des Breakthrough Junior Challenge, die jeder jeweils bis zu 400.000 USD in Bildungspreisen für sich selbst, ihre Lehrer und ihre Schulen in Empfang nehmen konnten. Der im Jahre 2012 ins Leben gerufene Breakthrough Prize hat annähernd 200 Millionen USD vergeben, um einen Paradigmenwechsel in den Bereichen Grundlagenphysik, Biowissenschaften und Mathematik zu würdigen. „Die Wissenschaft zu unterstützen ist so wichtig wie nie zuvor", erklärte Facebook-Gründer Mark Zuckerberg. „Die Preisträger des 2017 Breakthrough Prize stehen für die führende wissenschaftliche Forschung in Physik, Mathematik und Life Sciences. Ihre bahnbrechenden Erkenntnisse werden neue Möglichkeiten erschließen und zu einer für uns alle besseren Welt beitragen". Der 2017 Breakthrough Prize in Life Sciences ging an Stephen J. Elledge (Harvard Medical School); Harry F. Noller (University of California, Santa Cruz); Roeland Nusse (Stanford University); Yoshinori Ohsumi (Technische Hochschule Tokio); Huda Yahya Zoghbi (Baylor College of Medicine). Der 2017 Breakthrough Prize in Grundlagenphysik wurde an Joseph Polchinski (University of California, Santa Barbara); Andrew Strominger (Harvard University); und Cumrun Vafa (Harvard University) verliehen. Die drei Preisträger konnten sich den bereits im Mai 2016 bekanntgegebenen Empfängern des Sonderpreises in Grundlagenphysik anschließen. Ronald Drever (California Institute of Technology, Pasadena), Kip Thorne (California Institute of Technology, Pasadena) und Rainer Weiss (Massachusetts Institute of Technology) waren im Mai für den Nachweis von Gravitationswellen ausgezeichnet worden, der neue Horizonte in der Astronomie und Physik eröffnet. Die drei Preisträger des Special Prize teilen sich eine 1 Million USD an Preisgeld, zwei Millionen gehen zu gleichen Teilen an 1012 Mitglieder des LIGO-Teams. Der 2017 Breakthrough Prize in Mathematik wurde an Jean Bourgain (Institute for Advanced Study) vergeben. Die diesjährige Zeremonie steht für das fünfte Jubiläum der Organisation. Die Preisträger werden heute Abend im Rahmen von den Gründern Sergey Brin und Anne Wojcicki, Yuri und Julia Milner, Mark Zuckerberg und Priscilla Chan sowie Vanity Fair-Herausgeber Graydon Carter mitausgerichteten einer exklusiven Gala auf der Bühne stehen. Schauspieler und Academy Award®-Gewinner Morgan Freeman wird als Gastgeber der Veranstaltung fungieren, in deren Rahmen es einen Auftritt der mit 15 Grammy Awards® ausgezeichneten Alicia Keys geben wird. Als prominente Preisverleiher treten Jeremy Irons, Mark und Scott Kelly, Hiroshi Mikitani (CEO von Rakuten), Sienna Miller, Bryce Dallas Howard, Vin Diesel, Kevin Durant, Dev Patel, Sundar Pichai (CEO von Google), Alex Rodriguez, Will.i.am, Susan Wojcicki (CEO von YouTube) sowie die Begründer des Breakthrough Prize in Erscheinung. Der Abend wird unter dem Motto „die universelle Reichweite von Ideen" stehen. „Wissenschaft ist universell", sagte Yuri Milner. „Sie hat heute Abend einige der weltweit größten Schauspieler, Sportler, Musiker, Akademiker, Entrepreneure, Astronauten und, nicht zu vergessen, Wissenschaftler, zusammengebracht, um zu feiern, was der menschliche Geist erreichen kann. Und sie macht möglich, dass hier ein planetenweites Live-Publikum mit dabei ist". Eines der Highlights sind die Reden der beiden Schülerinnen, die den Breakthrough Junior Challenge gewonnen haben, Antonella Masini, 18 (Peru) und Deanna See, 17 (Singapur). Der Breakthrough Junior Challenge ist ein globaler Videowettbewerb im Bereich der Wissenschaften, der zu kreativem Denken hinsichtlich Grundkonzepten in den Biowissenschaften, der Physik oder der Mathematik anregen soll. In Anerkennung ihrer siegreichen Einreichungen erhielten beide Schülerinnen bis zu 400.000 USD in Bildungspreisen einschließlich eines Stipendiums im Wert von bis zu 250.000 USD, 50.000 USD für einen inspirierenden Lehrer und ein wissenschaftliches Labor auf dem neuestem Stand der Technik im Wert von 100.000 USD. Für die 2016 Ausgabe des globalen Wettbewerbs gingen mit Starttermin zum 1. September 2016 Beiträge aus 146 Ländern ein. Der Breakthrough Junior Challenge wird von Mark Zuckerberg und Priscilla Chan sowie Yuri und Julia Milner über die Breakthrough Prize Foundation mit einer Förderung durch Mark Zuckerbergs Fonds in der Silicon Valley Community Foundation und finanzieller Unterstützung der Milner Global Foundation finanziert. „Der Breakthrough Junior Challenge ermutigt die Schüler, die Welten von Wissenschaft und Mathematik besser zu verstehen und Spaß daran zu haben", erklärte Breakthrough Prize Mitbegründerin Dr. Priscilla Chan. „Antonella und Deanna haben beide beste Zukunftsaussichten in der Welt der Wissenschaften, und ich bin hocherfreut, sie für ihre Arbeit derart würdigen zu können. Sie können darüber hinaus hervorragend Geschichten erzählen und besitzen eine Fähigkeit, diese komplexen Ideen zugänglich und aufregend zu erfassen und zu vermitteln, die wirklich inspirierend ist. Ich bin äußerst gespannt darauf, mitzuerleben, wie sie die Welt verändern werden". Zusätzlich wurden sechs New Horizons-Preise verliehen, eine jährlich vergebene und mit jeweils 100.000 USD dotierte Auszeichnung, die die Leistungen von Physikern und Mathematikern würdigen, die am Anfang ihrer Karriere stehen. Der New Horizons in Physics Prize ging an: Der New Horizons in Mathematics Prize ging an: Die Preisverleihung steht zum vierten Male unter der Leitung und Regie von Don Mischer, gemeinsam mit den ausführenden Produzenten Charlie Haykel und Juliane Hare von Don Mischer Productions. Die Gala wurde in vollem Umfang live auf NATIONAL GEOGRAPHIC am Sonntag, 4. Dezember um 22:00 Uhr/21:00 Uhr ET/CT übertragen. Eine auf eine Stunde editierte Version der Preisverleihung wird ebenfalls über FOX am Sonntag, 18. Dezember, von 19:00 Uhr - 20:00 Uhr ET/PT und global über NATIONAL GEOGRAPHIC in 171 Ländern und 45 Sprachen zu sehen sein. Der Breakthrough Prize in Life Sciences ehrt transformative Fortschritte zum Verständnis lebender Systeme und zur Verbesserung des menschlichen Lebens, wobei einer der Preise der Arbeit gewidmet ist, die zum Verständnis der neurologischen Erkrankungen beiträgt. Jeder der fünf Gewinner des Life Science-Preises hat 3 Millionen USD erhalten. Stephen J. Elledge, Gregor Mendel Professor für Genetik und Medizin in der Abteilung für Genetik an der Harvard Medical School und an der Abteilung für Genetik am Brigham and Women's Hospital und Investigator am Howard Hughes Medical Institute, für seine Darlegung, wie eukaryotische Zellen Schäden in ihrer DNA spüren und auf diese reagieren, und Erkenntnisse zur Entwicklung und Behandlung von Krebs. Harry F. Noller, Direktor des Zentrums für Molekularbiologie der RNA, Robert L. Sinsheimer Professor für Molekularbiologie und Professor Emeritus für MCD Biologie an der University of California, Santa Cruz, für die Entdeckung der zentralen Rolle, die RNA bei der Bildung der aktiven Zentren des Ribosoms zukommt, der grundlegenden Maschinerie der Proteinsynthese in allen Zellen, was die moderne Biologie mit dem Ursprung des Lebens verknüpft und auch erklärt, auf welche Weise viele natürliche Antibiotika die Proteinsynthese stören. Roeland Nusse, Professor für Entwicklungsbiologie an der Stanford University und Investigator am Howard Hughes Medical Institute, für Pionierforschung zum Wnt-Signalweg, eines der entscheidenden interzellulären Signalisierungssysteme in der Entwicklungs-, Krebs- und Stammzellbiologie. Yoshinori Ohsumi, Honorarprofessor am Institut für Innovative Forschung an der Technischen Hochschule Tokio, für die Darlegung der Autophagie, des Recycling-Systems, das Zellen verwenden, um Nährstoffe aus ihren eigenen unwesentlichen oder beschädigten Komponenten zu erzeugen. Huda Yahya Zoghbi, Professorin an den Abteilungen für Pädiatrie, Molekulare und Humangenetik, Neurologie und Neurowissenschaften am Baylor College of Medicine, Investigator am Howard Hughes Medical Institute und Direktorin des Jan and Dan Duncan Neurological Research Institute (NRI) am Texas Children's Hospital, für die Entdeckung der genetischen Ursachen und biochemischen Mechanismen der spinozerebellären Ataxie und des Rett-Syndroms, Erkenntnisse, die einen Einblick in die Pathogenese neurodegenerativer und neurologischer Erkrankungen gegeben haben. Der Breakthrough Prize in Fundamental Physics würdigt wichtige Erkenntnisse zu den tiefstgründigen Fragestellungen des Universums. Die drei Gewinner, die sich die Summe von 3 Millionen USD teilen, sind: Joseph Polchinski, Professor am Fachbereich für Physik und Mitglied des Kavli Institut für Theoretische Physik an der University of California, Santa Barbara; Andrew Strominger, Direktor des Center for the Fundamental Laws of Nature an der Harvard University; und, Cumrun Vafa, Donner Professor für Wissenschaft am Fachbereich für Physik an der Harvard University, Alle drei erhielten den Preis für transformative Fortschritte in der Quantenfeldtheorie, Stringtheorie und Quantengravitation. Der Breakthrough Prize in Mathematics ehrt die besten Mathematiker der Welt, die zu großen Fortschritten in diesem Bereich beigetragen haben. Jean Bourgain, IBM von Neumann Professor an der Fakultät für Mathematik am Institute for Advanced Study, Princeton, New Jersey, für mehrere transformative Beiträge zu Analyse, Kombinatorik, partiellen Differentialgleichungen, hochdimensionaler Geometrie und Zahlentheorie. Der New Horizons in Physics Prize wird vielversprechenden Forschern verliehen, die am Anfang ihrer Karriere stehen und bereits wichtige Arbeit in der Grundlagenphysik geleistet haben. The New Horizons in Mathematics Prize wird vielversprechenden Forschern verliehen, die am Anfang ihrer Karriere stehen und bereits wichtige Arbeit in der Mathematik geleistet haben. Der zweite, jährlich vergebene Breakthrough Junior Challenge würdigt in diesem Jahr zwei Gewinner - Antonella Masini, 18, aus Peru, und Deanna See, 17, aus Singapur. Antonella und Deanna erhalten jeweils bis zu 400.000 USD an Bildungspreisen. Das von Antonella in der Kategorie Physik eingereichte Video fokussiert sich auf Quantenverschränkung. Deannas Video für Life Sciences trägt den Titel „Superbugs! And Our Race against Resistance" (Superbugs! Unser Wettlauf mit der Resistenz) und beschäftigt sich mit Antibiotikaresistenz. Bilder und ausgewähltes Videomaterial der 2017 Breakthrough Prize Gala mit Begrüßung auf dem rotem Teppich und Preisverleihung können für Pressezwecke unter folgendem Link heruntergeladen werden: Die Breakthrough Prizes zeichnen mittlerweile im fünften Jahr die weltweit führenden Wissenschaftler aus. Jeder Preis ist mit einer Summe von 3 Millionen USD dotiert und wird für die Bereiche Life Sciences (bis zu fünf pro Jahr), Grundlagenphysik (ein Preis pro Jahr) und Mathematik (ein Preis pro Jahr) vergeben. Darüber hinaus werden jährlich bis zu drei „New Horizons"-Preise in Physik und bis zu drei „New Horizons"-Preise in Mathematik an vielversprechende junge Wissenschaftler verliehen. Die Preisträger nehmen an einer im Fernsehen übertragenen Award-Verleihung zur Anerkennung ihrer Verdienste teil, die auch die nächste Generation von Wissenschaftlern inspirieren soll. Im Rahmen der Feierlichkeit nehmen sie ebenfalls an einem Programm von Vorlesungen und Diskussionen teil. Begründer der Breakthrough Prizes waren Sergey Brin und Anne Wojcicki, Mark Zuckerberg und Priscilla Chan sowie Yuri und Julia Milner. Auswahlgremien, die sich aus früheren Preisträgern der Breakthrough Prizes zusammensetzen, wählen die Gewinner aus. Informationen über die Breakthrough Prizes erhalten Sie unter www.breakthroughprize.org.


News Article | March 1, 2017
Site: www.nature.com

The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. ARC-Net, University of Verona: approval number 1885 from the Integrated University Hospital Trust (AOUI) Ethics Committee (Comitato Etico Azienda Ospedaliera Universitaria Integrata) approved in their meeting of 17 November 2010, documented by the ethics committee 52070/CE on 22 November 2010 and formalized by the Health Director of the AOUI on the order of the General Manager with protocol 52438 on 23 November 2010. APGI: Sydney South West Area Health Service Human Research Ethics Committee, western zone (protocol number 2006/54); Sydney Local Health District Human Research Ethics Committee (X11-0220); Northern Sydney Central Coast Health Harbour Human Research Ethics Committee (0612-251M); Royal Adelaide Hospital Human Research Ethics Committee (091107a); Metro South Human Research Ethics Committee (09/QPAH/220); South Metropolitan Area Health Service Human Research Ethics Committee (09/324); Southern Adelaide Health Service/Flinders University Human Research Ethics Committee (167/10); Sydney West Area Health Service Human Research Ethics Committee (Westmead campus) (HREC2002/3/4.19); The University of Queensland Medical Research Ethics Committee (2009000745); Greenslopes Private Hospital Ethics Committee (09/34); North Shore Private Hospital Ethics Committee. Baylor College of Medicine: Institutional Review Board protocol numbers H-29198 (Baylor College of Medicine tissue resource), H-21332 (Genomes and Genetics at the BCM-HGSC), and H-32711(Cancer Specimen Biobanking and Genomics). Patients were recruited and consent obtained for genomic sequencing through the ARC-Net Research Centre at Verona University, Australian Pancreatic Cancer Genome Initiative (APGI), and Baylor College of Medicine as part of the ICGC (www.icgc.org). A patient criterion for admission to the study was that they were clinically sporadic. This information was acquired through direct interviews with participants and a questionnaire regarding their personal history and that of relatives with regard to pancreas cancers and any other cancers during anamnesis. Clinical records were also used to clarify familial history based on patient indications. Samples were prospectively and consecutively acquired through institutions affiliated with the Australian Pancreatic Cancer Genome Initiative. Samples from the ARC-Net biobank are the result of consecutive collections from a single centre. All tissue samples were processed as previously described5151. Representative sections were reviewed independently by at least one additional pathologist with specific expertise in pancreatic diseases. Samples either had full face frozen sectioning performed in optimal cutting temperature (OCT) medium, or the ends excised and processed in formalin to verify the presence of tumour in the sample to be sequenced and to estimate the percentage of neoplastic cells in the sample relative to stromal cells. Macrodissection was performed if required to excise areas that did not contain neoplastic epithelium. Tumour cellularity was determined using SNP arrays (Illumina) and the qpure tool9. PanNET is a rare tumour type and the samples were collected via an international network. We estimate that with 98 unique patients in the discovery cohort, we will achieve 90% power for 90% of genes to detect mutations that occur at a frequency of ~10% above the background rate for PanNET (assuming a somatic mutation frequency of more than 2 per Mb)52. Cancer and matched normal colonic mucosa were collected at the time of surgical resection from the Royal Brisbane and Women’s Hospital and snap frozen in liquid nitrogen. A biallelic germline mutation in the MUTYH gene was detected by restriction fragment length polymorphism analysis and confirmed by automated sequencing to be the G382D mutation (or ENST00000450313.5 G396D, ClinVar#5294) in both alleles53. The primary antibodies used for immunohistochemical staining were: cytokeratin 8/18 (5D3, Novocastra), chromogranin A (DAK-A3, Dako), and CD99 (O13, Biolegend). Antibodies and staining conditions have been described elsewhere39. Whole-genome sequencing with 100-bp paired reads was performed with a HiSEQ2000 (Illumina). Sequence data were mapped to a GRCh37 using BWA and BAM files are available in the EGA (accession number: EGAS00001001732). Somatic mutations and germline variants were detected using a previously described consensus mutation calling strategy11. Mutations were annotated with gene consequence using SNPeff. The pathogenicity of germline variants was predicted using cancer-specific and locus-specific genetic databases, medical literature, computational predictions with ENSEMBL Variant Effect Predictor (VEP) annotation, and second hits identified in the tumour genome. Intogen27 was used to find somatic genes that were significantly mutated. Somatic structural variants were identified using the qSV tool as previously described10, 11, 17. Coding mutations are included in supplementary tables and all mutations have been uploaded to the International Cancer Genome Consortium Data Coordination Center. Mutational signatures were predicted using a published framework14. Essentially, the 96-substitution classification was determined for each sample. The signatures were compared to other validated signatures and the prevalence of each signature per megabase was determined. Somatic copy number was estimated using high density SNP arrays and the GAP tool12. Arm level copy number data were clustered using Ward’s method, Euclidian distance. GISTIC13 was used to identify recurrent regions of copy number change. The whole genome sequence data was used to determine the length of the telomeres in each sample using the qMotif tool. Essentially, qMotif determines telomeric DNA content by calculating the number of reads that harbour the telomere motif (TTAGG), and then estimates the relative length of telomeres in the tumour compared to the normal. qMotif is available online (http://sourceforge.net/projects/adamajava). Telomere length was validated by qPCR as previously described54. RNASeq library preparation and sequencing were performed as previously described55. Essentially, sequencing reads were mapped to transcripts corresponding to ensemble 70 annotations using RSEM. RSEM data were normalized using TMM (weighted trimmed mean of M-values) as implemented in the R package ‘edgeR’. For downstream analyses, normalized RSEM data were converted to counts per million (c.p.m.) and log transformed. Genes without at least 1 c.p.m. in 20% of the sample were excluded from further analysis55. Unsupervised class discovery was performed using consensus clustering as implemented in the ConsensusClusterPlus R package56. The top 2,000 most variable genes were used as input. Differential gene expression analysis between representative samples was performed using the R package ‘edgeR’57. Ontology and pathway enrichment analysis was performed using the R package ‘dnet’58. PanNET class enrichment using published gene signatures44 was performed using Gene Set Variation Analysis (GSVA) as described previously55. Two strategies were used to verify fusion transcripts. For verification of EWSR1–BEND2 fusions, cDNAs were synthesized using the SuperScript VILO cDNA synthesis kit (Thermofisher) with 1 μg purified total RNA. For each fusion sequence, three samples were used: the PanNET sample containing the fusion, the PanNET sample without that fusion, and a non-neoplastic pancreatic sample. The RT–PCR product were evaluated on the Agilent 2100 Bioanalyzer (Agilent Technologies) and verified by sequencing using the 3130XL Genetic Analyzer (Life Technologies). Primers specific for EWSR1–BEND2 fusion genes are available upon request. To identify the EWSR1 fusion partner in the case ITNET_2045, a real-time RT–PCR translocation panel for detecting specific Ewing sarcoma fusion transcripts was applied as described59. Following identification of the fusion partner, PCR amplicons were subjected to sequencing using the 3130XL Genetic Analyzer. EWSR1 rearrangements were assayed on paraffin-embedded tissue sections using a commercial split-signal probe (Vysis LSI EWSR1 (22q12) Dual Colour, Break Apart Rearrangement FISH Probe Kit) that consists of a mixture of two FISH DNA probes. One probe (~500 kb) is labelled in SpectrumOrange and flanks the 5′ side of the EWSR1 gene, extending through intron 4, and the second probe (~1,100 kb) is labelled in SpectrumGreen and flanks the 3′ side of the EWSR1 gene, with a 7-kb gap between the two probes. With this setting, the assay enables the detection of rearrangements with breakpoints spanning introns 7–10 of the EWSR1 gene. Hybridization was performed according to the manufacturer’s instructions and scoring of tissue sections was assessed as described elsewhere60, counting at least 100 nuclei per slide. Recurrently mutated genes identified by whole-genome sequencing were independently evaluated in a series of 62 PaNETs from the ARC-Net Research Centre, University of Verona. Four Ion Ampliseq Custom panels (Thermofisher) were designed to target the entire coding regions and flanking intron–exon junctions of the following genes: MEN1, DAXX, ATRX, PTEN and TSC2 (panel 1); DEPDC5, TSC1 and SETD2 (panel 2); ARID1A and MTOR (panel 3); CHEK2 and MUTYH (panel 4). Twenty nanograms of DNA were used per multiplex PCR amplification. The quality of the obtained libraries was evaluated by the Agilent 2100 Bioanalyzer on chip electrophoresis. Emulsion PCR was performed with the OneTouch system (Thermofisher). Sequencing was run on the Ion Torrent Personal Genome Machine (PGM, Thermofisher) loaded with 316 or 318 chips. Data analysis, including alignment to the hg19 human reference genome and variant calling, was done using Torrent Suite Software v4.0 (Thermofisher). Filtered variants were annotated using a custom pipeline based on the Variant Effector Predictor (VEP) software. Alignments were visually verified with the Integrative Genomics Viewer: IGV v2.3 (Broad Institute). There is no contiguous structure available for CHEK2, so we produced a model of isoform C using PDBid 3i6w61 as a template for predicting the structure of sequence O96017. Modelling was carried out within the YASARA suite of programs62 and consisted of an initial BLAST search for suitable templates followed by alignment, building of loops not present in selected template structure and energy minimization in explicit solvent. Modelling was carried out in the absence of a phosphopeptide ligand, which was added on completion by aligning the model with structure 1GXC and merging the ligand contained therein with the model structure. Similarly, MUTYH is represented by discontinuous structures and so this too was modelled using PDBids 3N5N and 4YPR as templates together with sequence NP_036354.1. Having constructed both models, amino acid substitutions were carried out to make the wild-type sequences conform to the variants described above. Each substitution was carried out independently and the resulting variant structures were subject to simulated annealing energy minimization using the AMBER force field. The resulting energy-minimized structures formed the basis of the predictions. CHEK2 site mutants were generated by site-directed mutagenesis of wild-type pCMV–FLAG CHEK2 (primer sequences in Supplementary Table 16). Proteins were expressed in HEK293T, a highly transfectable derivative of HEK293 cells that were retrieved from the cell culture bank at the QIMR Berghofer medical research institute. Cells were authenticated by STR profiling and were negative for mycoplasma. Transfected cells were lysed in NP-40 modified RIPA with protease and phosphatase inhibitors. Protein expression levels were analysed by western blotting with anti-FLAG antibodies and imaging HRP luminescent signal on a CCD camera (Fuji) and quantifying in MultiGauge software (Fuji). Kinase assays were performed using recombinant GST–CDC25C (amino acids 200–256) as substrate, essentially as described63. Kinase assay quantification was performed by scintillation counting of excised gel bands in OptiPhase scintillant (Perkin Elmer) using a Tri-Carb 2100TR beta counter (Packard). Counts for each reaction set were expressed as a fraction of the wild type. All experiments were performed at least three times. The date of diagnosis and the date and cause of death for each patient were obtained from the Central Cancer Registry and treating clinicians. Median survival was estimated using the Kaplan–Meier method and the difference was tested using the log-rank test. P values of less than 0.05 were considered statistically significant. The hazard ratio and its 95% confidence interval were estimated using Cox proportional hazard regression modelling. The correlation between DAXX or ATRX mutational status and other clinico-pathological variables was calculated using the χ2 test. Statistical analysis was performed using StatView 5.0 Software (Abacus Systems). Disease-specific survival was used as the primary endpoint. Genome sequencing data presented in this study have been submitted to the European Genome-Phenome Archive under accession number EGAS00001001732 (https://www.ebi.ac.uk/ega/search/site/EGAS00001001732).


News Article | August 24, 2016
Site: www.biosciencetechnology.com

A new device developed by researchers at MIT and a physician at Connecticut Children’s Medical Center could greatly improve doctors’ ability to accurately diagnose ear infections. That could drastically reduce the estimated 2 million cases per year in the United States where such infections are incorrectly diagnosed and unnecessary antibiotics are prescribed. Such overprescriptions are considered a major cause of antibiotic resistance. The new device, whose design is still being refined by the team, is expected ultimately to look and function very much like existing otoscopes, the devices most doctors currently use to peer inside the ear to look for signs of infection. But unlike these conventional devices, which use visible light and can only see a few millimeters into the tissues of the ear, the new device instead uses shortwave infrared light, which can penetrate much deeper. The findings are being reported this week in the journal PNAS, in a paper by Moungi Bawendi, the Lester Wolfe Professor of Chemistry at MIT; Jessica Carr, an MIT doctoral student; Oliver Bruns, an MIT research scientist; and Tulio Valdez, a pediatric otolaryngologist at Connecticut Children’s Medical Center  and associate professor of otolaryngology at the University of Connecticut. The one clear diagnostic sign of an infection in the ear is a buildup of fluid behind the eardrum, Carr explains. But the view through a conventional otoscope can’t penetrate deeply enough into the tissues to reveal such buildups. More expensive specialized equipment can offer more information needed for a firm diagnosis, but these tools are usually only available in the offices of specialists, who are not consulted in the vast majority of cases. “A lot of times, it’s a fifty-fifty guess as to whether there is fluid there,” Carr said. “If there’s no fluid, there’s no chance of an infection. One of the limitations of the existing technology is that you can’t see through the eardrum, so you can’t easily see the fluid. But the eardrum basically becomes transparent to our device.” Fluid within the ear, by contrast, “becomes very dark and very apparent.” While there are more advanced systems under development that do provide data on these deeper parts of the ear, Carr said, those “haven’t been widely adopted. They’re not familiar to the physicians, who have to use a whole range of technologies in their work. These are something new and unfamiliar, and some of these devices require a trained audiologist to run them.” So the MIT team worked to make the new device as familiar as possible, closely resembling the otoscopes that doctors already use. “We developed something easy to use, and that wouldn’t require much training,” she said. Studies have shown that about 8 million children each year in the U.S. are diagnosed with otitis media, the medical term for middle-ear infections, Carr said. These are especially prevalent among young children: About 80 percent of them will have at least one such diagnosis by the age of 3. But the studies show that such diagnoses are correct only 51 percent of the time — “essentially a coin toss,” Carr said. The roughly 4 million incorrect diagnoses are about evenly split between false positives and false negatives, indicating that about 2 million children every year are incorrectly thought to have such infections, and are prescribed unnecessary antibiotics. Once the presence of an infection is determined, doctors must then try to distinguish between viral and bacterial causes, something this device cannot determine, although it can provide some clues. After initial successful tests on 10 adult subjects, the team is now in the process of carrying out tests on pediatric patients to confirm the accuracy of the diagnostic results. Assuming the tests go well, the team hopes to commercialize the device. The ultimate cost, Carr says, will depend on the cost of the infrared imaging system — which is finding a variety of applications, including in the self-driving cars being developed by Google and other companies, because of its ability to see through fog and during night time. The cost of those devices, originally developed for military uses, has already fallen drastically over the last couple of years, she says, and widespread production could drop those costs rapidly. "The potential impact of this work is huge,” said Karina Cañadas, an assistant professor of pediatric otolaryngology at Baylor College of Medicine in Texas, who was not involved in this work. "Ear infections are one of the most common reasons for visits to the pediatrician, but sometimes the view of the middle ear in a wiggly irritated child is not easy, making a good exam not always possible.  With this  technology even a brief exam would be able to detect middle ear fluid more confidently.” The research was supported by the Laser Biomedical Research Center at MIT funded by the National Institutes of Health, MIT’s Institute for Soldier Nanotechnologies, and the Air Force Office of Scientific Research.


Dallas, TX (December 1, 2016) -- Over the Thanksgiving holiday in 2012, John Rodakis, a father of a child with autism, observed his son's condition dramatically improve while taking a common antibiotic. This marked the beginning of a four year quest to understand how an antibiotic might affect behaviors associated with autism. Today, on the four year anniversary of that observation, Baylor College of Medicine is launching a national study funded by the non-profit the father started, N of One: Autism Research Foundation, to investigate this routinely observed phenomenon. The first-of-its kind study will investigate why some children with autism spectrum disorder (ASD) experience improvements or changes in their autism symptoms when taking antibiotics. The study will follow children over a two-year period and capture information anytime antibiotics are prescribed by their regular physicians and compare changes in the gut microbiome (bacteria, yeasts and fungi found in the gut) and metabolome (small biological molecules produced by the microbes) during antibiotic use of those who experience a change in symptoms during to those who do not. The study seeks to understand when and why these changes occur and how this information can be harnessed for future interventions. Autism Spectrum Disorder is a neuro-developmental disorder with a steadily growing prevalence that affects more than 2 percent of children. Many parents have reported that their children experienced significant changes in their ASD symptoms, typically improvements, though sometimes a worsening of symptoms, when taking antibiotics, aka the "antibiotic effect." Recent research has documented abnormalities in the gut microbiome of children with autism. Researchers have speculated that changes in the gut bacteria caused by antibiotics may be behind the changes in symptoms observed in some children with autism. The gut-brain axis is now being widely investigated by researchers in many fields of medicine. The study marks the first collaboration between N of One: Autism Research Foundation and Baylor College of Medicine and is the brain-child of two parents of affected children, Dr. Ruth Ann Luna and John Rodakis, who have both been investigating the microbiome's role in autism. Dr. Luna is one of the nation's leading investigators of the role of the microbiome in autism and is the Director of Medical Metagenomics at the Texas Children's Microbiome Center at Texas Children's Hospital in Houston. Dr. Luna is also an Assistant Professor in the Department of Pathology & Immunology at Baylor College of Medicine. Mr. Rodakis is a former medical venture capitalist who founded the N of One: Autism Research Foundation. Both Luna and Rodakis have observed changes in their children's autism symptoms while taking antibiotics. "Working with Dr. Luna has been very energizing because as a fellow affected parent, we share a real passion to get this right for our children as well as millions of others," says Rodakis. "The support of N of One is enabling a much needed study that would have been unlikely to be funded elsewhere. Because we have both witnessed the antibiotic effect in our own children, we knew this was a natural starting point targeting a gap in published autism research. Our goals reach far beyond this first study and include using these initial data to more effectively subtype autism and thereby develop and deliver more effective microbial-based interventions." There is a growing recognition that the microbiome plays a role in autism. In 2000, a clinical trial conducted at Chicago Rush Children's Hospital demonstrated that eight out of 10 children experienced a significant improvement while taking the antibiotic vancomycin. Despite this and numerous reports published in the media and medical literature of children with ASD unexpectedly improving while taking antibiotics, there have been no systematic attempts to investigating this antibiotic effect until now. "The question of why some children's autism symptoms improve is important to me scientifically and personally. We saw this in our own child in 2012 and I published a paper describing what I saw. Soon, I began hearing from parents all over the world who had observed same thing," Rodakis says. "It was stunning to me that there was a frequently reported phenomenon of improvement that was not being used as a clue to guide further research. Today we begin that process." The phenomenon has parallels to the "fever-effect," an observation that some children with ASD experience improvements when they had a fever. Parents had been reporting this for decades, but the reports were not followed up on until 2007 when a Johns Hopkins researcher, Dr. Andy Zimmerman, (a scientific advisor to N of One) documented the effect and later in 2014 used the observations as the basis for a successful treatment trial using sulforaphane, a compound found in broccoli. N of One: Autism Research Foundation was also a sponsor of that trial. The trial is open to children nationwide. Parents who are interested in participating in the trial can visit: https:/ or contact Dr Luna at raluna@bcm.edu N of One: Autism Research Foundation's mission is to facilitate and sponsor breakthrough autism medical research. N of One emphasizes research that treats the observations of parents and doctors as potential clues to how autism works and seeks to turn those into breakthroughs. Headquartered in Dallas, TX in 2014, it has been a leader in focusing on the role of the microbiome in autism. Learn more at http://www. Follow us on Facebook


News Article | December 2, 2015
Site: www.sciencenews.org

Genies are said to have the power to grant three wishes. But genies recently released from laboratory flasks promise to fulfill nearly any wish a biologist can dream up. End the scourge of insect-borne diseases? Check. Inoculate endangered amphibians against killer fungi? Yes. Pluck invasive species from environments where they don’t belong? As you wish. These genies aren’t magical; they are research tools known as gene drives — clever bits of engineered DNA designed to propel themselves into the DNA of a pesky or troubled organism. A gene drive is a targeted contagion intended to spread within species, forever altering the offspring. Gene drive enthusiasts say these genies could wipe out malaria, saving more than half a million lives each year. Invasive species, herbicide-resistant weeds and pesticide-resistant bugs could be driven out of existence. Animals that carry harmful viruses could be immunized with ease. Scientists have sought the power of gene drives for decades. But only with the emergence of a genetic tool called CRISPR/Cas9 — the bottle opener that unleashed the genie — has gene drive technology offered the prospect of providing a speedy means to end some of the world’s greatest health and ecological scourges. “Everything is possible with CRISPR,” says geneticist Hugo Bellen. “I’m not kidding.” But genes designed to spread through populations and alter ecosystems could have unforeseen consequences. Researchers have designed ways to keep gene drives confined in the lab, but no such safety nets exist for gene drives released into the wild. A technology to eradicate entire species, even when those species are pests, raises ethical and regulatory issues that scientific and government agencies are just beginning to consider. As yet, no CRISPR gene drive has been released in the wild — few have even been built. There are plenty of technical hurdles to overcome. But there is enough awareness of the peril accompanying the promise that researchers and philanthropic organizations interested in the technology recently asked the U.S. National Academy of Sciences to weigh in on gene drives. The academy’s report won’t be issued until next year, but that hasn’t stopped the debate — or gene drive science — from moving forward. Normally, organisms have a 50 percent chance of passing along a gene to an offspring. A gene drive copies and pastes itself into chromosomes from both parents, ensuring it gets passed on more often. Gene drives aren’t naked DNA floating around the air and water. They are molecular tools that scientists engineer into an organism’s DNA. While biologists have long imagined building gene drives, it was the arrival of CRISPR that transformed imagination into application. CRISPR (an acronym for “clustered regularly interspaced short palindromic repeats”) refers to bits of viral DNA that bacteria have incorporated into their own genomes. With assistance from the enzyme known as Cas9, CRISPRs help bacteria defend themselves against viruses. In 2012, researchers announced that they had modified the CRISPR system into a gene-editing tool for cutting and pasting nearly any gene into any organism. Since then, CRISPR gene editing has taken biology by storm. It has become so widespread and easy that even third-graders are using it in science class, says CRISPR cocreator Jennifer Doudna of the University of California, Berkeley. Already, researchers have used CRISPR/Cas9 to edit genes in human cells grown in lab dishes, monkeys (SN: 3/8/14, p. 7), dogs (SN: 11/28/15, p. 16), mice and pigs (SN: 11/14/15, p. 6), yeast, fruit flies, the worm Caenorhabditis elegans, zebra­fish, tobacco and rice. “I do CRISPR every day,” says Bellen, of Baylor College of Medicine in Houston. All around him, scientists are engineering fruit flies, nematode worms and mice using the bacteria-derived tool. “It’s one of those very rare events when a technology revolutionizes how you do science.” Gene-editing tools are improving. The CRISPR/Cas9 system is easier to program and faster to produce than other gene editors in use. First used in live animals Time to do an experiment Usually, molecular biology techniques are specific to one organism, so CRISPR’s flexibility in editing genes from such a wide array of organisms is extremely attractive for researchers, says Anthony James, a molecular biologist at the University of California, Irvine. If they can nimbly edit any gene in any organism, scientists ought to be able to design a gene drive for that species as well. That could mean that invasive species such as Australia’s pesky cane toads and other organisms that scientists haven’t been able to manipulate genetically could now become gene drive targets with CRISPR. Gene drives are just the latest attempt at biological control systems. In the past, biologists have introduced natural enemy species to control pests. For instance, a fungus has been used to tamp down gypsy moth incursions in the northeastern United States. Gene drives aren’t much different, says gene drive pioneer Austin Burt, an evolutionary geneticist at Imperial College London. “But instead of releasing a whole species, you’re releasing a gene.” Burt has made a career studying “selfish genetic elements,” parasitic pieces of DNA or RNA that exist only to propagate themselves. They go by other names, such as jumping genes, transposable elements, biased gene converters or meiotic drivers. Selfish elements live in a wide variety of organisms (including humans), and have devised a variety of methods for getting themselves passed on. What they have in common is the ability to circumvent the normal rules of inheritance, first described by Gregor Mendel in the 1860s. Computer simulations predict that a gene drive inherited by 75 percent of progeny (red lines) starting at 10 percent of the population could be passed to all individuals within a few generations. A gene that follows normal 50-50 rules of inheritance (yellow lines) would not overtake the population. Under Mendelian rules, a gene has a 50-50 shot at being passed from a parent to an offspring. Selfish elements don’t play by those rules. They manipulate the system to get inherited by more than 50 percent of offspring, even if it means harming the organism. In 2003, Burt proposed harnessing some of these selfish entities for the greater good. He envisioned inserting a selfish element into a particular gene, creating a gene drive, which would change the inheritance rules to make sure that the drive would get passed on to a majority of a creature’s progeny. Burt’s notion was to domesticate a microbial family of selfish elements called homing endonuclease genes. Those genes make endonucleases — DNA-cutting enzymes that target one spot in an organism’s entire genetic catalog, or genome. Like molecular scissors, the enzyme snips the target DNA if it doesn’t already have the selfish element. Next, a copy of the homing endonuclease gene with its surrounding DNA inserts itself into the gap as the cell heals the breach. Once inserted into one chromosome, the gene snips and pastes itself into the matching chromosome inherited from the other parent. So when the organism mates and divides its genetic material, both chromosomes will carry the editing machinery. In the fertilized egg, this cut-and-paste machinery would also convert the mate’s DNA. This repetitive editing allows the selfish element to drive itself into nearly every organism in a population. Gene drives could speed through a population like wildfire blazing across grasslands. This approach has special appeal for weakening the disease-carrying dexterity of mosquitoes. A gene drive carried by 1 percent of mosquitoes in a population can be inherited so efficiently that in about 20 generations, 99 percent of all the mosquitoes will carry it, Burt calculates. Burt’s math probably isn’t far from what might happen if a gene drive were released in the wild. “This has happened in nature,” says Nora Besansky, who studies malaria-carrying mosquitoes. A selfish element called the P element invaded the DNA of Drosophila melanogaster fruit flies in the 1950s, and “in less than 50 years, spread itself worldwide, across oceans, without any human intervention,” says Besansky, of the University of Notre Dame. Humans might be able to direct gene drives to kill only female mosquitoes (the ones that bite and spread disease), or render the insects incapable of carrying malaria, dengue or other diseases. To put his gene theory into practice, all Burt and his colleagues had to do was reengineer a homing endonuclease to cut a certain spot in a mosquito’s genome. Not so easy, says synthetic biologist Kevin Esvelt of Harvard Medical School. “It’s one of the hardest problems in protein engineering.” Gene drives became much easier to build with CRISPR/Cas9. These new drives insert genes that produce the components of the system: a cutting enzyme and an RNA to guide it to the proper cutting site. When an organism mates, the drives convert the mate’s DNA to a gene drive as well, setting off a chain reaction that will continue in perpetuity. 1. A guide RNA shepherds the CAs9 cutting enzyme to a specific spot on DNA. 2. Cas9 locks onto the DNA and unzips it, allowing the guide RNA to pair up with a targeted section of the DNA. 3.  Cas9 snips the DNA, creating a break in both strands. 4. A piece of DNA carrying instructions for making Cas9 and the guide RNA matches up with the cut ends.  5. The cell heals the cut by inserting the DNA containing instructions for Cas9 and guide RNA.  6. When an egg or sperm carrying hte gene drive fuses with another egg or sperm, the enzyme and guide RNA are made to cut the gene and start the process over. It took years, but in 2011, Burt and colleagues announced in Nature that they had created a homing endonuclease that could find and cut a gene in mosquitoes. That experiment showed that building a gene drive in mosquitoes is possible. But gene drives that will get rid of mosquitoes or hinder their ability to transmit malaria are in the works (SN Online: 11/23/15). In addition to homing endonucleases, scientists have been tinkering with two artificial protein systems as programmable gene-editing tools. Those tools, called zinc finger nucleases and TALENs (short for transcription activator-like effector nucleases), link a cutting enzyme to a protein that binds DNA in specific spots. Those molecules have enabled scientists to make precision edits to a menagerie of genomes (SN: 12/12/15, p. 7). But the proteins “are a burden to make,” says Bellen. Working with them is “just too painful and too slow,” he says. “If it’s not fast and efficient, it’s not good technology.” CRISPR provides the speed. Like earlier technologies, the part of the CRISPR system that snips DNA is a protein (the Cas9 enzyme). But unlike other systems, CRISPR pairs the enzyme scissors with pieces of RNA that guide it to the gene researchers want to cut. When the RNA finds a match on the information-carrying units of DNA, called bases, the Cas9 enzyme cleaves the DNA. RNA is very easy to program. Researchers just need to select the DNA segment they want to cut and synthesize an RNA molecule that matches. The process takes days, as opposed to weeks or months for other technologies. Researchers have wholeheartedly embraced CRISPR and used the technology to easily manipulate the genomes of many organisms in ways that would have taken years to achieve, if ever. “It’s not oh, maybe someday,” Doudna says. “It’s now.” Harvard’s Esvelt was among the first to recognize that CRISPR is essentially an ultraflexible homing endonuclease that could easily be turned into a gene drive. He and colleagues laid out some of the possible uses for CRISPR gene drives in July 2014 in eLife. At the time, no one had reported creating a gene drive using CRISPR. That soon changed. In January, Esvelt and colleagues reported online at bioRxiv.org that they had made a gene drive in yeast. In March, researchers from the University of California, San Diego reported online in Science that they had created a gene drive in fruit flies. Those researchers, biologists Valentino Gantz and Ethan Bier, were looking for a way to easily make mutations in Drosophila fruit flies. Gantz focused on the yellow gene, which affects a fly’s color. He devised a piece of DNA carrying the gene that produces the Cas9 protein along with DNA that produces guide RNAs, which direct the drive to cut and plunk itself in the yellow gene, breaking it. A broken yellow gene jaundices the flies, which are normally tan with dark stripes. The yellow gene is on the X chromosome. Female flies, which have two copies of the X chromosome, can inherit one copy of the broken yellow gene and retain their normal coloring. Two copies turns them golden. But males have only one X chromosome, and therefore just one copy of the gene, so any disruption will turn them yellow. When an altered X chromosome is passed down to female offspring, Gantz reasoned, the gene drive should convert the normal X from the other parent into one with a broken yellow gene. Every female would be yellow. A gene drive turned normal fruit flies (A) into yellow flies (B). The gene drive didn’t work perfectly, however. In one fly (C), the gene drive worked only in cells on the left side of the body. “I figured this was beautiful on paper, but the odds of it really happening were pretty long,” Bier says. As it turns out, says Gantz, “it worked the first time.” When the researchers bred female flies containing the yellow gene drive to normal males, 95 to 100 percent of both male and female progeny were yellow. If the drive hadn’t worked, and normal Mendelian inheritance rules were in effect, only 50 percent of male and no female offspring would be yellow. The system wasn’t perfect. In 4 percent of cases, female flies were born with patches of normal cells and patches of yellow cells. One female was only half yellow. Clearly, some X chromosomes managed to outrun the drive. Still, the system worked with remarkable efficiency. Gantz and Bier didn’t call their invention a gene drive. They named it the “mutagenic chain reaction.” By any name, it was the first time researchers had deployed a CRISPR gene drive in a multicelled organism. If others can achieve the kind of efficiency that Gantz and Bier did, researchers could make a giant leap in wiping out insect-borne diseases. Theoretically, even one gene-drive–engineered organism could crash an entire population. That possibility terrified some people when they learned about the yellow fruit fly experiment. If a gene-drive–containing organism were to escape from the lab and start breeding with its wild counterparts, it could irrevocably alter the wild population. Maybe even wipe it out. In July, 27 scientists (Gantz and Bier among them) issued guidelines in Science for working with gene drives in the laboratory. The researchers want to keep their gene-drive experimental insects and other animals contained to protect wild populations, but also safeguard the potential humanitarian benefits of the technology. “What’s it going to do to public trust if we accidentally release a gene drive into the wild?” Esvelt asks. He fears an accidental breach could damage malaria eradication and other much-needed public health measures. The guidelines may help researchers avoid creating an accidental gene drive, but they don’t apply to gene drives that would actually be used in the wild, says molecular biologist Zach Adelman of Virginia Tech in Blacksburg. The whole purpose of a gene drive is to spread. Exactly how its spread will affect ecosystems isn’t known. Some people speculate that rapidly removing an invasive species could shock that system and have unknown costs. Even getting rid of disease-carrying mosquitoes might have consequences: Bats, birds and other critters that eat insects could lose a valuable food supply. What gene drives could do: • Reduce populations of rodents and other pests Scientists are also unclear whether gene drives could spread to closely related species. For Anopheles mosquitoes, many of which carry malaria, the answer could be yes, Besansky says. Eight species known as the Anopheles gambiae complex of mosquitoes in Africa became separate species less than 5 million years ago, and they sometimes still interbreed, producing fertile hybrids. Gene drives might pass from one species to another through this interbreeding. But given that all but a couple of those species can carry malaria, spillover from one species into another might actually be desirable, Besansky says. Still, many people are uncomfortable with the idea of gene drives that have the potential to eradicate entire species. Some researchers, including James of UC Irvine, prefer an approach that would prevent mosquitoes from spreading disease without reducing their numbers. In 2012, James and colleagues reported that they had engineered Anopheles stephensi mosquitoes with genes that produce antibodies against malaria parasites. The antibodies prevented Plasmodium falciparum parasites from making sporozoites, the stage of the malaria life cycle that is infectious to humans. No sporozoites means the mosquitoes can’t pass the parasite on to humans. With Gantz and Bier, James created a CRISPR gene drive to speed the spread of the antimalaria antibodies in mosquito populations. The team reported its work online November 23 in the Proceedings of the National Academy of Sciences (SN Online: 11/23/15). Getting the gene drive into the mosquitoes proved tricky; only two males out of more than 25,000 that were screened carried the drive. But once the drive was in the insects, males passed it to progeny with about 99 percent efficiency. Females, however, passed it to their offspring only slightly more often than Mendelian rules would suggest. While this gene drive will not work in the wild because of the problems with female inheritance, James expects that gene-drive–carrying mosquitoes resistant to malaria will help form a front line against the disease. Any wild mosquitoes entering a zone made disease-free with a gene drive would quickly be assimilated. All of the benefits and drawbacks to gene drives are “just so hypothetical right now,” says Allison Snow, a plant population ecologist at Ohio State University. She doubts, for instance, the suggestion that weeds could be gene-drive engineered to eliminate herbicide resistance. “These early predictions are rosy,” she says, and it is far too soon to say what will happen if such engineered weeds are ever released. There is still time to work out the uncertainties, says Virginia Tech’s Adelman. “People are jumping the gun thinking these are going to be released any day now. It’s going to be years and years,” he says. Scientists have a number of technical hurdles to overcome. One of the biggest barriers to making gene drives of any kind is getting them into the organism. That is harder in mosquitoes than it is in fruit flies or other lab animals. Genetically engineering mosquitoes that will pass along a gene requires access to the organism’s eggs. At less than a millimeter long and a quarter of a milli­meter wide, a mosquito egg doesn’t give researchers much room for error. Few labs have perfected the technique, James says. When creating the antimalaria antibody gene drive, the researchers had to inject Cas9, guide RNAs and bits of DNA containing the gene drive into the egg. Cas9 appears to be toxic to mosquitoes, so the team also included a separate piece of RNA to dampen the amount of Cas9 produced. That reduced the toxicity of the enzyme, but also squelched initial insertion of the gene drive. Ensuring the gene drive goes where it is supposed to is turning out to be tricky as well. Just as some human guides give better tours than others, some guide RNAs are better than others at shepherding Cas9 to the proper spot. Guide RNAs targeting five different Aedes aegypti mosquito genes varied in efficiency from 24 to 90 percent, Adelman and colleagues reported in March in the Proceedings of the National Academy of Sciences. CRISPR/Cas9 doesn’t always cut where it is supposed to. In one experiment with human cells, a guide RNA should have led the Cas9 enzyme only to a gene on chromosome 2 (yellow bar), but it also directed the enzyme to many off-target sites (red) on several other chromosomes. In experiments with human cells, Shengdar Tsai of Massachusetts General Hospital and Harvard Medical School found that some guide RNAs nearly always lead Cas9 to the correct cutting site. Other guides take the enzyme to more than 150 “off-target” sites, Tsai and colleagues reported in the February Nature Biotechnology. Another problem is that researchers know little about the biology of most disease-carrying critters, pests and invasive species, Burt says. That makes it hard to know which gene or genes to disrupt to sterilize or otherwise incapacitate a pest. Even with these obstacles, CRISPR technology is moving so fast that human reaction times may not be enough to cork the bottle before the genie escapes. Scientists are scrambling to learn how to keep the genie under control, so that “make a wish” won’t turn into “be careful what you wish for.” Whether gene drives will ever make it out of the lab is a big question. Researchers still don’t know how gene drives will behave in the wild, whether the public will accept them or what regulatory hoops they will have to jump through. Ecologist Ron Thresher got a sense of how the public might react to gene drives when he described his plan to use genetic engineering to rid the Australian waterways of invasive European carp, a voracious fish that can turn a crystal-clear stream into “a disgusting mudhole.” Thresher, with Australia’s Commonwealth Scientific and Industrial Research Organization in Hobart, Tasmania, has a genetic trick to do it. When he talked about his idea with environmentalists, ecologists, aboriginal groups and Boy Scout troops, every group asked the same question: What if one of your carp got loose in Europe? “We could say with hands to heart that [for our system] nothing would happen,” Thresher says. But with a gene drive, a single smuggled fish could theoretically wipe out the entire carp population of Europe. Even with public support, government approval won’t come easy unless rules change. The whole point of a gene drive is to disperse in the wild, but government regulations are designed to keep genetic engineering out of wild organisms, says Zach Adelman, a molecular biologist at Virginia Tech in Blacksburg. “There is no regulatory pathway that can deal with something that, by definition, can’t be contained.” It’s not even clear which government agency would have jurisdiction over gene drives, Kenneth Oye of MIT and colleagues wrote in a commentary last year in Science. U.S. Food and Drug Administration regulations require that genetic modifications to animals be safe and effective for the engineered critters. Gene drives designed to wipe out invasive species might be effective, but they certainly would not be “safe” from the target species’ point of view. Then there’s the Department of Agriculture and the Environmental Protection Agency, which have overlapping regulations on the use of toxic substances, pest control and animal and plant health. Gene drives spreading through wild populations would not respect international boundaries, so they might run afoul of international treaties, such as the Cartagena Protocol on Biosafety that governs cross-border movement of genetically engineered organisms. Nations that release gene drives could also be accused of violating the United Nations Biological Weapons Convention if gene-drive–carrying organisms cause harm to native species in another country. Gene drives may make getting rid of disease and pests easy, but resolving questions surrounding their use will be anything but. — Tina Hesman Saey This article appears in the December 12, 2015, issue of Science News with the headline, "Gene drives unleashed: CRISPR brings a powerful genetic tool closer to reality."


News Article | December 8, 2016
Site: phys.org

A future probe designed for brain mapping is illustrated in Figure 10. Credit: Neurophotonics , doi:10.1117/1.NPh.4.1.011002 The ability to stimulate neural circuits with very high precision light to control cells—optogenetics—is key to exciting advances in the study and mapping of the living brain. In the current state of the art, spatially patterned light projected via free-space optics stimulates small, transparent organisms and excites neurons within superficial layers of the cortex. However, light scattering and absorption in neural tissue cause light penetration to be extremely short, making it impossible to employ free-space optical methods to probe brain regions deeper than about 2 mm. In "Patterned photostimulation via visible-wavelength photonic probes for deep brain optogenetics," published today by SPIE, the international society for optics and photonics, in the journal Neurophotonics, principal author Eran Segev of professor Michael Roukes' group at Caltech, along with coauthors from Caltech, Baylor College of Medicine, and Stanford University, describe a solution. The article is available via open access. Their approach combines nanophotonics and microelectromechanical systems (MEMS) in an implantable, ultra-narrow, silicon-based photonic probe to deliver light deep within brain tissues. This minimally invasive technique avoids major tissue displacement during implantation. Using techniques of optogenetics, a protein in the brain serves as a sensory photoreceptor and can be controlled by specific wavelengths of light. These combined techniques provide a new approach to stimulation of brain circuits with remarkable resolution, enabling observation and control of individual neurons. These breakthroughs present widespread and promising applications for the neuroscience and neuromedical research communities. From characterizing the role of specific neurons and identifying neural circuits responsible for behavior to enabling new methods of operant conditioning through reward-induced circuit activations, optogenetics has become a new path for neuroscientists seeking advances in research capabilities. The article appears in a special section in Neurophotonics, Brain Mapping and Therapeutics, with Shouleh Nikzad, Jet Propulsion Laboratory, Caltech, serving as senior guest editor. The special section is part of an SPIE partnership with the Society for Brain Mapping and Therapeutics (SBMT), serving as a multidisciplinary approach for using advanced technology to solve neurological disorders and disease and to understand neuroscience. The effort was initiated during Nikzad's term as SBMT president in 2015. Explore further: Refining optogenetic methods to map synaptic connections in the brain More information: Eran Segev et al, Patterned photostimulation via visible-wavelength photonic probes for deep brain optogenetics, Neurophotonics (2016). DOI: 10.1117/1.NPh.4.1.011002


IP6, the natural inhibitor or ligand of Clostridium difficile's toxin, binds weakly to the toxin. This results in the toxin remaining active (center figure). Changing a single atom in IP6 to form IP6(S) results in stronger binding to the toxin and its inactivation (left side figure). Credit: T. Savidge (BCM); K. Prince (TCH) Infections with bacterium Clostridium difficile have rapidly become a significant medical problem in hospitals and long-term care facilities. The bacteria cause diarrhea and life-threatening inflammation of the colon by producing toxins that kill the endothelial cells that form the lining of the gut. Although a natural inhibitor of these toxins, called InsP6, works in the test tube, it is not very efficient when administered orally. Traditional methods to optimize InsP6 have until now not been successful, but researchers at Baylor College of Medicine have discovered that changing one atom in InsP6 can increase its ability to neutralize the toxins by 26-fold. The results appear in Science Advances. "The toxins, called TcdA and TcdB, are very large molecules that kill the cells very efficiently," said Dr. Tor Savidge, associate professor of pathology and immunology and of pediatrics, director of the Savidge Lab at the Texas Children's Microbiome Center and senior author of the paper. "It's like delivering a warhead into the cell. The toxins bind to the cell and the cell internalizes them in a sack of cell membrane called endosome. Not all of the toxin will exit this sack to kill the cell, just the little warhead pokes its head out. Another section of the toxin senses when the warhead is outside the sack and cleaves it. The warhead is released, interferes with basic functions and kills the cell," said Savidge. To neutralize the toxins, the researchers targeted the section that senses when the warhead is inside the cell, called allosteric modulator. "The strategy we have tried is to make the toxin 'think,' before it binds to and enters the cell, that the warhead is ready to be released, so it releases it prematurely," said Savidge. When the warhead is released outside the cell, it is neutralized. InsP6, the toxins' natural inhibitor, works this way, but is not very efficient. Finding molecules that would bind to the allosteric modulator and trigger the premature release of the warhead involved analyzing and testing half a million molecules listed in large databases. Dr. Numan Oezguen, a member of the Savidge Lab, used virtual drug screening to sift through the databases to identify candidate molecules that most likely would bind to the allosteric modulator. One of his screening strategies consists of creating virtual 3-D structures of the molecules, projecting them on a large screen and using 3-D glasses to determine the most likely interactions between molecules. The molecules whose virtual analysis suggested they would bind to the allosteric modulator were then tested in the lab. "We found that allosteric mechanisms are very complicated," said Savidge. "You can find something that binds and you think, well, this is probably a good candidate for this, but it's not right. It binds, but it doesn't trigger the premature release of the warhead." Far from discouraging their efforts, the results motivated the researchers to better understand what makes interactions between molecules stronger or weaker. Their comprehensive analysis of numerous molecules provided insights into how water contributes to molecular interactions, in particular those involving hydrogen bonds, one of the most important bonds between molecules. The roles of water and hydrogen bonding had not been considered in this way before. "When you take water into consideration you need to acknowledge that it can form hydrogen bonds, which may or may not compete or interfere with those formed between other molecules such as C. difficile toxins and their inhibitors, which interact in the gut, surrounded by water," said Savidge. "Before we considered the role of water, the predominant idea was that to strengthen the interaction between molecules the ability to form hydrogen bonds had to be made as strong as possible in the drug. It turns out this is not the case," said Oezguen. Many times drugs designed to be able to make strong hydrogen bonds bind poorly to their targets. The researchers discovered that to enhance the binding of a drug to its target, both sides of the hydrogen bond, the side on the drug and the one on the target, have to have either significantly stronger or significantly weaker hydrogen bonding capabilities. On the other hand, a mixed strong-weak hydrogen bond pairing decreases the overall binding of the drug to its target, in some cases by 3 million fold. The decrease in binding is the result, the researchers propose, of water molecules forming hydrogen bonds with the drug and its target, therefore preventing the drug and the target from forming hydrogen bonds between them. With all this information in hand, the researchers proceeded to make chemical changes in the InsP6 inhibitor to improve its hydrogen bonding capabilities with C. difficile toxins. One of the modifications, changing one single atom in InsP6, strengthened InsP6 binding to the allosteric modulator by 26-fold. This observation builds on a report published by Savidge in Science last year exploring the role of water interactions in the origin of enzymatic catalytic power. Plans are currently underway to exploit these fundamentally new concepts in the precision design of future therapeutic applications. Explore further: Researchers claim to have discovered why warm water freezes faster than cooler water More information: Regulation of protein-ligand binding affinity by hydrogen bond pairing, Science Advances, dx.doi.org/10.1126/sciadv.1501240


News Article | February 15, 2017
Site: www.prweb.com

Dermatology Associates (“DA”) is pleased to announce that it recently completed the acquisition of Texoma Dermatology Clinic (“Texoma” or “TDC”). The transaction closed in February 2017. Dermatology Associates is a dermatology-focused physician services and management organization backed by private equity firm ABRY Partners. Based in Sherman, TX, with an additional location in Paris, TX, TDC has provided patients across North Texas and Southern Oklahoma with quality health care since its foundation in 1976. Its specialized physicians provide up-to-date, evidence-based medicine supporting their combined 60+ years of experience to help treat a comprehensive array of dermatologic conditions, including inflammatory diseases, skin cancers, and infection. TDC’s physicians have a combined experience of treating over 60,000 skin cancers. Texoma Dermatology provides services to patients via three board-certified dermatologists and two physician assistants. Dr. Mark Koone has been in private dermatology practice since 1990. In addition to being with TDC since 1993, he is also a dermatologist for the Austin College Student Clinic. Dr. Koone’s educational background includes a B.S., Magna cum Laude from Houston Baptist University, Doctor of Medicine with High Honor at Baylor College of Medicine, an Internal Medicine Internship with Baylor College of Medicine at St. Luke’s Episcopal Hospital and a dermatology residency at Duke University Medical Center. Dr. Koone has been selected to “Best Doctors in America” every year from 1995-2016. Dr. Creed Stewart is a Southern Oklahoma native, and has lived in Sherman, TX since 2002. He received his medical degree and completed his residency at the University of Oklahoma Health Sciences Center, where he served as chief resident. Dr. Stewart is a board-certified dermatologist and is a member of the Alpha Omega Alpha medical honor society. Dr. Stewart has been a fellow of the American Society of Mohs Surgery since 2005. Dr. Clint Moss joined Texoma Dermatology in 2012 after spending many years in Lubbock, TX. He is a board-certified dermatologist and has expertise in both general and surgical dermatology. He received his dermatology training at Texas Tech University Health Sciences Center where he also served as Chief Resident, and was inducted into the Alpha Omega Alpha medical honor society there as well. Joining the physicians of Texoma Dermatology are their highly-experienced physician assistants, Amy Edwards, PA-C, and Ashley Chappell, PA-C. “We are honored to partner with the highly-experienced team at Texoma Dermatology,” said Geoff Wayne, CEO of Dermatology Associates. “Their great reputation and long-standing presence further bolsters our market-leading position in Texas.” If you would like more information about Dermatology Associates, or if you have any questions regarding the partnership with TDC, please contact one of the team members listed below: About Dermatology Associates Headquartered in Dallas, TX, Dermatology Associates provides comprehensive practice management services to over 85 board-certified dermatologists across more than 50 locations in Texas, Kansas and Missouri. Dermatology Associates is focused solely on supporting providers so that they can focus exclusively on delivering high-quality care to patients. By leveraging the benefits of a broad group platform, Dermatology Associates’ physicians are able to maintain professional autonomy while the business aspects of practice management are handled by its team of experts. About ABRY Partners Founded in 1989 and headquartered in Boston, Massachusetts, ABRY Partners is an experienced and successful private equity investment firm focused on media, communications, healthcare services, insurance services, business and information services. Since its founding, ABRY has completed more than $62 billion of transactions, representing investments in more than 550 properties.


News Article | November 22, 2016
Site: www.eurekalert.org

INDIANAPOLIS - A combination of the stimulant drug methylphenidate with a process known as cognitive-behavioral rehabilitation is a promising option to help people who suffer from persistent cognitive problems following traumatic brain injury, researchers at Indiana University School of Medicine have reported. The study, believed to be the first to systematically compare the combination therapy to alternative treatments, was published online in the journal Neuropsychopharmacology, a Nature publication. The researchers, led by Brenna McDonald, PsyD, associate professor of radiology and imaging sciences, and Thomas McAllister, MD, chairman of the Department of Psychiatry, compared the effectiveness of two forms of cognitive therapy with and without the use of methylphenidate, a drug used to treat attention-deficit/hyperactivity disorder and better known by its trade name, Ritalin. "We found that the combination of methylphenidate and Memory and Attention Adaptation Training resulted in significantly better results in attention, episodic and working memory, and executive functioning after traumatic brain injury," said Dr. McDonald. In the Memory and Attention Adaptation Training intervention - also used to assist patients with cognitive issues following breast cancer chemotherapy - therapists work with patients to help them develop behaviors and strategies to improve performance in memory and other cognitive tasks. In this study, this "metacognitive" approach was compared with Attention Builders Training, which Dr. McDonald likened to more of a "drill and practice" approach. The 71 participants who completed the six-week trial were adults who had experienced a traumatic brain injury of at least mild severity - a blow to the head with some alteration of consciousness - at least four months previously, and who either complained of having cognitive problems, or who had been identified with cognitive problems in testing. The participants were divided into four groups: the two cognitive therapy approaches with the drug therapy, and the two approaches with placebo. After six weeks, the researchers found that participants in the combination metacognitive-Ritalin group improved significantly better in word list learning, nonverbal learning and measures of attention-related and executive function. However, Dr. McDonald cautioned that due to the relatively small number of participants in the each of the four arms of the trial - 17 to 19 people each - the results of the trial should be considered preliminary. Nonetheless, she said, the work breaks new ground in providing evidence for the combination therapy. "There have been a few small studies suggesting methylphenidate could help with attention and executive function after traumatic brain injury, which makes senses because it's used to improve attention and focus. But this is the first to test it in combination with cognitive-behavioral therapy for treatment in traumatic brain injury," said Dr. McDonald. In addition to Drs. McDonald and McAllister, researchers contributing to the study were Gwen C. Sprehn, Flora M. Hammond, Jaroslaw Harezlak, Li Xing, Rachel N. Wall, and Andrew J. Saykin of the IU School of Medicine; Laura A. Flashman, Carrie L. Kruck, and Karen L. Gillock of the Geisel School of Medicine, Dartmouth College; David B. Arciniegas of the Baylor College of Medicine; Robert J. Ferguson of the Department of Medicine, University of Pittsburgh; Arthur C. Maerlender of the University of Nebraska and Kim Frey of Craig Hospital, Englewood, Colorado. This study was funded by the Eunice Kennedy Shriver National Institute of Child Health and Human Development of the National Institutes of Health (R01 HD047242). Dr. Arciniegas receives research support from the National Institute on Disability, Independent Living, and Rehabilitation Research (H133A120020, H133A130047) and Department of Veterans Affairs (CX000239) and receives compensation from American Psychiatric Association Publishing.


News Article | February 21, 2017
Site: www.eurekalert.org

Melanoma patients' response to a major form of immunotherapy is associated with the diversity and makeup of trillions of potential allies and enemies found in the digestive tract, researchers at The University of Texas MD Anderson Cancer Center report at the ASCO-Society for Immunotherapy in Cancer meeting in Orlando. Analysis of 113 fecal samples of patients with metastatic melanoma found that those who responded to a PD1 checkpoint inhibitor had a greater diversity of gut bacteria and larger volumes of a specific type of bacteria than those who did not respond. This connection between a person's microbiome - trillions of bacteria harbored to varying degrees in the human body -- and immune system could have major implications for cancer prognosis and treatment. "Anti-PD1 immunotherapy is effective for many, but not all, melanoma patients and responses aren't always durable," said Jennifer Wargo, M.D., associate professor of Surgical Oncology. "Our findings point to two potential impacts from additional research -- analyzing the diversity and composition of the microbiome to predict response to immunotherapy and modulating the gut microbiome to enhance treatment," said Wargo, senior researcher on the project and co-leader of the Melanoma Moon Shot™, part of MD Anderson's Moon Shots Program™ to reduce cancer deaths by accelerating development of therapies from scientific discoveries. PD1 is a protein on the surface of T cells, the immune system's specialized attack cells, that shuts down immune response. Anti-PD1 drugs use an antibody to block activation of PD1 by PD-L1, a ligand found on tumors and surrounding cells. Wargo and colleagues are conducting preclinical research to better understand the mechanisms that connect bacteria and the immune system. They're also designing clinical trials to test the hypothesis that modifying the gut microbiome might improve patients' responses to checkpoint inhibitors. "Evidence from preclinical research had previously indicated a relationship between solid tumors, immune response, and the microbiome. Our study was the first of its type to look at the relationship between the microbiome and immunotherapy response in patients," said Vancheswaran Gopalakrishnan, first author and doctoral student at The University of Texas Health Science Center at Houston School of Public Health. Gopalakrishnan, Wargo and colleagues examined oral and gut microbiome samples from 228 patients with metastatic melanoma. While no differences in response were found in connection with the oral samples, the 113 fecal samples told another story. Gopalakrishnan said the team conducted 16S rRNA sequencing, an analysis of the presence of 16S ribosomal RNA used to identify bacteria. Among the 93 patients treated with anti-PD1 immune checkpoint blockade, the researchers had gut microbiome samples from 30 responders and 13 non-responders. They found: The researchers also conducted immune profiling before treatment for the presence of important immune system cells in the tumors. Responders had significantly increased immune infiltrates in their tumors, including the presence of CD8+ killer T cells, correlated to the abundance of a specific bacterium. Even as they conduct deeper research into the microbiome and the metabolites produced by bacteria to affect the immune response, the team is also studying ways to change the composition of the microbiome. "The microbiome is highly targetable in a variety of ways," Gopalakrishnan said, including by diet, probiotics to boost the presence of helpful bacteria, antibiotics or by fecal transplants. In collaboration with the Parker Institute for Cancer Immunotherapy (PICI), the first clinical trial is expected to launch later this year. Research also continues funded by MD Anderson's Melanoma Moon Shot™. The Melanoma Research Alliance and PICI also provided support for this study. Co-authors with Gopalakrishnan and Wargo are Christine Spencer, Tatiana Karpinets, Ph.D., Robert Jenq, M.D., and Andrew Futreal, Ph.D., of Genomic Medicine; Alexandre Reuben, Ph.D., Peter Prieto, M.D., and Jeffrey Gershenwald, M.D., of Surgical Oncology; Kristi Hoffman, Ph.D., of Cancer Prevention; Michael Tetzlaff, Ph.D., M.D., and Alexander Lazar, M.D., Ph.D., of Pathology; Michael Davies, M.D., Ph.D., and Patrick Hwu, M.D., of Melanoma Medical Oncology; Padmanee Sharma, M.D., Ph.D., of Genitourinary Medical Oncology and Immunology; Jim Allison, Ph.D., of Immunology; Carrie Daniel-MacDougall, Ph.D., of Epidemiology; and Diane Hutchinson, Ph.D., Nadim Ajami, Ph.D., and Joseph Petrosino, Ph.D., of Baylor College of Medicine.


To enable this ambitious project, the U.S. government's Intelligence Advanced Research Projects Activity(IARPA) has awarded a $21 million contract to an interdisciplinary team of neuroscientists, computer scientists, physicists and mathematicians, led by principal investigator Dr. Andreas Tolias, associate professor of neuroscience at Baylor. The research team includes scientists from Baylor, the California Institute of Technology, Columbia University, Cornell University, Rice University, the University of Toronto and the University of Tuebingen. The program supporting this research is known as Machine Intelligence from Cortical Networks (MICrONS) and was envisioned and organized by Jacob Vogelstein, a neuromorphic engineer and program manager with IARPA. It is part of the broader BRAIN Initiative, launched in 2013 by President Obama with the goal of understanding devastating brain diseases and developing new technology, treatments and cures. "Our goal is to discover the algorithms and learning rules that the brain implements and use these discoveries to create fundamentally smarter artificial neural networks" said Tolias. Artificial Intelligence (AI) has been a dream for a long time, but an elusive one. People have consistently underestimated how hard it is to construct intelligent systems, Tolias said. Famously, in 1955, cognitive scientists proposed to solve AI as a summer project for several Dartmouth undergraduates. It didn't turn out to be that easy. But in the past few years, AI has been booming, and applications have blossomed everywhere. Handheld devices now use machine learning algorithms to recognize faces and speech, the first self-driving cars already are on the roads, and computer systems regularly wade through Big Data to find new medicines and anticipate geopolitical and financial trends. Despite their new successes, "these artificial neural networks are still incredibly primitive compared to biological neural networks, and don't learn the way real brains do," said Dr. Xaq Pitkow, co-principal investigator of the MICrONS project, and an assistant professor of neuroscience and McNair Scholar at Baylor as well as an assistant professor of electrical and computer engineering at Rice University. "By modeling the brain's computations and extracting their key features, we think we can give computers the ability to do much better." Researchers have been trying to develop brain-like intelligence for years, so what has changed that makes this more achievable today? Tolias's answer: bigger and better data. Jacob Reimer, assistant professor of neuroscience at Baylor and one of the lead scientists and project manager of the team, agrees. "Technologies in both physics and molecular biology have advanced so much that we can now record from many hundreds of neurons at a time, with even more extensive recordings on the horizon," he said. "This lets us analyze neural circuits in ways that we couldn't dream of just a few years ago." In order to accomplish their ambitious goals, the team musters an impressive range of experts, each directing a research group in different aspects of the project. Chris Xu, a physicist at Cornell University, has pioneered 3-photon imaging, a novel method to monitor neural activity non-invasively and more deeply in the brain than ever before. Thanos Siapas of Caltech will focus his team's efforts on unraveling the learning rules in the brain. On the theoretical and mathematical modeling side, Mathias Bethge of the University of Tuebingen and Liam Paninski of Columbia, will develop mathematical models and statistical methods to help interpret the complex data collected by the team's experimentalists. Even with the massive trove of data they will collect by recording neural activity, it can be hard to tell which neurons are connected to each other, directly exchanging information. That type of wiring information is critical to understanding the brain's algorithms that are embodied in its biological wetware. Accordingly, the Baylor-led team also is partnering with two other groups to reconstruct the complete wiring diagram for a cube of brain whose activity they measure. Clay Reid and Nuno da Costa from the Allen Institute for Brain Science will use electron microscopy to image biological structures down to scales reaching just billionths of a meter. They will then hand off about 1,000 large hard disks full of these massive images to Sebastian Seung from Princeton University, who will extract the three-dimensional structure of the neurons, including their shapes and connections. All together, the team will create one of the most exhaustive neuroscience data set in history. The ultimate key to succeeding in the goals of the MICrONS project is to implement neuroscience principles in computer algorithms. Working closely with the neuroscientists, team members Ankit Patel, assistant professor of neuroscience at Baylor College of Medicine and Rice University, Richard Baraniuk from Rice University, and Raquel Urtasun and Richard Zemel from the University of Toronto, are machine learning experts, tasked with integrating the computational building blocks the neuroscientists discover into new kinds of artificial neural networks. This endeavor represents a monumental challenge and opportunity for both neuroscience and computer science. There is no better test of neuroscience principles than to see whether machines built from those principles actually solve real-world problems, Tolias said. "The project demonstrates what is possible when we bring together world-class interdisciplinary researchers to solve fundamental problems. This bold endeavor could provide enormous benefits to society, including new computer technologies, new understanding of the brain, and new medical breakthroughs," said Dr. Paul Klotman, Baylor College of Medicine president, CEO and executive dean. The team's grand aims are to understand one cubic millimeter of a mouse brain, and if they are successful their new algorithms will revolutionize machine learning. But it will still be the product of human ingenuity and creativity, and it will take more understanding than we can squeeze from a tiny cube of mouse brain to match that feat. Explore further: How maths can help explain the workings of our brain


News Article | November 3, 2016
Site: www.eurekalert.org

New Rochelle, NY, November 3, 2016-Analysis of a single urine sample using a metabolomics-based screening approach can identify multiple different inborn errors of metabolism (IEMs), facilitating early disease detection and rapid initiation of treatment, as described in an article published in Genetic Testing and Molecular Biomarkers, a peer-reviewed journal from Mary Ann Liebert, Inc., publishers. The article is available free on the Genetic Testing and Molecular Biomarkers website until November 30, 2016. Adam Kennedy, Sarah Elsea, and coauthors from Metabolon, Inc. (Durham, NC) and Baylor College of Medicine (Houston, TX), present the automated IEM screening platform they have designed and implemented in the article entitled "Metabolomic Profiling of Human Urine as a Screen for Multiple Inborn Errors of Metabolism". Biochemical signatures have been identified in urine for more than 30 IEMs, which have traditionally been detected in various different bodily fluids including blood and cerebrospinal fluid. This study demonstrates the potential to detect numerous IEMs in a single urine sample using one metabolomics-based assay performed on an automated screening platform. "This is both transformative research and an economical and efficient way to provide precision medicine on a population-based scale," says Genetic Testing and Molecular Biomarkers Editor-in-Chief Garth D. Ehrlich, PhD, FAAAS, Center for Genomic Sciences and Center for Advanced Microbial Processing, Institute for Molecular Medicine and Infectious Disease, Drexel College of Medicine (Philadelphia, PA). Genetic Testing and Molecular Biomarkers is an authoritative peer-reviewed journal published 12 times per year online with open access options and in print that reports on all aspects of genetic testing, including molecular and biochemical based tests and varied clinical situations; ethical, legal, social, and economic aspects of genetic testing; and issues concerning effective genetic counseling. Tables of content and a free sample issue may be viewed on the Genetic Testing and Molecular Biomarkers website. Mary Ann Liebert, Inc., publishers is a privately held, fully integrated media company known for establishing authoritative peer-reviewed journals in many promising areas of science and biomedical research, including Human Gene Therapy and OMICS: A Journal of Integrative Biology. Its biotechnology trade magazine, GEN (Genetic Engineering & Biotechnology News), was the first in its field and is today the industry's most widely read publication worldwide. A complete list of the firm's 80 journals, books, and newsmagazines is available on the Mary Ann Liebert, Inc., publishers website.


News Article | March 9, 2016
Site: www.nature.com

Scientists around the world are working to solve the same basic formula: what number and mix of group members makes for the most efficient and productive lab? Some principal investigators (PIs) produce a steady stream of high-impact papers with just a couple of people in the lab; others successfully oversee a team that could populate a village. Some stock up on postdocs, and others aim to balance career stages and positions: graduate students, staff scientists and technicians. One of the most important steps for new PIs to take early in their career is to identify the formula that works best for them. In the past, they have had to decide the make-up of their group largely on the basis of their instincts and, often, financial realities. But now, they have some data to turn to. Studies on how lab size and composition affect productivity give researchers guidance in their quest for better science, more publications and higher impact. Junior faculty members who are deciding how to staff their lab need to consider their priorities: do they want to maximize the number of publications, or focus instead on impact? Do they favour hands-on or hands-off management? The number and type of people in a lab can affect all these important parameters, so PIs should build their labs with care — and with a plan. Two studies published last year suggest that most labs could produce more papers and make a bigger splash by — perhaps unsurprisingly — bringing more people on board. One of these, a 2015 study of nearly 400 life-sciences PIs in the United Kingdom, found that the productivity of a lab — measured by the number of publications — increased steadily, albeit modestly, with lab size ( , , & PeerJ http://doi.org/bcwf; 2015). In terms of sheer paper production, “it's best for a lab to be as big as possible”, says co-author Adam Eyre-Walker, a geneticist at the University of Sussex, UK. Notably, the study found no sign that individual members become less productive or less efficient as labs grow. “Adding a team member to a large lab gives you the same return as adding one to a small lab,” Eyre-Walker says. The second paper, a study of 119 biology laboratories from 1966 to 2000 at the Massachusetts Institute of Technology in Cambridge, found that productivity inched forward when an average-sized lab of ten members added people ( & Res. Pol. 44, 1633–1644; 2015). But this study did detect limits: once lab size reached 25 people — an unusually high number achieved by very few labs — the addition of team members no longer conferred benefit. Further, a lab's productivity tops out with 13 postdocs, the study found. Co-author Christopher Liu, a former biochemist who now researches strategic management at the University of Toronto, Canada, points out that his study was limited to biology labs at one institution, which makes it tricky to generalize the findings. Still, he says, PIs should pay attention to the take-home message: bigger isn't always better. “Going from 15 to 20 people is probably not great,” Liu says. “But going from two people to seven is something that you should probably do. A group of two people is pretty fragile.” Sarah Teichmann, a molecular biologist at the EMBL–European Bioinformatics Institute and at the Wellcome Trust Sanger Institute in Hinxton, UK, can attest to both the pay-offs and the challenges of growing a lab. “When I started in 2001, it was just myself and a PhD student,” she says. “I grew my group slowly. After three years, I had three PhD students and a postdoc.” She might have kept that modest configuration, but a change of focus forced a change in lab size. After several years of work on the computational aspects of gene expression and protein folding, Teichmann added an experimental angle to her research. She started by hiring one postdoc to focus on experimental work, but soon realized that he needed help. “He was alone and isolated,” she says. “It didn't really work. There has to be a critical mass of experimental and computational people or it won't take off.” A €1.3-million (US$1.4-million) grant from the European Research Council in 2010 enabled her to add three people, and her lab was on the way to bigger things, including more grants, awards and high-impact publications. Today, she leads a group of five postdocs, four PhD students and two staff scientists — one for the computational side and one for the experimental side — with a steady flow of visiting scientists. Staying on top of such an enterprise has been daunting for her and her team (see 'How to pick the right group'). “The bigger your group is, the less face-to-face time you're going to have,” she says. “There are only 24 hours in a day.” Teichmann tries to keep the lab running smoothly by hiring people who work well together and support each other without her constant involvement. Her strategy is working: she has had her name on 16 publications since the start of 2015, including two articles in Science. She also won the 2015 EMBO Gold Medal, a prize awarded to outstanding young scientists in the life sciences. Still, as Liu points out, bigger labs aren't always the key to a productive career. A smaller group can work for those who prefer to manage team members themselves and whose research doesn't require a huge roster. For his part, Eyre-Walker finds comfort in the knowledge that small labs can make a big splash: his study found only a weak correlation between lab size and the average impact factor of each paper. He oversees a relatively small team of three PhD students and a postdoc, and says that he can remain deeply engaged with the analysis of all the work in his lab. “I couldn't cope with any more people,” he says. “I like it like this. I can still do science. I'm not just managing people.” Some PIs learn through experience that they prefer a less-populous team. Koen Venken, a geneticist at Baylor College of Medicine in Houston, Texas, rapidly built a team of ten lab members after starting his faculty job in 2014. But he soon realized that his team members weren't working well together. “It was a mistake, and I'm happy to admit it,” he says. After some rapid downsizing, he now has a group of two PhD students, one postdoc, one lab technician, one research associate and a non-tenure-track instructor, a mix that has proved to be productive and efficient. Looking back, Teichmann is glad that she took a slow, deliberate approach to building her lab. “Going slow is important for the sanity of the PI,” she says. Eyre-Walker agrees. “You have to feel your way into it. Start small, and see how you get on. The worst thing you can do as a new faculty member is take on five PhD students.” But size is only one measure of a lab. PIs who are assembling a team also have to consider balance — and that means weighing the relative merits of graduate students, postdocs, technicians and other potential members. According to the Research Policy study, postdocs — especially those who have external funding through fellowships — are the key drivers of productivity. Overall, adding a funded postdoc to the average lab boosts output by about 29% of a published paper every year. Graduate students don't contribute much to productivity, but they do play an important part in the group. The analysis found that students are as valuable as funded postdocs for generating 'breakthrough' papers, which the study defined as anything published in Science, Nature or Cell. Adding either a funded postdoc or a graduate student to the average lab increases the chances of such a paper by about 8%, the team found. Postdocs without their own funding, who may not be quite as accomplished as their funded peers, do not improve the odds of a breakthrough paper at all. Many PIs eventually have to concede to financial and other realities. Sergey Kryazhimskiy, an evolutionary biologist at the University of California, San Diego, was originally dead set against hiring postdocs. He recognized that many postdocs end up stuck in their positions and are not able to move on to tenure-track jobs — and he did not want to play a part in what he views as an unfair system with enormous stakes. “If you're a responsible PI, you would like your postdocs to proceed somewhere after your lab,” he says. “It's difficult to assign them risky projects. You're playing with their lives.” He had a plan for avoiding his ethical dilemma: he would bring in staff scientists who were committed to their lab careers. But when he actually got his faculty position earlier this year, he realized that pragmatic considerations outweighed the ethical ones. He estimates that at his institution, it costs nearly twice as much to hire staff scientists as it does to hire postdocs, partly because they get benefits such as paid time off and health insurance. Unable to stick with his original strategy, Kryazhimskiy has started to interview postdocs. He is looking for candidates whom he thinks will have a good shot at a faculty job, even in a tough academic market. Another option is to find someone with other career goals, such as a job in industry. From a purely practical perspective, he thinks that postdocs will be the best investment of his grant money. PIs whose labs — and grants — are on the large side may be better able to absorb the cost of staff scientists. For Teichmann, at least, her two staff members are key to her lab's success. Both are accomplished researchers who know how the lab works and how to get things done. She expects to hire two more professionals: a lab manager and a software developer. “Then I would have four core people who can support my postdocs and PhD students,” she says. Unlike postdocs and graduate students, those four professionals wouldn't be locked into a pressurized timeline to graduate or to move on to another job. Venken would eventually like to add a few people to his lab, too — perhaps some postdocs, graduate students or a mixture of both. “I just want people who are invested in everything that we're doing,” he says. The size and structure of a lab can be hugely important, but in the end, the quality of any workplace comes down to the quality of the people, PIs say. Whether they are looking for graduate students or postdocs, whether they desire a large or small research group, new PIs need to find team members who are ready to contribute. “The first set of individuals that you hire is very important,” Liu says. “They set the tone for the entire laboratory.”


News Article | December 5, 2016
Site: www.newscientist.com

At the fifth annual Breakthrough Prize ceremony last night, 12 scientists received a total of $25 million in science prizes for fundamental contributions to human knowledge. The ceremony, held at NASA’s Ames Research Center in Mountain View, California, featured all the glitz and glam of the Oscars: a red carpet, musical guests such as Alicia Keys and will.i.am, and Morgan Freeman as host. “This project is really mostly about public outreach,” says billionaire internet investor Yuri Milner, who co-founded the prize. “That’s why we have a televised ceremony and everything around it, because the founders want to send a signal that fundamental science is important.” The Breakthrough Prize was founded in 2012 and is financed by Silicon Valley billionaires such as Milner, Google’s Sergey Brin and Facebook’s Mark Zuckerberg. One of the prizes was already announced earlier this year. The physicists behind the LIGO experiment, which revealed the first detection of Einstein’s long-sought gravitational waves in February, will share the $3 million Breakthrough Prize in fundamental physics. Of that, $1 million will be split between three of LIGO’s founders: Ronald Drever and Kip Thorne at the California Institute of Technology, and Rainer Weiss at the Massachusetts Institute of Technology. The other $2 million will be equally split between 1012 contributors to the experiment. Another $3 million prize in fundamental physics will be split between three physicists. Joseph Polchinski at the University of California, Santa Barbara, was recognised for his theories of what happens at the event horizons of black holes, and Andrew Strominger and Cumrun Vafa at Harvard University were honoured for contributions to quantum gravity and string theory. The Breakthrough Prize in mathematics – another $3 million – went to Jean Bourgain at the Institute for Advanced Study in Princeton, New Jersey, for his contributions to analysis, combinatorics, partial differential equations, high-dimensional geometry and number theory. Five prizes of $3 million each went to researchers in the life sciences. Stephen Elledge at Harvard Medical School and the Brigham and Women’s Hospital in Boston, Massachusetts, received a prize for insights into how cells sense and respond to damage in their DNA, and how that relates to the development and treatment of cancer. Harry Noller at the University of California, Santa Cruz, was recognised for discovering how central RNA is in the fundamental machinery of protein synthesis in all cells, connecting modern biology to the origin of life and explaining how many natural antibiotics work. Roeland Nusse at Stanford University and the Howard Hughes Medical Institute was honoured for pioneering work on the Wnt pathway, which encourages cells to divide and is one of the crucial intercellular signalling systems in developmental, cancer and stem cell biology. Yoshinori Ohsumi at Tokyo Institute of Technology in Japan received a prize for his discovery of the mechanisms behind autophagy, a fundamental process in which cells degrade, recycle and repair themselves. Ohsumi also received the 2016 Nobel Prize in Physiology or Medicine. The fifth life-sciences prize went to Huda Yahya Zoghbi at Baylor College of Medicine in Houston, Texas, for her discoveries related to the genetic causes and biochemical mechanisms of neurodegenerative and neurological diseases, including Rett syndrome and spinocerebellar ataxia. The final $1 million in prize money will go to six “New Horizons” winners for early-career achievements in physics and maths, and one Breakthrough Junior Prize for a teenager’s original science video. After five years of pushing for scientists to be treated like celebrities, Milner thinks the project is off to a good start. “If a few kids in a high school will get inspired by those incredible people, I think this effort is worth pursuing,” he says. “I think it’s really about the priorities of society: where we should put more resources in, and where the smartest people should go. If we can reach even half the audience of the Super Bowl globally, that would be amazing. But that’s a high bar.”


Cheng-Lun Soo, MD Recognized as a Top 100 Doctor for Two Consecutive Years by Strathmore's Who's Who Worldwide Publication Oklahoma City, OK, March 02, 2017 --( About Cheng-Lun Soo, MD Dr. Soo is the Owner and a Physician for 16 years at Orthopedic Reconstruction Center which is a medical center providing orthopedic patient care in Oklahoma City, Oklahoma. He specializes in orthopedic spinal surgery. He is fluent in English and Chinese. Dr. Soo is affiliated with multiple hospitals in the area, including Deaconess Hospital and Integris Southwest Medical Center. Dr. Soo is a member of the A.A.O.S., the N.A.S.S and the Oklahoma Orthopedic Society. Born in Taipei, Taiwan on October 20, 1958, Dr. Soo obtained a M.D. from the University of Kentucky, School of Medicine in 1993 and completed his orthopedic residency and surgery internship at Baylor College of Medicine. He conducted his spine fellowship in a combined program at the University of Louisville and Tulane University. Dr. Soo is Board Certified in Orthopedic Surgery-spine. For further information, contact www.orc-ok.com. About Strathmore’s Who’s Who Worldwide Strathmore’s Who’s Who Worldwide is an international advertising, networking and publishing company based in Farmingdale, New York. They are proud to be able to satisfy their clients and continue to have repeat clientele due to their longevity and pride in their products and services. The Owners strive to connect business professionals to enhance their contact base and networking capabilities so they can get the acknowledgment and publicity within their industries and beyond. The Strathmore family has been providing these valuable services for over two decades. They target executives and professionals in all industries to be featured in their publication and on-line directory. Industries include business, law, education, healthcare and medicine, fine arts, IT, government, science, real estate, entertainment and many more accomplished fields. Professional profiles are listed in an annual hardcover journal and in a detailed, searchable database on the website www.strww.com. Oklahoma City, OK, March 02, 2017 --( PR.com )-- Cheng-Lun Soo, MD of Oklahoma City, Oklahoma has been recognized as a Top 100 Doctor for two consecutive years, 2016 and 2017, by Strathmore’s Who’s Who Worldwide Edition for his outstanding achievements and contributions for over 23 years in the field of orthopedic healthcare.About Cheng-Lun Soo, MDDr. Soo is the Owner and a Physician for 16 years at Orthopedic Reconstruction Center which is a medical center providing orthopedic patient care in Oklahoma City, Oklahoma. He specializes in orthopedic spinal surgery. He is fluent in English and Chinese.Dr. Soo is affiliated with multiple hospitals in the area, including Deaconess Hospital and Integris Southwest Medical Center. Dr. Soo is a member of the A.A.O.S., the N.A.S.S and the Oklahoma Orthopedic Society.Born in Taipei, Taiwan on October 20, 1958, Dr. Soo obtained a M.D. from the University of Kentucky, School of Medicine in 1993 and completed his orthopedic residency and surgery internship at Baylor College of Medicine. He conducted his spine fellowship in a combined program at the University of Louisville and Tulane University. Dr. Soo is Board Certified in Orthopedic Surgery-spine.For further information, contact www.orc-ok.com.About Strathmore’s Who’s Who WorldwideStrathmore’s Who’s Who Worldwide is an international advertising, networking and publishing company based in Farmingdale, New York. They are proud to be able to satisfy their clients and continue to have repeat clientele due to their longevity and pride in their products and services. The Owners strive to connect business professionals to enhance their contact base and networking capabilities so they can get the acknowledgment and publicity within their industries and beyond. The Strathmore family has been providing these valuable services for over two decades. They target executives and professionals in all industries to be featured in their publication and on-line directory. Industries include business, law, education, healthcare and medicine, fine arts, IT, government, science, real estate, entertainment and many more accomplished fields. Professional profiles are listed in an annual hardcover journal and in a detailed, searchable database on the website www.strww.com. Click here to view the list of recent Press Releases from Strathmore Worldwide


News Article | October 26, 2016
Site: www.eurekalert.org

Personalized therapies can potentially improve the outcomes of patients with lung cancer, but how to best design such an approach is not always clear. A team of scientists from Baylor College of Medicine and the University of Texas MD Anderson Cancer Center analyzed vast amounts of molecular data from a set of more than 1,000 non-small cell lung cancers that allowed them to break down the cancers into distinct subtypes, each with its own molecular profile and potentially different response to therapy. The results appear in Oncogene. "People may think of lung cancer as one disease, but lung cancer is a collection of diverse subtypes of cells and each subtype may respond differently to the same therapy," said senior author Dr. Chad Creighton, associate professor of medicine and member of the Dan L Duncan Comprehensive Cancer Center Division of Biostatistics at Baylor College of Medicine. By using molecular data - which would inform scientists, for instance, about which genes and proteins the cancer expresses and changes in its DNA- the researchers were able to tease out the different subtypes and have a more refined system of classification for non-small cell lung cancer. "Any two given lung cancers may have very different molecular profiles," said Creighton. "One would have certain genes turned on and produce certain proteins while the other cancer would have different genes turned on and express different proteins. This would imply that one cancer subtype might be more vulnerable to specific therapies while the other might be more susceptible to other therapies." The researchers found that the tumors are complex in more than one way. They are complex because of the diversity of alterations involving tumor cells, but also in the variety of non-tumor cells that are part of the tumor microenvironment. "One big part of the study was to try to tease out the cells in the tumor that actually are not cancer," said Creighton. "Those cells include lymphocytes - a type of immune cell that tries to attack the cancer. Lymphocytes showed up in the tumor profile and we found out that only specific subsets of lung cancer show this really strong pattern for lymphocyte infiltration. These cancer subtypes also show evidence for immune check point pathway, which is a pathway by which cancer cells learn to evade the immune system which normally would actively attack and kill cancer cells. Many cancers have learned some 'tricks' so they can turn on or off specific genes or proteins that allow them to evade the immune response." With these types of analyses the researchers identified specific subsets of cancer cells that they think might be more responsive to immunotherapy - a therapy to boost the body's natural defenses to fight the cancer. Immunotherapy has had a lot of success in a subset of human cancers. "The Cancer Genome Atlas, the cancer initiative that generated these data that we analyzed, involves data for over 10,000 cancers," said Creighton. "That information is now in the public domain and we are currently going through all of the data, not just for lung cancer, but for all the cancer types. We call this pan cancer analysis. We are trying to find features that not just apply to one type of cancer, but across multiple types. Much of our work in the next year is going to be focusing on pan cancer work that might point at ways of treating multiple types of cancer." Other contributors to this work include Fengju Chen, Yiqun Zhang, Edwin Parra, Jaime Rodríguez, Carmen Behrens, Rehan Akbani, Yiling Lu, Jon Kurie, Don Gibbons, Gordon Mills and Ignacio Wistuba, who are affiliated with Baylor and/or the University of Texas MD Anderson Cancer Center. Financial support for this project was provided by the National Institutes of Health (NIH) grant 2R01CA125123-09, MD Anderson's Institutional Tissue Bank Award 2P30CA016672, The University of Texas Lung Specialized Programs of Research Excellence grant P50CA70907, Cancer Prevention and Research Institute of Texas (CPRIT) grant RP120713 C2, P2 and RP150405 and Department of Defense PROSPECT grant W81XWH-07-1-0306.


News Article | December 22, 2016
Site: www.eurekalert.org

CINCINNATI--Cancer researchers at the University of Cincinnati (UC) College of Medicine have found an obesity-associated protein's role in leukemia development and drug response which could lead to more effective therapies for the illness. The study, which will be published in the Dec. 22 online edition of Cancer Cell and led by Jianjun Chen, PhD, associate professor in the Department of Cancer Biology, provided evidence that FTO--the protein associated with fat mass and obesity--plays a critical cancer-promoting role by regulating expression of a set of genes through a mechanism involving ribonucleic acid (RNA) modification and thereby increasing the reproduction of leukemia cells and prohibiting drug response. "N6-methyladenosine (m6A) RNA methylation, the most prevalent internal modification in messenger RNAs (mRNAs, which translate DNA) in genes, was first identified in 1970s. In 2011, Dr. Chuan He, professor of chemistry at the University of Chicago, a co-senior author of this paper, discovered for the first time that FTO actually functions as an eraser of m6A methylation. This means that it can remove the modification from RNA transcripts, or RNA copies, thereby showing that m6A modification is a reversible process and is highly likely it is of biological importance. In 2012, two groups independently reported the development of novel sequencing technologies to profile all m6A modification areas in the entire genome and showed that roughly one-third of mRNAs in individual mammal cells are targets of m6A modification, highlighting the prevalence and potential functional importance of m6A modification. "Recent studies have shown that m6A modification in mRNAs or non-coding RNAs plays critical roles in virtually all major normal biological processes such as tissue development and stem cell self-renewal and differentiation. However, little is known about the biological importance of m6A modification in the regulation of cancer-causing genes and/or tumor-suppressing genes in the development of tumors." Researchers in the study analyzed a microarray dataset of 100 human acute myeloid leukemia (AML) samples from patients and nine normal control samples as well as other large-scale microarray datasets of AML samples. They found that FTO was highly expressed in various subtypes of leukemia samples such as those that contained chromosome crossover (genetic exchange between chromosomes) or mutations in certain genes. The high level of FTO expression contributed to cancer cells multiplying and surviving and also promoted the development of leukemia in animal models and the non-response of cancer cells to therapeutic agents. Additionally, researchers found that genes like ASB2 and RARA, which were reported to inhibit leukemia cell growth and/or mediate the response of leukemia cells to therapeutic agents, were suppressed in the AML samples with higher FTO expression. The suppression of these genes was attributed to FTO-controlled decreased stability of their mRNA and was connected to FTO's m6A demethylase activity. "Our study shows, for the first time, the functional importance of the m6A modification machinery in leukemia," says Chen. "In addition, given the functional importance of FTO in the formation of leukemia and drug response, targeting FTO signaling may present a new therapeutic strategy to treat leukemia. As FTO may also play a cancer-promoting role in various types of solid tumors, besides leukemia, our discoveries may have a broad impact in cancer biology and cancer therapy. Further studies are needed to advance our understanding of the critical role of FTO in various types of cancers and to develop more effective novel therapeutic strategies based on such understanding to treat cancers." In addition to researchers from the University of Cincinnati, scientists from Howard Hughes Medical Institute and the University of Chicago; Baylor College of Medicine; and the First Affiliated Hospital Zhejiang University, Wuhan University and Sun Yat-Sen University Cancer Center, all in China, were involved in the study. This study was funded by the National Institutes of Health (CA178454, CA182528,CA214965 and GM071440), the Leukemia & Lymphoma Society, the American Cancer Society, Howard Hughes Medical Institute, the Damon Runyon Cancer Research Foundation, the China Scholarship Council and the Foundation of Innovation Team for Basic and Clinical Research of Zhejiang Province. The authors cite no conflict of interest.


News Article | December 9, 2016
Site: www.eurekalert.org

SAN ANTONIO -- Breast cancer mortality rates continue to decline in many nations, but a review of mortality trends in 47 countries around the world indicates some significant disparities, particularly in South Korea and some Latin American nations, according to results presented at the 2016 San Antonio Breast Cancer Symposium, held Dec. 6-10. "Breast cancer is by far the primary cancer site in women and, worldwide, represents a quarter of all cancers in women," said the study's lead author, Cécile Pizot, MSc, at the International Prevention Research Institute in Lyon, France. "Comparing mortality trends between countries helps identify which health care systems have been the most efficient at reducing breast cancer mortality." In this study, Pizot and colleagues extracted information on breast cancer deaths from the World Health Organization database and calculated mortality rates over the years 1987-2013, stratifying results according to age groups. Overall, breast cancer mortality declined in 39 out of 47 countries, including the United States and most developed European nations. England and Wales had the sharpest drop in mortality, with a 46 percent decline. Pizot said this trend was to be expected, due to advances in detection and treatment over the past few decades. Latin American nations experienced scattered increases in mortality; for example, Brazil and Colombia saw mortality rates increase in women of all age groups, while in Argentina and Chile mortality rates decreased in all women. South Korea had the most dramatic increase in breast cancer mortality, with an 83 percent increase overall and higher mortality in every age group. However, the breast cancer mortality rate is still lower than the rate in the United States (5.3 per 100,000 women in South Korea compared with 14 per 100,000 women in the United States in the 2011-2013 period). "South Korea has experienced major societal changes since the 1950s and quickly evolved from an agricultural, developing country to a highly industrialized and Westernized country," Pizot said. "Such quick changes might explain the considerable shift in cancer mortality." Other highlights of the study: "This finding underlines the difficulty of isolating a single, common factor that would have a major influence on mortality trends," Pizot said, adding that future research on breast cancer mortality should focus on other facets of breast cancer management, including risk factors, drug therapies, access to care, and the use of multidisciplinary teams. "Differences in health care systems and patient management could explain discrepancies in mortality reduction between similar countries," Pizot said. "However, there is at present little data comparing the management of breast cancer patients across countries." Pizot said a limitation of the study is that data were unavailable for many Latin American, Asian, and African nations. This study was funded internally by the International Prevention Research Institute. Pizot has no conflicts of interest. Abstract Publication Number: P5-08-04 Title: Overview of breast cancer mortality trends in the world Presentation: Friday, Dec. 9, Poster Session 5, 5 p.m. CT The mission of the 2016 San Antonio Breast Cancer Symposium is to produce a unique and comprehensive scientific meeting that encompasses the full spectrum of breast cancer research, facilitating the rapid translation of new knowledge into better care for patients with breast cancer. The Cancer Therapy & Research Center (CTRC) at The University of Texas Health Science Center at San Antonio, the American Association for Cancer Research (AACR), and Baylor College of Medicine are joint sponsors of the San Antonio Breast Cancer Symposium. This collaboration utilizes the clinical strengths of the CTRC and Baylor and the AACR's scientific prestige in basic, translational, and clinical cancer research to expedite the delivery of the latest scientific advances to the clinic. For more information about the symposium, please visit http://www. . To interview Cécile Pizot, contact Julia Gunther at julia.gunther@aacr.org or 267-250-5441.


Le Breakthrough Prize in Life Sciences 2017 est décerné à Stephen J. Elledge, Harry F. Noller, Roeland Nusse, Yoshinori Ohsumi et Huda Yahya Zoghbi Le Breakthrough Prize in Fundamental Physics 2017 est décerné à Joseph Polchinski, Andrew Strominger et Cumrun Vafa Le Breakthrough Prize in Mathematics 2017 est décerné à Jean Bourgain Le prix New Horizons in Physics est décerné à Asimina Arvanitaki, Peter W. Graham et Surjeet Rajendran ; Simone Giombi et Xi Yin ; et Frans Pretorius Le prix New Horizons in Mathematics est décerné à Mohammad Abouzaid, Hugo Duminil-Copin, et Benjamin Elias et Geordie Williamson Le deuxième Breakthrough Junior Challenge annuel est remporté par les étudiantes Antonella Masini, 18 ans (Pérou) et Deanna See, 17 ans (Singapour) Le Special Breakthrough Prize in Fundamental Physics 2016 a été décerné en mai aux fondateurs et aux membres de l'équipe de LIGO, et attribué à Kip Thorne, Rainer Weiss et à la famille de Ronald Drever Les lauréats seront récompensés lors d'un brillant gala de remise des prix présenté par Morgan Freeman, qui verra un spectacle en direct d'Alicia Keys et des interventions de Daniel Ek (PDG de Spotify), Jeremy Irons, Mark et Scott Kelly, Hiroshi Mikitani (PDG de Rakuten), Sienna Miller, Bryce Dallas Howard, Vin Diesel, Kevin Durant, Dev Patel, Sundar Pichai (PDG de Google), Alex Rodriguez, Will.i.am, Susan Wojcicki (PDG deYouTube) et des fondateurs des Breakthrough Prize SAN FRANCISCO, 5 décembre 2016 /PRNewswire/ -- Le Breakthrough Prize et ses fondateurs Sergey Brin et Anne Wojcicki, Yuri et Julia Milner, Mark Zuckerberg et Priscilla Chan, ont annoncé ce soir les lauréats des Breakthrough Prizes 2017, qui marquent le cinquième anniversaire de cette organisation reconnaissant les meilleures réussites en sciences de la vie, physique fondamentale et mathématiques. Ce sont au total 25 millions de dollars qui ont été décernés lors de la cérémonie de gala qui a eu lieu dans la Silicon Valley et a été présentée par Morgan Freeman. Chaque Breakthrough Prize représente un montant de 3 millions de dollars, ce qui en fait la récompense monétaire individuelle la plus élevée dans le domaine de la science. Cette année, un total de sept prix a été décerné à neuf personnes, alors que le Special Breakthrough Prize in Fundamental Physics, d'une valeur de 3 millions de dollars, a été divisé entre les trois fondateurs et les quelque mille membres de l'équipe de LIGO. Par ailleurs, trois prix New Horizons in Physics d'un montant de 100 000 USD ont été décernés à six physiciens en début de carrière, et trois autres prix New Horizons in Mathematics de 100 000 dollars ont été attribués à quatre jeunes mathématiciens. Et cette année il y a eu deux gagnantes du Breakthrough Junior Challenge, et chaque lauréate a reçu jusqu'à 400 000 dollars en prix destiné à la formation, pour elles-mêmes, pour leur professeur respectif et leur école. Depuis sa création en 2012, le Breakthrough Prize a attribué près de 200 millions de dollars pour récompenser des recherches qui bousculent les paradigmes de la physique fondamentale, des sciences de la vie et des mathématiques. « Il n'y a jamais eu d'époque plus importante pour soutenir les sciences », a déclaré le fondateur de Facebook, Mark Zuckerberg. « Les lauréats du Breakthrough Prize 2017 représentent les leaders de la recherche scientifique en physique, mathématiques et sciences de la vie. Leurs avancées vont ouvrir de nouvelles possibilités et contribuer à faire du monde un endroit meilleur pour tout le monde. » Le Breakthrough Prize in Life Sciences 2017 a été décerné à Stephen J. Elledge (École de médecine de Harvard) ; Harry F. Noller (Université de Californie, Santa Cruz) ; Roeland Nusse (Université Stanford) ; Yoshinori Ohsumi (Institut de Technologie de Tokyo) ; Huda Yahya Zoghbi (Baylor College of Medicine). Le Breakthrough Prize in Fundamental Physics 2017 a été décerné à Joseph Polchinski (Université de Californie, Santa Barbara) ; Andrew Strominger (Université de Harvard) et Cumrun Vafa (Université de Harvard). Les trois lauréats ont rejoint ceux du Special Prize in Fundamental Physics précédemment annoncé et attribué en mai 2016. Ronald Drever (Institut de Technologie de Californie, Pasadena), Kip Thorne (Institut de Technologie de Californie, Pasadena) et Rainer Weiss (Institut de technologie du Massachusetts) ont été reconnus en mai pour leur détection des vagues gravitationnelles, ce qui ouvre de nouveaux horizons en astronomie et en physique. Les trois gagnants du Prix spécial se partageront un montant d'un million de dollars, et les 1 012 membres de l'équipe de LIGO se partageront 2 millions de dollars. Le Breakthrough Prize in Mathematics 2017 a été décerné à Jean Bourgain (Institute for Advanced Study). La cérémonie de cette année marquera le cinquième anniversaire de l'organisation, et les lauréats seront sur le devant de la scène ce soir lors d'un gala exclusif organisé conjointement par les fondateurs Sergey Brin et Anne Wojcicki, Yuri et Julia Milner, Mark Zuckerberg et Priscilla Chan, et par le rédacteur en chef de Vanity Fair, Graydon Carter. L'acteur qui a remporté un Award® de l'Académie, Morgan Freeman, présentera le gala, qui verra un spectacle de l'actrice quinze fois primée par les Grammy Award®, Alicia Keys, et les interventions de personnalités comme Jeremy Irons, Mark et Scott Kelly, Hiroshi Mikitani (PDG de Rakuten), Sienna Miller, Bryce Dallas Howard, Vin Diesel, Kevin Durant, Dev Patel, Sundar Pichai (PDG de Google), Alex Rodriguez, Will.i.am, Susan Wojcicki (PDG de YouTube), ainsi que des fondateurs du Breakthrough Prize. La soirée sera placée sous le thème de « la portée universelle des idées ». « La science est universelle », a déclaré Yuri Milner. « Ce soir elle a rassemblé certains des plus grands acteurs, sportifs, musiciens, universitaires, entrepreneurs, astronautes et, bien entendu, scientifiques du monde entier, pour célébrer ce que l'esprit humain est capable de faire. Et cela a attiré un public venu des quatre points de la planète. » L'un des moments forts sera les discours prononcés par les deux étudiantes qui ont remporté le Breakthrough Junior Challenge, Antonella Masini, 18 ans (Pérou) et Deanna See, 17 ans (Singapour). Le Breakthrough Junior Challenge est un concours mondial de vidéos scientifiques conçu pour inspirer la pensée créative sur les concepts fondamentaux en sciences de la vie, physique ou mathématiques. En reconnaissance de leurs candidatures gagnantes, les deux étudiantes ont reçu jusqu'à 400 000 dollars en prix pour la formation, dont une bourse d'une valeur de 250 000 dollars, 50 000 dollars pour les professeurs qui les ont respectivement inspirées, ainsi qu'un laboratoire de pointe évalué à 100 000 dollars. Des candidatures venant de 146 pays ont été reçues pour l'édition 2016 du concours mondial, qui a démarré le 1er septembre 2016. Le Breakthrough Junior Challenge a été fondé par Mark Zuckerberg et Priscilla Chan, Yuri et Julia Milner, à travers la Breakthrough Prize Foundation, et se fonde sur une bourse provenant du fonds de Mark Zuckerberg à la Silicon Valley Community Foundation, et sur une bourse de Milner Global Foundation. « Le Breakthrough Junior Challenge encourage les étudiants à mieux comprendre les mondes des sciences et des mathématiques et à trouver du plaisir à les explorer », a déclaré la cofondatrice du Breakthrough Prize, la Dr Priscilla Chan. « Antonella et Deanna ont toutes les deux un brillant avenir dans les sciences et je suis ravie de récompenser leur travail. Ce sont aussi de grandes oratrices, dont les capacités à exprimer ces idées complexes d'une façon accessible et captivante est une vraie source d'inspiration. J'ai vraiment hâte de voir comment elles vont changer le monde. » Par ailleurs, six prix New Horizons – un prix annuel doté de de 100 000 dollars, qui reconnait les réussites de physiciens et de mathématiciens en début de carrière, ont été attribués. Le prix New Horizons in Physics a été décerné à : Le prix New Horizons in Mathematics a été décerné à : La cérémonie sera réalisée et produite, pour la quatrième fois, par Don Mischer, aux côtés des producteurs exécutifs Charlie Haykel et Juliane Hare de Don Mischer Productions. La cérémonie sera intégralement diffusée en direct sur NATIONAL GEOGRAPHIC à 10 h, heure de l'Est américain et 9 h, heure du centre, le dimanche 4 décembre. Un montage d'une heure de la cérémonie sera également retransmis sur FOX le dimanche 18 décembre, à 19 heures, heure de l'Est et 20 heures, heure du Pacifique, et à l'échelle mondiale sur NATIONAL GEOGRAPHIC dans 171 pays et en 45 langues. Le Breakthrough Prize in Life Sciences récompense des avancées qui transforment la compréhension des systèmes vivants et de l'extension de la vie humaine, avec un prix consacré au travail contribuant à la compréhension des maladies neurologiques. Chacun des cinq lauréats des prix de Sciences de la vie a reçu une récompense de 3 millions de dollars. Stephen J. Elledge, professeur de génétique et de médecine, titulaire de la chaire Gregor Mendel, au département de génétique à l'École de médecine de Harvard et de la division de génétique au Brigham and Women's Hospital et chercheur au Howard Hughes Medical Institute, pour expliciter la façon dont les cellules eucaryotes sentent et répondent aux dommages faits dans leur ADN et pour donner des informations sur le développement et le traitement du cancer. Harry F. Noller, directeur du Center for Molecular Biology of RNA (Centre de la biologie moléculaire de l'ARN), Robert L. Sinsheimer, professeur de biologie moléculaire et professeur émérite de biologie moléculaire, cellulaire et du développement à l'Université de Californie, Santa Cruz, pour avoir découvert le rôle central de l'ARN dans la formation des centres actifs du ribosome, la machinerie fondamentale de la synthèse des protéines dans toutes les cellules, connectant ainsi la biologie moderne à l'origine de la vie et expliquant également combien d'antibiotiques naturels perturbent la synthèse des protéines. Roeland Nusse, professeur de biologie du développement à l'université Stanford et chercheur au Howard Hughes Medical Institute, pour sa recherche pionnière sur la voie des protéines Wnt, l'un des systèmes de signalement intercellulaire fondamentaux dans le développement, le cancer et la biologie des cellules souche. Yoshinori Ohsumi, professeur honoraire, Institut de la recherche innovante de l'Institut de technologie de Tokyo pour élucider l'autophagie, le système de recyclage que les cellules utilisent pour générer des substances nutritives provenant de leurs composants non essentiels ou endommagés. Huda Yahya Zoghbi, professeur du département de pédiatrie, de génétique moléculaire et humaine, de neurologie et de neurosciences au Baylor College of Medicine, chercheur au Howard Hughes Medical Institute et directeur du Jan and Dan Duncan Neurological Research Institute (NRI) à l'Hôpital pour enfants du Texas, pour ses découvertes sur les causes génétiques et les mécanismes biochimiques de l'ataxie spinocérébelleuse et du syndrome de Rett, découvertes qui ont ouvert des fenêtres sur la pathogénèse des maladies neurodégénératives et neurologiques. Le Breakthrough Prize in Fundamental Physics reconnait les plus grandes idées sur les questions les plus profondes que nous pose l'univers. Les trois gagnants, qui se partagent un prix de 3 millions de dollars, sont : Joseph Polchinski, professeur au département de physique et membre du Kavli Institute for Theoretical Physics à l'Université de Californie, Santa Barbara ; Andrew Strominger, directeur du Center for the Fundamental Laws of Nature de l'université Harvard ; et, Cumrun Vafa, professeur de sciences, titulaire de la chaire Donner, au département de physique de l'université Harvard. Tous les trois ont reçu le prix pour les avancées transformatrices en théorie quantique des champs, théorie des cordes et gravité quantique. Le Breakthrough Prize in Mathematics récompense les meilleurs mathématiciens au monde qui ont contribué à des avancées majeures dans ce domaine. Jean Bourgain, professeur de mathématiques, titulaire de la chaire IBM von Neumann, à l'École de mathématiques de l'Institute for Advanced Study, Princeton, New Jersey, pour ses multiples contributions qui transforment l'analyse, la combinatoire, les équations différentielles partielles, la géométrie hautement dimensionnelle et la théorie des numéros. Le New Horizons in Physics Prize est décerné à de prometteurs chercheurs en début de carrière qui ont déjà produit un travail important en physique fondamentale. Le prix New Horizons in Mathematics est décerné à de prometteurs chercheurs en début de carrière qui ont déjà produit un travail important en mathématiques. Le deuxième Breakthrough Junior Challenge annuel reconnaît deux vainqueurs cette année - Antonella Masini, 18 ans, du Pérou, et Deanna See, 17 ans, de Singapour. Antonella et Deanna recevront chacune jusqu'à 400 000 dollars en prix pour la formation. La vidéo d'Antonella, présentée dans la catégorie « physique », est axée sur l'intrication quantique. La vidéo de sciences de la vie de Deanna, intitulée « Superbugs! And Our Race against Resistance » (Superbactéries ! Et notre course contre la résistance) abordait la résistance aux antibiotiques. Les images et les vidéos choisies du gala du Breakthrough Prize 2017 – tapis rouge et cérémonie – peuvent être téléchargées à des fins d'utilisation par la presse sur : Pour la cinquième année consécutive, les Breakthrough Prizes vont reconnaître les meilleurs scientifiques au monde. Chaque prix a une valeur de 3 millions de dollars et récompense dans les domaines des sciences de la vie (jusqu'à cinq prix par an), de la physique fondamentale (un prix par an) et des mathématiques (un prix par an). Par ailleurs, jusqu'à trois prix New Horizons in Physics et jusqu'à trois prix New Horizons in Mathematics sont décernés à de jeunes chercheurs chaque année. Les lauréats participent à une cérémonie de remise des prix télévisée conçue pour célébrer leurs réussites et pour inspirer la nouvelle génération de scientifiques. Dans le cadre de l'agenda de la cérémonie, ils participent aussi à un programme de conférences et de débats. Les Breakthrough Prizes ont été fondés par Sergey Brin et Anne Wojcicki, Mark Zuckerberg et Priscilla Chan, Yuri et Julia Milner. Des comités de sélection composés de précédents lauréats du Breakthrough Prize choisissent les vainqueurs. Vous trouverez des informations sur les Breakthrough Prizes en cliquant sur www.breakthroughprize.org.


DENVER, CO--(Marketwired - October 28, 2016) - Denver Health (DH) and the University of Colorado School of Medicine (SOM), along with two other prestigious trauma research institutions, have been awarded a U.S. Department of Defense (DOD) contract that could lead to $90 million in research over the next decade to improve trauma care for civilians and military personnel. The contract will launch with a $10.7 million project where DH and SOM will work with the University of Pittsburgh and the University of Oregon, to establish a nationwide network of trauma systems capable of conducting detailed research to improve injury outcomes. The Linking Investigations in Trauma and Emergency Services (LITES) network will collect extensive data from thousands of trauma cases across the country. "LITES will allow us to access information across the broad spectrum of trauma care, from the pre-hospital setting through hospital discharge and beyond," said Dr. Ernest E. Moore, principal investigator for the Colorado consortium, trauma surgeon at Denver Health, and professor of surgery at the School of Medicine. "Our immediate goal will be to evaluate the information coming in and our sense is that after accruing and harmonizing the data, we'll be able to launch subsequent projects, including randomized clinical trials, at the DOD's request." The four organizations, all of which have collaborated previously, will provide leadership and oversight to the LITES network. Five additional trauma centers -- the University of Texas at Houston, Vanderbilt University, University of Louisville, Baylor College of Medicine and the University of Arizona -- will share trauma data with the system. "The initial data collected will help us to identify any regional variations in the ways trauma injuries are managed," said Dr. Mitchell Cohen, director of surgery at Denver Health and professor of surgery at CU School of Medicine. "Using that data will allow us to design future research projects to determine best practices and ultimately improve survival rates following critical injury." Other key participants on the Colorado team include Dr. Ani Banerjee, Dr. Chris Silliman, Dr. Angela Sauaia, and Dr. Jason Haukoos, who are all members of the CU School of Medicine faculty. The initial phase of LITES is expected to last six -18 months, with future studies and clinical trials being conducted over the next ten years. The goal, established by a recent report published in the National Academies of Sciences, Engineering and Medicine, is to achieve zero preventable deaths after injury and minimal trauma related disability. This material is based upon work supported by the U.S. Army Medical Research Acquisition Activity under Contract No. W81XWH-16-D-0024-0001. Any opinions, findings and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the U.S. Army Medical Research Acquisition Activity. Denver Health is the Rocky Mountain Region's Level I academic trauma center, and the safety net hospital for the Denver area. The Denver Health system, which integrates acute and emergency care with public and community health, includes the Rocky Mountain Regional Trauma Center, Denver's 911 emergency medical response system, Denver Health Paramedic Division, nine family health centers, 17 school-based health centers, the Rocky Mountain Poison and Drug Center, NurseLine, Denver CARES, Denver Public Health, the Denver Health Foundation and the Rocky Mountain Center for Medical Response to Terrorism, Mass Casualties and Epidemics. Faculty at the University of Colorado School of Medicine work to advance science and improve care. These faculty members include physicians, educators and scientists at University of Colorado Health, Children's Hospital Colorado, Denver Health, National Jewish Health, and the Denver Veterans Affairs Medical Center. The school is located on the Anschutz Medical Campus, one of four campuses in the University of Colorado system. To learn more about the medical school's care, education, research and community engagement, visit its web site.


News Article | December 22, 2016
Site: www.eurekalert.org

An international team of scientists has identified variants of the gene EBF3 causing a developmental disorder with features in common with autism. Identification of these gene variants leads to a better understanding of these complex conditions and opens the possibility of diagnosing other previously undiagnosed patients with similar clinical disorders. The study appears in the American Journal of Human Genetics. "We investigate the genetic causes of complex neurological conditions of various types, such as autism spectrum disorders and intellectual disability," said first author Dr. Hsiao-Tuan Chao, postdoctoral research fellow of pediatric-neurology at Baylor College of Medicine. "Such conditions are long-lasting, manifest very early in life and range from mild to severe. They can affect different neurological functions; however, sometimes they have overlapping similarities. For many of these conditions there is no definite diagnosis, treatments are limited and there is no cure." Chao and colleagues have taken a step toward better understanding some of these conditions. They discovered new mutations of the gene EBF3 in three patients presenting with a newly described syndrome. "The patients' main features include developmental delay, coordination problems, limited facial expressions at an early age and abnormal verbal communication and social behaviors. They can also present with repetitive motor movements, high threshold to pain and cognitive impairments," said Chao. "This newly described syndrome has many similarities with what we see in autism spectrum disorders, but also important differences." The researchers used whole exome sequencing, a laboratory technique that allows the identification of all the genes in an individual's genome. In the patients, they identified two new variants of the gene EBF3 that were not present in the patients' parents. Mutations of EBF3 are rare in the general population but more common in a population of individuals with autism spectrum disorders and intellectual disability. "The gene is known to be essential for normal development of the nervous system," said Chao. "It is one of the key factors involved in how neurons develop and connect with each other, but has not been studied in detail. In animal models, mutations that cause the gene to lose its function result in death of the embryo. EBF3 had never before been associated with a disease." That the three patients with developmental disorders have mutations in the same gene is not sufficient proof that the mutations cause the condition. To determine whether the mutations can cause neurodevelopmental problems the scientists tested the effect of the mutations in the laboratory fruit fly, Drosophila melanogaster. "We genetically engineered fruit flies to carry the mutations present in the patients," said Chao. "The defective gene product was not able to carry on the functions of the normal gene; the effect is so severe that the fly embryos do not survive. On the other hand, when we introduced the normal version of the human gene, the files developed normally." The identification of variants of EBF3 that can cause neurodevelopmental disorders has improved the genetic diagnosis of these conditions."We are able to provide a genetic diagnosis for patients who did not know the cause of their condition," said Chao. "This provides some relief to their parents and the possibility of reaching for support from a community of parents whose children are affected by similar disorders. In addition, by gaining a better understanding of how people are affected by EBF3 dysfunction, we as physicians are better equipped to prognosticate the developmental outcomes for these children." "Being able to see our research in fruit flies help us diagnose a patient in our own hospital was very gratifying. Knowing the genetic basis allows for more insights into this disorder of the brain," said Dr. Michael F. Wangler, assistant professor of molecular and human genetics at Baylor, a senior author on the paper. Other contributors to this work include Mariska Davids, Elizabeth Burke, John G. Pappas Jill A. Rosenfeld, Alexandra McCarty, Taylor Davis, Lynne Wolfe, Camilo Toro, Cynthia Tifft, Fan Xia, Nicholas Stong, Travis K. Johnson, Coral G. Warr, Members of the UDN, Shinya Yamamoto, David Adams, Thomas C. Markello, William A. Gahl, Hugo J. Bellen and May Christine V. Malicdan. The authors are affiliated with one or more of the following institutions: Baylor College of Medicine, Texas Children's Hospital, National Institutes of Health, National Human Genome Research Institute, New York University, Baylor Genetics Laboratories, Columbia University, the Howard Hughes Medical Institute and Monash University. This work was supported in part by U54NS093793, R24OD022005, and R01GM067858, by the Intramural Research Program of the National Human Genome Research Institute and by the Common Fund, Office of the Director of the National Institutes of Health. The Department of Molecular and Human Genetics at Baylor College of Medicine derives revenue from the clinical exome sequencing offered at Baylor Genetics.


News Article | November 11, 2015
Site: www.techtimes.com

A new study suggests that medicines do not expire faster in space and that it does not exude significant differences in degradation, compared to what is observed on Earth. Medications are known to eventually undergo the process of degradation, specifically when it is exposed to oxygen, humidity and light. Although the temperatures and humidity inside the International Space Station (ISS) are recognized to be within conducive ranges for drug storage, the impacts of other factors while in spaceflight such as microgravity and increased radiation have not yet been assessed in terms of deterioration outcomes. In a new pilot-scale study by Virginia Wotring from Baylor College of Medicine, drugs approved by the U.S. Food and Drug Administration (FDA) were collected from and repackaged by Johnson Space Center (JSC) Pharmacy to follow space mission requirements. A total of nine medication types were processed, including an antihistamine, two sleeping pills, a decongestant, an antidiarrheal, three painkillers and an alertness drug. The medications were then transported to the ISS via Russia's Progress spacecraft and after 550 days in the space research complex, it was returned back to Earth via Dragon (SpaceX) capsule. The drug samples were sent to California via boat before it was flown to JSC in Houston, Texas for analysis. The total time of travel from capsule splashdown to the final destination is more or less 58 hours. The samples were analyzed using the procedures included in the 2012 United States Pharmacopeia (USP) to identify levels of active pharmaceutical ingredient (API) and detect and measure degradation products. The findings of the study showed that most of the drugs did not expire faster in space. "Some ISS-aged medications met API and impurities requirements months after their expiration dates," the study read. One drug met USP stipulations five months after its official expiration date. Four of the medicines were still usable up to eight months after expiration and three medications conformed to the USP guidelines after being tested three months following the expiration date. Meanwhile, a sleeping pill did not meet USP conditions 11 months after expiration. The study did not find noteworthy degradation products in all of the tests. The author noted, however, that the results of the study are founded on measurements made in a specific period of time for a handful of drugs only. With this, the results cannot be used to predict the safety and efficacy of other medications or inferred to other storage times. In the end, Wotring wrote that the study provides valuable initial source of information, but more comprehensive studies are needed to confirm if spaceflight conditions trigger unusual deterioration during storage. The study was published in the American Association of Pharmaceutical Scientists (AAPS) journal on Friday, Nov. 6.


SAN ANTONIO -- Radiotherapy increased complications and impaired patient-reported satisfaction with reconstructed breasts in breast cancer patients who received implant reconstruction but not in those who received autologous reconstruction, according to data from a large, prospective, multicenter cohort study presented at the 2016 San Antonio Breast Cancer Symposium, held Dec. 6-10. Autologous breast reconstruction is a procedure in which a woman's own body tissues are used to create a new breast after breast cancer surgery. "There is growing evidence supporting the benefits of post-mastectomy radiotherapy in appropriate patients, but many patients still must decide whether they feel that the benefits given their particular circumstances outweigh the risks," said Reshma Jagsi, MD, DPhil, professor and deputy chair in the Department of Radiation Oncology at the University of Michigan. "One of the risks of radiation therapy is that it may affect the options and outcomes for breast reconstruction, which many women who receive mastectomy desire." Women diagnosed with early-stage breast cancer face challenging decisions that will impact both their long-term disease control and quality of life, Jagsi said. Because many women who undergo mastectomy become long-term survivors, breast reconstruction can have a lasting impact on quality of life. Optimal approaches to integrate post-mastectomy radiotherapy and breast reconstruction are not well established thus far, she added. Jagsi and colleagues conducted a multicenter cohort study called the Mastectomy Reconstruction Outcomes Consortium (MROC), in which they collected medical data and patient-reported outcomes data from 553 and 1,461 patients who did and did not receive radiotherapy, respectively. About 38 percent and 25 percent of the patients who did and did not receive radiotherapy, respectively, received autologous reconstruction, and the rest received implant reconstruction. The researchers assessed if radiotherapy was associated with developing complications after breast reconstruction, such as hematoma and wound infection, and measured patients' satisfaction with the outcome using a BREAST-Q patient-reported outcome instrument, one and two years after reconstruction. After a year of follow-up, 28.8 and 22.3 percent of the patients who did and did not receive radiotherapy, respectively, had at least one of the complications measured. After two years of follow-up, 34.1 percent of the patients who received radiotherapy and 22.5 percent of those who did not receive radiotherapy experienced reconstruction-related complications. When the researchers took several variables into account, radiotherapy was associated with more than double the odds of developing complications in patients who received implants, but it was not associated with complications in those who received autologous reconstruction. Based on BREAST-Q scores, patient-reported satisfaction was significantly lower in those who received radiation versus those who did not receive radiation among patients who received implants, but no such differences were found among patients who received autologous reconstruction. "Although women must still weigh multiple factors, including the differences in operative time and rehabilitation required for different approaches, when selecting their preferred type of reconstruction, those who plan to receive post-mastectomy radiation therapy should be informed of the substantial and significant impact of radiotherapy observed in the current study among patients who received implant reconstruction," Jagsi said. "Conversely, those who plan to pursue autologous reconstruction and are debating whether or not to receive radiotherapy may derive some reassurance from the current study findings that outcomes among patients receiving autologous reconstruction did not appear substantially worse than those of unirradiated patients by two years," she added. A limitation of this study is that it is observational and does not establish cause-effect relationship. Further, patients treated at centers that are particularly skilled in integrating implant-based approaches with radiotherapy may still do well with such an approach, Jagsi noted. This study was funded by the National Cancer Institute. Jagsi declares no conflict of interest. Abstract Publication Number: S3-07 Title: Impact of radiotherapy on complications and patient-reported satisfaction with breast reconstruction: Findings from the prospective multicenter MROC study Presentation: Thursday, Dec. 8, General Session 3 - Hall 3, 11 a.m. CT The mission of the 2016 San Antonio Breast Cancer Symposium is to produce a unique and comprehensive scientific meeting that encompasses the full spectrum of breast cancer research, facilitating the rapid translation of new knowledge into better care for patients with breast cancer. The Cancer Therapy & Research Center (CTRC) at The University of Texas Health Science Center at San Antonio, the American Association for Cancer Research (AACR), and Baylor College of Medicine are joint sponsors of the San Antonio Breast Cancer Symposium. This collaboration utilizes the clinical strengths of the CTRC and Baylor and the AACR's scientific prestige in basic, translational, and clinical cancer research to expedite the delivery of the latest scientific advances to the clinic. For more information about the symposium, please visit http://www. . To interview Reshma Jagsi, contact Julia Gunther at julia.gunther@aacr.org or 267-250-5441.


News Article | December 8, 2016
Site: www.prweb.com

The ability to stimulate neural circuits with very high precision light to control cells — optogenetics — is key to exciting advances in the study and mapping of the living brain. In the current state of the art, spatially patterned light projected via free-space optics stimulates small, transparent organisms and excites neurons within superficial layers of the cortex. However, light scattering and absorption in neural tissue cause light penetration to be extremely short, making it impossible to employ free-space optical methods to probe brain regions deeper than about 2 mm. In “Patterned photostimulation via visible-wavelength photonic probes for deep brain optogenetics,” published today by SPIE, the international society for optics and photonics, in the journal Neurophotonics, principal author Eran Segev of professor Michael Roukes’ group at Caltech, along with coauthors from Caltech, Baylor College of Medicine, and Stanford University, describe a solution. The article is available via open access. Their approach combines nanophotonics and microelectromechanical systems (MEMS) in an implantable, ultra-narrow, silicon-based photonic probe to deliver light deep within brain tissues. This minimally invasive technique avoids major tissue displacement during implantation. Using techniques of optogenetics, a protein in the brain serves as a sensory photoreceptor and can be controlled by specific wavelengths of light. These combined techniques provide a new approach to stimulation of brain circuits with remarkable resolution, enabling observation and control of individual neurons. These breakthroughs present widespread and promising applications for the neuroscience and neuromedical research communities. From characterizing the role of specific neurons and identifying neural circuits responsible for behavior to enabling new methods of operant conditioning through reward-induced circuit activations, optogenetics has become a new path for neuroscientists seeking advances in research capabilities. The article appears in a special section in Neurophotonics, Brain Mapping and Therapeutics, with Shouleh Nikzad, Jet Propulsion Laboratory, Caltech, serving as senior guest editor. The special section is part of an SPIE partnership with the Society for Brain Mapping and Therapeutics (SBMT), serving as a multidisciplinary approach for using advanced technology to solve neurological disorders and disease and to understand neuroscience. The effort was initiated during Nikzad’s term as SBMT president in 2015. David Boas of Massachusetts General Hospital, Harvard Medical School, is the editor-in-chief of Neurophotonics. Launched in 2014, Neurophotonics is published digitally in the SPIE Digital Library and in print. The journal covers advances in optical technology applicable to the study of the brain and their impact on basic and clinical neuroscience applications. The SPIE Digital Library contains more than 458,000 articles from SPIE journals, proceedings, and books, with approximately 18,000 new research papers added each year. Abstracts are freely searchable, and a number of journal articles are published with open access. SPIE, the international society for optics and photonics, is an educational not-for-profit organization founded in 1955 to advance light-based science, engineering and technology. The Society serves nearly 264,000 constituents from approximately 166 countries, offering conferences and their published proceedings, continuing education, books, journals, and the SPIE Digital Library. In 2016, SPIE provided $4 million in support of education and outreach programs. http://www.spie.org


News Article | April 18, 2016
Site: www.biosciencetechnology.com

Thanks in part to the efforts of one dedicated mother, who took to Facebook to document her son’s mysterious developmental disability, an international team of researchers led by scientists at UC San Francisco and Baylor College of Medicine in Houston has now identified a new genetic syndrome that could help illuminate the biological causes of one of the most common forms of intellectual disability. In a study of 10 children published online in the American Journal of Human Genetics on April 14, the researchers linked a constellation of birth defects affecting the brain, eye, ear, heart and kidney to mutations in a single gene, called RERE. The discovery is likely to aid researchers striving to understand the cause of birth defects more broadly, the study’s authors said, but it is also a boon to families who know for the first time the reason their children share this group of developmental disabilities. “Just having an answer can be hugely beneficial for families,” said co-senior author Elliott Sherr, M.D., Ph.D., a UCSF pediatric neurologist who directs the Brain Development Research Program and the Comprehensive Center for Brain Development at UCSF. “Of course, getting a genetic answer is just the first step, but for the longest time we didn’t even have that much. It gives these families hope that we can move forward.” Finding could speed search for answers in more common genetic syndrome In their paper, the researchers demonstrate that the developmental disabilities suffered by children with RERE mutations correspond almost perfectly to the well-known pattern of intellectual disabilities, heart defects, craniofacial abnormalities, and hearing and vision problems seen in 1p36 deletion syndrome, one of the most common sources of intellectual disability in children. This syndrome occurs in approximately 1 in 5,000 newborns, and is caused by a much larger (and harder to study) pattern of genetic damage in the so-called 1p36 region at the tip of human chromosome 1. The research group of Daryl Scott, MD, PHD, an associate professor of molecular and human genetics at Baylor College of Medicine, has been working for many years to identify the specific genes that cause the medical problems in children with 1p36 deletion syndrome. “Previous research had narrowed it down to two smaller ‘critical regions’ within the 1p36 region, but even these smaller regions contain dozens of different genes,” said Scott, who was co-senior author on the new study. Scott’s group had focused on the RERE gene, which lies within one of these 1p36 critical regions, because it plays a role in retinoic acid (vitamin A) signaling, an important pathway regulating the development of many organs, including the brain, eye and heart. The Baylor researchers found that mice with Rere mutations had birth defects that were very similar to the children with 1p36 deletions, but had initially been unable to prove that damage to this gene was sufficient produce the same developmental problems in humans. Sherr and Scott credit the genesis of their collaboration to Chauntelle Trefz, the mother of one of Sherr’s patients who connected the two researchers after discovering Scott’s work on mice with Rere mutations online and whose Facebook page about her son, Harrison, became a hub for identifying other children with the same condition. Trefz says that getting the whole exome sequencing results from Sherr and learning that a single gene mutation was responsible for her son’s dizzying array of symptoms — which include global developmental delay, vision problems, hearing problems, weak muscles, and constant acid reflux — was “a game-changer.” “Learning about the mutation was like a huge weight had been lifted,” she said. “When you bring a child with special needs into the world you feel so guilty, like you’ve done something wrong. Hope can be a hard thing to find. Dr. Sherr gave us hope.” Trefz started a Facebook page documenting the joys and challenges of raising and caring for Harrison, who is now 4, hoping to find other families whose children had the same condition. “Harrison is such a happy kid, and he seems normal in many ways, but he’s really not,” she said. “I could see a lot of kids falling through the cracks without the right diagnosis. I wanted other parents to see this and say, ‘that sounds like my son.’” Soon Sherr and Scott had identified 10 children with RERE mutations through collaborators around the US, as well as several from the Netherlands who had found the researchers through Trefz’s Facebook page. The researchers began a thorough comparison of these 10 children with a cohort of 31 patients with the more common 1p36 deletion syndrome, and found that RERE mutations alone produced almost exactly the same pattern of symptoms as 1p36 syndrome, with the exception of a few of the craniofacial abnormalities and cardiomyopathies often seen in that more common syndrome. Additional experiments showed that unique brain and eye problems first observed in human patients were also seen in the mice with Rere mutations. “It’s still a shock that [a mutation in] one gene is capable of causing all these different problems,” Scott said. “But this finding really brings everything together, from molecular studies to mouse experiments and all the way to human patients. We’ve finally proved what we’ve been talking about for all these years.” Though much more study is needed to understand the syndrome fully, Scott said, RERE mutations may be capable of inducing a diverse set of developmental problems because the protein encoded by the gene interacts with important developmental processes in many organs throughout the body, such as the retinoic acid signaling crucial for proper eye and heart development. When RERE doesn’t function properly, the development of all of these organs is affected. Sherr acknowledges that the current sample of just 10 patients with RERE mutations, who each experience slightly different symptoms with notably different levels of severity, is too small to give a complete portrait of the new syndrome. “Now that we’ve seen the first 10 cases, we want to know what the next 10, the next 20 look like,” he said. “That may not take very long. Before we’d even published the paper, we’d already gotten calls from more clinics around the country whose patients have similar mutations. We suspect this syndrome may be significantly more common than we previously appreciated.” The empowerment of families through social media and the plummeting cost of of gene sequencing technologies have produced a revolution in the pace of discovery about rare genetic conditions, Sherr said. “In the last five years alone there’s been a huge explosion in the number of conditions we can decipher genetically – we can take a few kids with developmental disabilities, come up with a coherent genetic explanation for what has happened and use that as first step for how to move forward” he said. “When I started working in child neurology as a fellow back in the late ‘90s, we understood just a few of these super-rare genetic disorders but now there are hundreds. And we’re just getting started.” The authors acknowledge the following industry ties: Sherr is a member of the clinical advisory board of genetic testing company InVitae and consults for Personalis. Four of the authors are employees of GeneDx, which provides exome sequencing on a clinical basis. The Department of Molecular and Human Genetics at Baylor College of Medicine derives revenue from clinical laboratory testing conducted at Baylor Miraca Genetics Laboratories, which provides exome sequencing on a clinical basis.


News Article | December 12, 2016
Site: www.eurekalert.org

Scientists have linked a gene called PKD1L1 with disarrangement of human internal organs, known as laterality defects, and complex congenital heart disease. This discovery contributes to a better understanding of the genetic causes of this condition and opens the possibility for families carrying the disease genes to have children unaffected by the disease via prenatal or pre-implantation genetic diagnosis. The study appears in the American Journal of Human Genetics. "This project began when a family was referred to our Baylor Genetics laboratory for prenatal genetic assessment after ultrasound showed complex congenital malformations in the fetus," said first author Dr. Francesco Vetrini, lead clinical genomics scientist at Baylor Genetics. "The liver and spleen and stomach were in the reverse site of the fetus' body, and the heart presented with malformations." This family was searching for an answer because they already had lost one child with a similar disorder. The researchers used whole exome sequencing to analyze all the genes in the fetus' genome looking for a genetic cause of the condition. A variety of genes are already known to cause laterality defects in humans, but the researchers did not find any disease-causing mutations in these genes in the fetus' samples. "However, we found a change in a gene called PKD1L1, which until now had not been associated with any disorders in humans. This prompted us to do additional studies to confirm that the newly found mutation was the cause of the condition," said senior author Dr. Yaping Yang, senior director of Baylor Genetics and associate professor of molecular and human genetics at Baylor College of Medicine. "The role of PKD1L1 in medical genetics was completely unknown, but it was known to a small circle of developmental biologists who had found that the gene is involved in the right and left positioning of internal organs in the mouse and the medaka fish laboratory models," said Vetrini. "In these models, the loss of function of PKD1L1 causes characteristics very similar to those observed in our patient." The next step was to corroborate that this evidence in animal studies also was associated with laterality and congenital defects in humans. First, the scientists found that the previously deceased brother with the same condition carried the same mutation. In addition, thanks to the collaboration with co-authors Dr. James R. Lupski, Cullen Professor of Molecular and Human Genetics at Baylor, Dr. John W. Belmont, now senior principal medical scientist at Illumina Inc., and other colleagues, the scientists found in the Baylor-Hopkins Center for Mendelian Genomics another family in which one member with similar laterality and congenital heart defects had a different mutation in PKD1L1. "Using bioinformatics tools and extensive research in databases and literature we showed that the mutations in PKD1L1 we found in both families cause the laterality and congenital heart defects in the patients," said Vetrini. "Our novel analytical approach to validate the pathogenicity of one of the mutations looked at the genetic change not only in terms of gene-specific evolutionary conservation but also at the effect of the change in the same domain present in functionally and evolutionarily unrelated proteins," said Vetrini. "I am most excited that our work has provided an answer to the affected families and also the possibility of having an action plan for the future," said co-author Alicia Braxton, certified genetic counselor at Baylor Genetics. "Now that we do have a diagnosis, the family may be able to avoid having an affected child in the future by doing tests such as pre-implantation genetic diagnosis (PGD) or prenatal diagnosis. PGD is a test done in the laboratory where specialists determine before implantation whether an embryo carries the gene variant that we now know causes the disease in their family. Implanting embryos that do not have the disease-causing variant would allow the family to have a child that is not affected by laterality defects or heart problems caused by variants in this gene." "This is a remarkable story of how genomic studies in unique families, and even single patients, can catalyze gene discovery efforts and in the process help many other families and doctors struggling with a medical mystery," said Lupski. "This work has been the result of strong collaborations among physicians, geneticists, genetic counselors, patients and their families," said Yang. "Thanks to our research we now know that this gene is associated with this disorder. We can now use this information to counsel other families that might be affected by these gene." Other contributors to this work include Lisa C.A. D'Alessandro, Zeynep C. Akdemir, Mahshid S. Azamian, Mohammad K. Eldomery, Kathryn Miller, Chelsea Kois, Virginia Sack, Natasha Shur, Asha Rijhsinghani, Jignesh Chandarana, Yan Ding, Judy Holtzman, Shalini N. Jhangiani, Donna M. Muzny, Richard A. Gibbs, Christine M. Eng, Neil A. Hanchard, Tamar Harel and Jill A. Rosenfeld. The authors are affiliated with one or more of the following institutions: Baylor Genetics, Texas Children's Hospital, Baylor College of Medicine, Albany Medical Center and Kaiser Permanente Medical Group. The study was supported in part by the US National Human Genome Research Institute (NHGRI)/National Heart Lung and Blood Institute (NHLBI) grant no. U54HG006542 to the Baylor-Hopkins Center for Mendelian Genomics, and the NIH/NIGMS T32 GM07526 Medical Genetics Research Fellowship Program.


News Article | February 15, 2017
Site: www.prweb.com

NDA Partners Chairman Carl Peck, MD, announced today that Deborah Wenkert, MD a former Clinical Research Medical Director at Amgen and pediatrics, rheumatology, and bone disease expert has joined the company as an Expert Consultant. Following an immunology postdoc at Harvard University, Dr. Wenkert was an instructor at Washington University School of Medicine and then, for eleven years, an Adjunct Assistant/Associate Clinical Professor at St Louis University School of Medicine in the division of rheumatology. Concurrent with her position at St. Louis University, Dr. Wenkert conducted research in adult and pediatric metabolic bone and genetic disorders and provided care to affected children as the Associate Director of the Center for Metabolic Bone Disease and Molecular Research at Shriners Hospital for Children, St Louis. “Dr. Deborah Wenkert’s knowledge and expertise in adult and pediatric metabolic bone and genetic disorders, in addition to, her extensive experience in pediatric rheumatology and pediatric clinical trials will provide an excellent resource to our clients and to our growing Pediatric Practice,” said Dr. Peck. “We are very pleased to welcome her to NDA Partners.” Dr. Wenkert earned her MD from the University of Texas Medical Branch (Galveston, Texas), attended graduate school at Baylor College of Medicine Graduate School, and obtained a BA in Biochemistry from Rice University. She is board certified in pediatrics and pediatric rheumatology, a member of the American Society for Bone and Mineral Research, and a Fellow of the American Academy of Pediatrics and American College of Rheumatology. About NDA Partners NDA Partners is a strategy consulting firm specializing in expert product development and regulatory advice to the medical products industry and associated service industries such as law firms, investment funds and government research agencies. The highly experienced Principals and Premier Experts of NDA Partners include three former FDA Center Directors; the former Chairman of the Medicines and Healthcare Products Regulatory Agency (MHRA) in the UK; an international team of more than 100 former pharmaceutical industry and regulatory agency senior executives; and an extensive roster of highly proficient experts in specialized areas including nonclinical development, toxicology, pharmacokinetics, CMC, medical device design control and quality systems, clinical development, regulatory submissions, and development program management. Services include product development and regulatory strategy, expert consulting, high-impact project teams, and virtual product development teams.


News Article | December 26, 2016
Site: www.eurekalert.org

HOUSTON - (Dec. 26, 2016) - Scientists have discovered that networks of inhibitory brain cells or neurons develop through a mechanism opposite to the one followed by excitatory networks. Excitatory neurons sculpt and refine maps of the external world throughout development and experience, while inhibitory neurons form maps that become broader with maturation. This discovery adds a new piece to the puzzle of how the brain organizes and processes information. Knowing how the normal brain works is an important step toward understanding the nature of neurological conditions and opens the possibility of finding treatments in the future. The results appear in Nature Neuroscience. "The brain represents the external world as specific maps of activity created by networks of neurons," said senior author Dr. Benjamin Arenkiel, associate professor of molecular and human genetics and of neuroscience at Baylor College of Medicine, who studies neural maps in the olfactory system of the laboratory mouse. "Most of these maps have been studied in the excitatory circuits of the brain because excitatory neurons in the cortex outnumber inhibitory neurons." The studies of excitatory maps have revealed that they begin as a diffuse and overlapping network of cells. "With time," said Arenkiel, "experience sculpts this diffuse pattern of activity into better defined areas, such that individual mouse whiskers, for instance, are represented by discrete segments of the brain cortex. This progression from a diffuse to a refined pattern occurs in many areas of the brain." In addition to excitatory networks, the brain has inhibitory networks that also respond to external stimuli and regulate the activity of neural networks. How the inhibitory networks develop, however, has remained a mystery. In this study, Arenkiel and colleagues studied the development of maps of inhibitory neurons in the olfactory system of the mouse. Studying inhibitory brain networks of the mouse sense of smell "Unlike sight, hearing or other senses, the sense of smell in the mouse detects discrete scents from a large array of molecules," said Arenkiel, who is also a McNair Scholar at Baylor. Mice can detect a vast number of scents thanks in part to a complex network of inhibitory neurons. Inhibitory neurons are the most abundant type of cells in the mouse brain area dedicated to process scent. To support this network, newly born inhibitory neurons are continually added and integrated into the circuits. Arenkiel and colleagues followed the paths of these newly added neurons in time to determine how inhibitory circuits develop. First, they genetically labeled the cells so they would glow when the neurons were active. Then, they offered individual scents to the mice and visually recorded through a microscope the areas or networks of the brain that glowed for each scent the live, anesthetized animal smelled. The scientists repeated the experiment several times to determine how the networks changed as the animal learned to identify each scent. The scientists expected that inhibitory networks would mature in a way similar to that of excitatory networks. That is, the more the animal experienced a scent, the better defined the networks of activity would become. Surprisingly, the scientists discovered that the inhibitory brain circuits of the mouse sense of smell develop in a manner opposite to the excitatory circuits. Instead of becoming narrowly defined areas, the inhibitory circuits become broader. Thanks to this new finding scientists now better understand how the brain organizes and processes information. Arenkiel and colleagues think that the inhibitory networks work hand-in-hand with the excitatory networks. They propose that the interaction between excitatory and inhibitory networks could be compared to a network of roads (excitatory networks) whose traffic is regulated by a network of traffic lights (inhibitory networks). The scientists suggest that the formation of useful neural maps depends on inhibitory networks driving the refinement of excitatory networks, and that this new information will be essential towards developing new approaches for repairing brain tissue. Other contributors to this work include Kathleen B Quast, Kevin Ung, Emmanouil Froudarakis, Longwen Huang, Isabella Herman, Angela P Addison, Joshua Ortiz-Guzmán, Keith Cordiner, Peter Saggau and Andreas S Tolias. The authors are affiliated with one or more of the following institutions: Baylor College of Medicine, University of St. Thomas, Allen Institute of Brain Science, Rice University and Texas Children's Hospital. Financial support was provided by the McNair Medical Institute, the Charif Souki Fund, IRACDA Fellowship K12GM084897, NRSA F31NS089178, NINDS grant F31NS081805, NINDS R01NS078294, U54HD083092 to the BCM IDDRC and the Intelligence Advanced Research Projects Activity (IARPA) via Department of Interior/Interior Business Center (DoI/IBC) contract number D16PC00003.


News Article | December 5, 2016
Site: www.eurekalert.org

SAN ANTONIO -- The American Association for Cancer Research (AACR) will honor two renowned researchers for their work in breast cancer at the 2016 San Antonio Breast Cancer Symposium, held Dec. 6-10. Fergus J. Couch, PhD, of the Mayo Clinic in Rochester, Minnesota, will receive the ninth annual AACR Outstanding Investigator Award for Breast Cancer Research, funded by Susan G. Komen, and Max S. Wicha, MD, of the University of Michigan Comprehensive Cancer Center in Ann Arbor, will receive the ninth annual AACR Distinguished Lectureship in Breast Cancer Research. The AACR Outstanding Investigator Award for Breast Cancer Research recognizes an investigator of no more than 50 years of age whose novel and significant work has had or may have a far-reaching impact on the etiology, detection, diagnosis, treatment, or prevention of breast cancer. Such work may involve any discipline across the continuum of biomedical research, including basic, translational, clinical, and epidemiological studies. Couch, who is the Zbigniew and Anna M. Scheller professor of medical research, and chair of the Division of Experimental Pathology and Laboratory Medicine in the Department of Laboratory Medicine and Pathology at the Mayo Clinic, is being honored for his seminal work in identifying the inherited genes and mutations that predispose to breast cancer. Much of his research has focused on determining the clinical relevance of inherited variants of uncertain significance (VUS) in breast cancer predisposition genes using genetic epidemiology and molecular biology approaches. Couch will present his Outstanding Investigator Award for Breast Cancer Research lecture, "Decoding Breast Cancer Predisposition Genes," Friday, Dec. 9, at 11:30 a.m. CT, in Hall 3 of the Henry B. Gonzalez Convention Center. A distinguished national leader in cancer genetics, Couch is a founder and member of the Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) consortium, and a leader in the BRCA Challenge and the Prospective Registry of Multiplex Testing (PROMPT) initiatives aimed at understanding alterations in cancer predisposition genes. He is also a co-founder of the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), a Triple Negative Breast Cancer Consortium (TNBCC), and is a long-term member of the Breast Cancer Association Consortium. Working with members of these consortia, Couch has led genome-wide association studies to identify common genetic variants that influence risk of estrogen receptor (ER) negative and triple negative breast cancer and modify risks of breast cancer among carriers of germline BRCA1 and BRCA2 mutations. In more recent research, Couch has been working to estimate risks of breast cancer associated with pathogenic variants identified by clinical genetic testing using multigene panels, and is leading an effort to identify genetic factors that account for the missing heritability of breast cancer. The AACR Distinguished Lectureship in Breast Cancer Research was established to recognize outstanding science that has inspired or has the potential to inspire new perspectives on the etiology, diagnosis, treatment, or prevention of breast cancer. Wicha, director emeritus of the University of Michigan Comprehensive Cancer Center, is being recognized for his leadership in breast cancer research and as a pioneer in the field of cancer stem cells (CSCs). Wicha is among the most highly cited investigators in the field. His group was part of the team that first identified CSCs in human breast cancers, the first in any solid tumor. His laboratory has developed many of the techniques and assays used to study these cells and to elucidate the pathways which regulate their behavior. These pathways have provided targets for the development of drugs aimed at targeting CSCs. He will present his Distinguished Lectureship in Breast Cancer Research award lecture, "Targeting Breast Cancer Stem Cells: Challenges and Opportunities," Thursday, Dec. 8, at 11:30 a.m. CT, in Hall 3 of the Henry B. Gonzalez Convention Center. Wicha is co-founder of OncoMed Pharmaceuticals, a company focused on developing CSC therapeutics, which has produced five agents currently in clinical testing. After training at the National Cancer Institute in clinical oncology and cancer biology, Wicha joined the faculty of the University of Michigan in 1980, where he served as chief in the Division of Hematology/Oncology in the Department of Internal Medicine. He served as director of the University of Michigan Comprehensive Cancer Center since its inception in 1986 until 2015, when he became director emeritus. He remains an active clinician, specializing in the treatment of patients with breast cancer. The mission of the 2016 San Antonio Breast Cancer Symposium is to produce a unique and comprehensive scientific meeting that encompasses the full spectrum of breast cancer research, facilitating the rapid translation of new knowledge into better care for patients with breast cancer. The Cancer Therapy & Research Center (CTRC) at The University of Texas Health Science Center at San Antonio, the American Association for Cancer Research (AACR), and Baylor College of Medicine are joint sponsors of the San Antonio Breast Cancer Symposium. This collaboration utilizes the clinical strengths of the CTRC and Baylor and the AACR's scientific prestige in basic, translational, and clinical cancer research to expedite the delivery of the latest scientific advances to the clinic. For more information about the symposium, please visit http://www. .


NEW YORK, Nov. 11, 2016 (GLOBE NEWSWIRE) -- Intercept Pharmaceuticals, Inc. (Nasdaq:ICPT) (Intercept), a biopharmaceutical company focused on the development and commercialization of novel therapeutics to treat progressive non-viral liver diseases, today announced results from three new exploratory analyses of the Phase 3 POISE trial of Ocaliva® (obeticholic acid) in patients with primary biliary cholangitis (PBC). The analyses will be presented at the American Academy for the Study of Liver Diseases (AASLD) Annual Meeting (The Liver Meeting®), taking place in Boston, MA from November 11-15.  The POISE trial evaluated the safety and efficacy of once-daily treatment with Ocaliva in PBC patients with an inadequate therapeutic response to, or who are unable to tolerate, ursodeoxycholic acid (UDCA). Of 216 patients randomized to three treatment arms—placebo, Ocaliva 5 mg titrated to 10 mg or Ocaliva 10 mg—93% continued receiving UDCA. The first POISE presentation (abstract #209) evaluated the effects of Ocaliva on non-invasive assessments of liver fibrosis using both transient elastography (Fibroscan™) and the AST to Platelet Ratio (APRI). These tests have been shown to be effective in predicting clinical outcomes in PBC, and Ocaliva-treated patients experienced improvements in both compared with those receiving placebo. In patients with transient elastography assessments at baseline and month 12 (approximately 43% of the study population), only Ocaliva-treated patients experienced a reduction in liver stiffness below 16.9 kPa, a threshold associated with the presence of cirrhosis. Mean liver stiffness reduction was observed in the 10 mg Ocaliva group compared to placebo. In patients with a baseline APRI score above 0.54 (a threshold associated with increased risk of adverse clinical outcomes in PBC patients), 35% of Ocaliva-treated patients compared to 13% of placebo-treated patients experienced an improvement to below 0.54 at the end of the 12 month double-blind phase. “Because liver biopsies are not routinely used for staging patients with PBC, it is important that we explore non-invasive strategies to evaluate the effects of new therapies like Ocaliva on liver fibrosis,” said Gideon Hirschfield, M.D., Professor and Honorary Consultant Hepatologist, Centre for Liver Research at the University of Birmingham, UK, who presented the data. “These results are very promising, and the ongoing Phase 4 COBALT trial of Ocaliva will provide us with a more definitive understanding of the drug’s ability to improve non-invasive measures of liver fibrosis and reduce the risk of clinical outcomes in our patients with PBC.” The second POISE presentation (abstract #366) evaluated the efficacy and safety of Ocaliva in the subset (17%) of patients with cirrhosis who were at the greatest risk of progression to liver-related adverse outcomes or death. At month 12, more Ocaliva-treated patients with cirrhosis achieved the primary composite study endpoint compared to placebo. Ocaliva treatment improved markers of both cholestasis (alkaline phosphatase) and hepatic impairment (bilirubin) relative to placebo in patients with cirrhosis. Consistent with previous study results, pruritus (itch) was the most common adverse event associated with Ocaliva treatment. Additional side effects observed during the trial included fatigue, abdominal pain and discomfort, rash, oropharyngeal pain, dizziness, constipation, arthralgia, thyroid function abnormality, and eczema. “This exploratory analysis suggests that high-risk PBC patients with compensated cirrhosis benefited from treatment with Ocaliva, and the results were comparable to what we observed in earlier stage non-cirrhotic patients,” said John Vierling, M.D., F.A.C.P., F.A.A.S.L.D., Professor of Medicine and Surgery at Baylor College of Medicine, Past President of AASLD, and lead author of the abstract. “The bilirubin improvements in these patients are particularly meaningful because increasing bilirubin levels – even within the normal range – are one of the hallmarks of progressive disease and strongly associated with clinical outcomes.” The third POISE presentation (abstract #401) examined the effects of Ocaliva in PBC patients with mild and moderate renal impairment. In this exploratory analysis, Ocaliva demonstrated comparable efficacy regardless of renal status and enabled patients with renal impairment to achieve significant improvements in markers of cholestasis and hepatic damage. Ocaliva had no apparent effect on renal safety, with mild to moderate pruritus the most commonly occurring adverse event in all renal function groups. About Primary Biliary Cholangitis Primary biliary cholangitis (PBC) is a rare, autoimmune cholestatic liver disease that puts patients at risk for life-threatening complications. PBC is primarily a disease of women, afflicting approximately one in 1,000 women over the age of 40. If left untreated, survival of PBC patients is significantly worse than the general population. About Ocaliva® (obeticholic acid) Ocaliva (obeticholic acid) is a potent and highly selective agonist of the farnesoid X receptor (FXR), a nuclear receptor expressed in the liver and intestine. FXR is a key regulator of bile acid, inflammatory, fibrotic and metabolic pathways. In May 2016, the U.S. Food and Drug Administration (FDA) granted accelerated approval to obeticholic acid for the treatment of PBC under the brand name Ocaliva based on a reduction in ALP. An improvement in survival or disease-related symptoms has not been established. Continued approval for this indication may be contingent upon verification and description of clinical benefit in confirmatory trials. In October 2016, the Committee for Medicinal Products for Human Use (CHMP) of the European Medicines Agency (EMA) adopted a positive opinion recommending the conditional marketing authorization of Ocaliva in PBC. Based on the CHMP’s positive recommendation, the final decision of the European Commission on the conditional marketing authorization of Ocaliva in PBC is expected by the end of 2016. The brand name Ocaliva has been provisionally approved by the EMA. U.S. IMPORTANT SAFETY INFORMATION Contraindications Ocaliva is contraindicated in patients with complete biliary obstruction. Warnings and Precautions Liver-Related Adverse Reactions In two 3-month, placebo-controlled clinical trials, a dose-response relationship was observed for the occurrence of liver-related adverse reactions including jaundice, ascites and primary biliary cholangitis flare with dosages of Ocaliva of 10 mg once daily to 50 mg once daily (up to 5-times the highest recommended dosage), as early as one month after starting treatment with Ocaliva. In a pooled analysis of three placebo-controlled trials in patients with PBC, the exposure-adjusted incidence rates for all serious and otherwise clinically significant liver-related adverse reactions, and isolated elevations in liver biochemical tests, per 100 patient exposure years (PEY) were: 5.2 in the Ocaliva 10 mg group (highest recommended dosage), 19.8 in the Ocaliva 25 mg group (2.5 times the highest recommended dosage) and 54.5 in the Ocaliva 50 mg group (5 times the highest recommended dosage) compared to 2.4 in the placebo group. Monitor patients during treatment with Ocaliva for elevations in liver biochemical tests and for the development of liver-related adverse reactions. Weigh the potential risks against the benefits of continuing treatment with Ocaliva in patients who have experienced clinically significant liver-related adverse reactions. The maximum recommended dosage of Ocaliva is 10 mg once daily. Adjust the dosage for patients with moderate or severe hepatic impairment. Severe Pruritus Severe pruritus was reported in 23% of patients in the Ocaliva 10 mg arm, 19% of patients in the Ocaliva titration arm and 7% of patients in the placebo arm in the POISE trial, a 12-month double-blind randomized controlled trial of 216 patients. Severe pruritus was defined as intense or widespread itching, interfering with activities of daily living, or causing severe sleep disturbance, or intolerable discomfort, and typically requiring medical interventions. In the subgroup of patients in the Ocaliva titration arm who increased their dosage from 5 mg once daily to 10 mg once daily after 6 months of treatment (n=33), the incidence of severe pruritus was 0% from months 0 to 6 and 15% from months 6 to 12. The median time to onset of severe pruritus was 11, 158 and 75 days for patients in the Ocaliva 10 mg, Ocaliva titration and placebo arms, respectively. Management strategies include the addition of bile acid resins or antihistamines, Ocaliva dosage reduction and/or temporary interruption of Ocaliva dosing. Reduction in HDL-C Patients with PBC generally exhibit hyperlipidemia characterized by a significant elevation in total cholesterol primarily due to increased levels of high density lipoprotein-cholesterol (HDL‑C). In the POISE trial, dose-dependent reductions from baseline in mean HDL-C levels were observed at 2 weeks in Ocaliva-treated patients, 20% and 9% in the 10 mg and titration arms, respectively, compared to 2% in the placebo arm. At month 12, the reduction from baseline in mean HDL-C level was 19% in the Ocaliva 10 mg arm, 12% in the Ocaliva titration arm and 2% in the placebo arm. Nine patients in the Ocaliva 10 mg arm and six patients in the Ocaliva titration arm, versus three patients in the placebo arm, had reductions in HDL-C to less than 40 mg/dL. Monitor patients for changes in serum lipid levels during treatment. For patients who do not respond to Ocaliva after one year at the highest recommended dosage that can be tolerated (maximum of 10 mg once daily), and who experience a reduction in HDL-C, weigh the potential risks against the benefits of continuing treatment. Adverse Reactions The most common adverse reactions from subjects taking Ocaliva (≥5%) were pruritus, fatigue, abdominal pain and discomfort, rash, oropharyngeal pain, dizziness, constipation, arthralgia, thyroid function abnormality and eczema. Drug Interaction Bile Acid Binding Resins Bile acid binding resins such as cholestyramine, colestipol or colesevelam absorb and reduce bile acid absorption and may reduce the absorption, systemic exposure and efficacy of Ocaliva. If taking bile acid binding resins, take Ocaliva at least 4 hours before or 4 hours after (or at as great an interval as possible) taking a bile acid binding resin. To report SUSPECTED ADVERSE REACTIONS, contact Intercept Pharmaceuticals, Inc. at 1-844-782-ICPT or FDA at 1-800-FDA-1088 or www.fda.gov/medwatch. About the POISE Trial The POISE trial studied the safety and efficacy of once-daily treatment with Ocaliva in PBC patients with an inadequate therapeutic response to, or who are unable to tolerate, UDCA, the current standard of care. Of 216 patients randomized to three treatment arms—placebo, Ocaliva 5 mg titrated to 10 mg or Ocaliva 10 mg—93% continued receiving UDCA. The Ocaliva 5-10 mg titration group received Ocaliva 5 mg for six months, after which dosing was increased to 10 mg based on tolerability and biochemical response. The trial's primary endpoint was a reduction in ALP to below a threshold of 1.67 times the upper limit of normal, with a minimum of 15% reduction in ALP level from baseline, and a normal bilirubin level after 12 months of therapy. About Intercept Intercept is a biopharmaceutical company focused on the development and commercialization of novel therapeutics to treat progressive non-viral liver diseases, including primary biliary cholangitis (PBC), nonalcoholic steatohepatitis (NASH), primary sclerosing cholangitis (PSC) and biliary atresia. Founded in 2002 in New York, Intercept now has operations in the United States, Europe and Canada. For more information about Intercept, please visit www.interceptpharma.com. Safe Harbor Statements This press release contains "forward-looking statements" within the meaning of the Private Securities Litigation Reform Act of 1995, including, but not limited to, statements regarding the clinical relevance and utility of ALP and the surrogate endpoint used in the Phase 3 POISE trial to predict clinical outcomes, the acceptance of Ocaliva® (obeticholic acid) as a treatment for PBC by healthcare providers, patients and payors, the potential approval of OCA in PBC by the European Commission and other regulatory bodies and the timelines related thereto, the availability of OCA for the treatment of PBC in Europe and other jurisdictions outside the United States and timelines related thereto, the anticipated prevalence of and other epidemiological estimates and market data related to PBC, the continued development of OCA and Intercept's other product candidates, and our strategic directives under the caption "About Intercept." These "forward-looking statements" are based on management's current expectations of future events and are subject to a number of important risks and uncertainties that could cause actual results to differ materially and adversely from those set forth in or implied by such forward-looking statements. These risks and uncertainties include, but are not limited to: Intercept's ability to successfully commercialize Ocaliva in PBC, and Intercept's ability to maintain its regulatory approval of Ocaliva in the United States for Ocaliva in PBC; the initiation, cost, timing, progress and results of Intercept's development activities, preclinical studies and clinical trials, including Intercept’s development program in NASH; the timing of and Intercept's ability to obtain and maintain regulatory approval of OCA in PBC in countries outside the United States and in indications other than PBC and any other product candidates it may develop such as INT-767; conditions that may be imposed by regulatory authorities on Intercept's marketing approvals for its product candidates such as the need for clinical outcomes data (and not just results based on achievement of a surrogate endpoint), and any related restrictions, limitations, and/or warnings in the label of any approved product candidates; Intercept's plans to research, develop and commercialize its product candidates; Intercept's ability to obtain and maintain intellectual property protection for its product candidates; Intercept's ability to successfully commercialize OCA in indications other than PBC and its other product candidates; the size and growth of the markets for Intercept's product candidates and its ability to serve those markets; the rate and degree of market acceptance of any of Intercept's products, which may be affected by the reimbursement that it may receive for its products from payors; the success of competing drugs that are or become available; the election by Intercept's collaborators to pursue research, development and commercialization activities; Intercept's ability to attract collaborators with development, regulatory and commercialization expertise; regulatory developments in the United States and other countries; the performance of third-party suppliers and manufacturers; Intercept's need for and ability to obtain additional financing; Intercept's estimates regarding expenses, future revenues and capital requirements and the accuracy thereof; Intercept's use of cash, short-term investments and the proceeds from the offering; Intercept's ability to attract and retain key scientific or management personnel; and other factors discussed under the heading "Risk Factors" contained in our annual report on Form 10-K for the year ended December 31, 2015 filed on February 29, 2016 as well as any updates to these risk factors filed from time to time in our other filings with the Securities and Exchange Commission. All information in this press release is as of the date of the release, and Intercept undertakes no duty to update this information unless required by law.


News Article | November 23, 2016
Site: www.24-7pressrelease.com

SANTA FE, NM, November 23, 2016-- Diana MacArthur has been included in Marquis Who's Who. As in all Marquis Who's Who biographical volumes, individuals profiled are selected on the basis of current reference value. Factors such as position, noteworthy accomplishments, visibility, and prominence in a field are all taken into account during the selection process.Mrs. MacArthur's professional and volunteer lives have, over the years, taken parallel paths, each reinforcing the other. She was Co-founder, Chair, and CEO of Dynamac International Inc.; CEO, Research Analysis and Management Corp.; President, Consumer Dynamics, Inc.; Program Manager, Space Division, General Electric; Vice President, Thomas J. Deegan Co. (a public relations firm in the InterPublic group); and Director, Office of Private and International Organizations, the Peace Corps. She has served as a consultant to Westinghouse, Eastman Kodak, Lever Brothers, the Hearst Corporation, the National Youth Conference on Natural Beauty and Conservation, and the National Recreation and Park Association.Complementing her professional accomplishments, Mrs. MacArthur was a member of or served on the boards of various organizations in the realms of public policy, science, education, and business. These include the following: President's Committee of Advisors on Science and Technology; Citizen's Advisory Board, President's Council on Youth Opportunity; Center for Strategic and International Studies; University of Maryland Biotechnology Institute; Smithsonian Environmental Research Center; Chancellor's Advisory Council, University System of Maryland; Tech Council of Maryland; Council on Competitiveness; Business-Higher Education Forum; Atlantic Council; Santa Fe Institute; Los Alamos National Laboratory Foundation; Science and Technology Corp., University of New Mexico; Lady Bird Johnson Wildflower Center; Menninger-Baylor College of Medicine-The Methodist Hospital Foundation; Business Advisory Committee, Center for China-U.S. Cooperation, University of Denver Graduate School of International Studies.Now retired and drawing on her wealth of experience, Mrs. MacArthur has embarked on a project in one of the most beautiful and daunting regions of the world, the Karakoram Mountains of Pakistan. On a visit to the village of MurtazaAbad, she was asked for help in constructing a building for the local school, and she agreed because her daughter had taught there. Mrs. MacArthur is now undertaking a remarkable effort to build a Center for Educational Excellence along the newly developed China-Pakistan Economic Corridor, bringing modernity to a small but economically and strategically important area of the world.She serves as the principal donor and volunteer project director of the Center, working with the local community and its representative, the Al-Murtaza Educational and Social Welfare Organization. The Center's co-ed primary/secondary schools, now under construction, will be housed in a state-of-the art, earthquake-resistant, high-tech school building, and will provide low-cost education, without discrimination based on religion, gender, ethnicity, or social status. Because a school is more than a building, the outstanding educational precepts of the Aga Khan Educational Network are being followed, and emphasis is being placed on teacher training, curriculum development, parental involvement, and efficient management and administration. Working closely with local families, Mrs. MacArthur has successfully encouraged the bringing together of the Ismaili, Shia, and Sunni Muslim communities, with the goal of providing an outstanding education to the children of the region and creating a vital civil society. Mrs. MacArthur's contributions, in time, expertise, and funding, demonstrate just how much she cares about the world and its citizens, especially children.Mrs. MacArthur has been recognized through features in Who's Who in Finance and Business, Who's Who in Science and Engineering, Who's Who of American Women, Who's Who in the East, Who's Who in the West, Who's Who in America, and Who's Who in the World.About Marquis Who's Who :Since 1899, when A. N. Marquis printed the First Edition of Who's Who in America , Marquis Who's Who has chronicled the lives of the most accomplished individuals and innovators from every significant field of endeavor, including politics, business, medicine, law, education, art, religion and entertainment. Today, Who's Who in America remains an essential biographical source for thousands of researchers, journalists, librarians and executive search firms around the world. Marquis now publishes many Who's Who titles, including Who's Who in America , Who's Who in the World , Who's Who in American Law , Who's Who in Medicine and Healthcare , Who's Who in Science and Engineering , and Who's Who in Asia . Marquis publications may be visited at the official Marquis Who's Who website at www.marquiswhoswho.com


SAN ANTONIO--(BUSINESS WIRE)--Harland Clarke Holdings (HCH) is excited to announce today its donation of $250,000 to The Children’s Hospital of San Antonio Foundation in support of pediatric emergency care. This gift demonstrates HCH’s commitment to the San Antonio community and the Foundation’s Putting Children First four-year campaign initiated to provide funding for capital, endowment and program support for the hospital. “Harland Clarke Holdings has a long-standing commitment to driving efforts that support and strengthen our communities,” said Victor Nichols, chief executive officer, Harland Clarke Holdings. “We are honored to advance children’s health by supporting a facility that is 100 percent dedicated to providing comprehensive pediatric services.” Harland Clarke Holdings’ gift was used for construction of the emergency department’s pod D and will be recognized on this unit. The emergency department’s pod D includes eight exam rooms, two of which will be used as OB triage/treatment rooms, two forensic exam/treatment rooms for the care of neglected and abused children and a trauma treatment room. The emergency department at The Children’s Hospital of San Antonio is the largest dedicated emergency department in San Antonio with 31,000 square feet and 84,000 patient visits per year. “We are extremely grateful to Harland Clarke Holdings for their generous donation to The Children’s Hospital of San Antonio, which will have an incredible impact on the level of care we are able to provide the San Antonio community,” said John Bel, president, The Children’s Hospital of San Antonio Foundation. “This gift helps continue the momentum of the Putting Children First campaign and allows us to focus on providing exemplary pediatric care, outstanding research, medical education and advocacy for children.” Harland Clarke Holdings is comprised of companies focused on optimizing client relationships through multiple channels by enabling them to acquire, retain and grow their customer base. Its major business units, Harland Clarke, Scantron and Valassis are recognized as leading providers of marketing services, transaction solutions, education services and intelligent media delivery that create millions of customer touch points annually for their clients. Harland Clarke Holdings is a wholly owned company of MacAndrews and Forbes Incorporated. About The Children’s Hospital of San Antonio The Children’s Hospital of San Antonio is the first freestanding hospital in San Antonio solely dedicated to the care of children. Located in the heart of downtown San Antonio, The Children’s Hospital of San Antonio is owned by CHRISTUS Santa Rosa Health System. Baylor College of Medicine, one of the top medical schools in the nation, is the academic partner of The Children’s Hospital with 170 pediatric subspecialists affiliated with Baylor. In addition, community physicians in private practice remain a valuable partner in the care of children in our community. Founded in 1869 by the Sisters of Charity of the Incarnate Word of Houston and San Antonio, CHRISTUS Santa Rosa is a Catholic, faith-based, nonprofit health and wellness ministry dedicated to extending the healing ministry of Jesus Christ and providing the highest quality medical care and services available. Besides The Children’s Hospital, CHRISTUS Santa Rosa has four adult hospitals that are located in the South Texas Medical Center, New Braunfels, Westover Hills, and Alamo Heights. For additional information on The Children’s Hospital of San Antonio, visit www.chofsa.org or for more information on CHRISTUS Santa Rosa, visit www.christussantarosa.org. Find us on Facebook at www.facebook.com/ChildrensHospSA and follow us on Twitter at www.twitter.com/ChildrensHospSA.


News Article | November 14, 2016
Site: globenewswire.com

BELGRADE, Mont., Nov. 14, 2016 (GLOBE NEWSWIRE) -- Xtant Medical Holdings, Inc. (NYSE MKT:XTNT), a leader in the development of regenerative medicine products and medical devices, today announced the first surgical cases of the Xspan Laminoplasty Fixation System. The first two cases were performed by Dr. Francisco Vaz-Guimaraes at the Michael E. DeBakey VA Medical Center in Houston. The open door laminoplasty procedure was performed to treat spinal stenosis without fusing the vertebrae. "The Xspan system is easy to put in, final construct was rock solid. Both patients were discharged shortly after the procedure," stated Dr. Vaz-Guimaraes. Dr. Vaz-Guimaraes is a Neurosurgeon and faculty member at Baylor College of Medicine, and contracted with the Michael E. DeBakey VA Medical Center in Houston. Dr. Fuentes and Dr. Ehni, both of the VA Medical Center in Houston, advised from concept to final implant, ensuring Xspan was designed utilizing the expertise of surgeons who routinely perform laminoplasty procedures with the expertise of Xtant Medical engineers. "The Xspan Laminoplasty System has been designed to make the open door laminoplasty technique safer, more adaptable to spondylotic variations in the dorsal element anatomy, and simpler to perform," said Dr. Ehni. Dr. David Kirschman, developer of Xspan and member of the Xtant Medical Board of Directors, states, "The Xspan system is a comprehensive set of implants and instruments to perform the cervical laminoplasty procedure. This procedure allows for direct decompression of the cervical spine, with minimum disruption to patient anatomy. This system is emblematic of Xtant's vision to maximize outcomes while minimizing patient impact." The Xspan System represents the latest generation of laminoplasty fixation. Spinal laminoplasty is a surgical procedure performed to remove pressure from the spinal cord. Unlike a laminectomy, where the entire lamina is removed and often is performed in conjunction with spinal fusion, laminoplasty involves only an opening or window made on one side of the lamina to alleviate the compression of the spinal cord. The lamina is then restructured by a small plate which allows for an expansion of the spinal canal without losing stability or movement in the vertebrae. This procedure can be completed at single or multiple levels. Xtant Medical estimates the worldwide market for laminoplasty at $128M and growing. Xspan is currently available to a limited number of key surgeons with a larger general release to follow later in 2017. Xtant Medical develops, manufactures and markets regenerative medicine products and medical devices for domestic and international markets. Xtant Medical products serve the specialized needs of orthopedic and neurological surgeons, including orthobiologics for the promotion of bone healing, implants and instrumentation for the treatment of spinal disease, tissue grafts for the treatment of orthopedic disorders, and biologics to promote healing following cranial, and foot and ankle surgeries. With core competencies in both biologic and non-biologic surgical technologies, Xtant Medical can leverage its resources to successfully compete in global neurological and orthopedic surgery markets. For further information, please visit www.xtantmedical.com. This press release contains certain disclosures that may be deemed forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995 that are subject to significant risks and uncertainties. Forward-looking statements include statements that are predictive in nature, that depend upon or refer to future events or conditions, or that include words such as "continue," "efforts," "expects," "anticipates," "intends," "plans," "believes," "estimates," "projects," "forecasts," "strategy," "will," "goal," "target," "prospects," "potential," "optimistic," "confident," "likely," "probable" or similar expressions or the negative thereof. Statements of historical fact also may be deemed to be forward-looking statements. We caution that these statements by their nature involve risks and uncertainties, and actual results may differ materially depending on a variety of important factors, including, among others: our ability to integrate the acquisition of X-spine Systems, Inc. and any other business combinations or acquisitions successfully; our ability to remain listed on the NYSE MKT; our ability to obtain financing on reasonable terms; our ability to increase revenue; our ability to comply with the covenants in our credit facility; our ability to maintain sufficient liquidity to fund our operations; the ability of our sales force to achieve expected results; our ability to remain competitive; government regulations; our ability to innovate and develop new products; our ability to obtain donor cadavers for our products; our ability to engage and retain qualified technical personnel and members of our management team; the availability of our facilities; government and third-party coverage and reimbursement for our products; our ability to obtain regulatory approvals; our ability to successfully integrate recent and future business combinations or acquisitions; our ability to use our net operating loss carry-forwards to offset future taxable income; our ability to deduct all or a portion of the interest payments on the notes for U.S. federal income tax purposes; our ability to service our debt; product liability claims and other litigation to which we may be subjected; product recalls and defects; timing and results of clinical studies; our ability to obtain and protect our intellectual property and proprietary rights; infringement and ownership of intellectual property; our ability to remain accredited with the American Association of Tissue Banks; influence by our management; our ability to pay dividends; our ability to issue preferred stock; and other factors. Additional risk factors are listed in the Company's Annual Report on Form 10-K and Quarterly Reports on Form 10-Q under the heading "Risk Factors." You should carefully consider the trends, risks and uncertainties described in this document, the Form 10-K and other reports filed with or furnished to the SEC before making any investment decision with respect to our securities. If any of these trends, risks or uncertainties actually occurs or continues, our business, financial condition or operating results could be materially adversely affected, the trading prices of our securities could decline, and you could lose all or part of your investment. The Company undertakes no obligation to release publicly any revisions to any forward-looking statements to reflect events or circumstances after the date hereof or to reflect the occurrence of unanticipated events, except as required by law. All forward-looking statements attributable to us or persons acting on our behalf are expressly qualified in their entirety by this cautionary statement.


NEWARK, Calif.--(BUSINESS WIRE)--Revance Therapeutics, Inc. (NASDAQ:RVNC), a biotechnology company developing botulinum toxin products for use in aesthetic and therapeutic indications, today announced positive interim results from its U.S. Phase 2 open-label, dose-escalating clinical study of DaxibotulinumtoxinA Injectable (RT002) to treat moderate-to-severe isolated cervical dystonia in adults, a movement disorder of the neck. The trial enrolled 37 subjects and follows three sequential treatment cohorts for up to a total of 24 weeks after treatment for each cohort. The trial’s first cohort of 12 subjects received a single dose of up to 200 units of RT002 injectable, the second cohort of 12 subjects received between 200 and 300 units, and the third cohort received from 300 to 450 units. Later-enrolled subjects in the second and third cohorts have yet to complete the trial’s 24-week protocol. Today’s results are therefore preliminary, with final results expected in the first half of 2017. “Patients with cervical dystonia suffer from painful, embarrassing twisting movements of the neck, often impairing their ability to work, drive and perform activities of daily living,” said lead trial investigator Dr. Joseph Jankovic, Professor of Neurology, Distinguished Chair in Movement Disorders, Founder, The Parkinson's Disease Center and Movement Disorders Clinic (PDCMDC) Baylor College of Medicine, Houston, Texas. “The current treatment of cervical dystonia calls for injection of botulinum toxin about every 3 months, or 4 times per year, to provide patients with an improved quality of life. The preliminary data in the Phase 2 trial appears quite robust, showing marked improvements in symptoms and signs. I am particularly encouraged that in this trial RT002 exhibited a safety profile at least as good as currently marketed neurotoxins. Furthermore, with a sustained median duration of at least 24 weeks, there is a possibility that patients will require injections only two times a year. Although further studies are needed, RT002 may represent a major advance in neurotoxin technology, which should translate into more meaningful treatment outcomes in patients with cervical dystonia.” “Cervical dystonia is an ideal therapeutic indication for testing the attributes of RT002 injectable,” said Dan Browne, President and Chief Executive Officer at Revance. “We believe these results may have broad implications for the product profile of RT002, as we have now shown long duration in both low- and high-dose indications for small and large muscles. And we’ve also shown long duration of effect in two Phase 2 trials for the treatment of glablellar lines.” “Further, RT002 injectable, even at high doses, may deliver a strong safety profile possibly by limiting the spread of toxin, which could avoid life-altering adverse events such as general muscle weakness and difficulty swallowing,” Browne continued. “We plan to share the final safety, efficacy, and duration results in 2017 once all cohorts have completed the 24-week assessment period. We then intend to seek regulatory advice from US and EU health authorities to determine the next steps in this clinical program.” The abstract for this Phase 2 clinical trial of RT002 injectable to treat cervical dystonia was submitted to the Toxins 2017 (January 18-21, Madrid, Spain) meeting and has been accepted for presentation. Study investigator Cynthia L. Comella, MD, Professor in the Department of Neurological Sciences at Rush University Medical Center, Chicago, Illinois, is scheduled to present. Revance’s Phase 2 trial is an open-label, sequential, dose-escalating study to evaluate the safety, preliminary efficacy and duration of effect of a single treatment of DaxibotulinumtoxinA Injectable (RT002) for isolated cervical dystonia. Thirty-seven subjects with at least moderate cervical dystonia were enrolled at multiple sites in the United States. There are three treatment groups of 12, 12 and 13 subjects, respectively, each subject treated with one of three dose levels of RT002 injectable. The primary efficacy endpoint of the Phase 2 study is an improvement in dystonia symptoms as measured by change (reduction) from baseline in Toronto Western Spasmodic Torticollis Rating Scale (TWSTRS) total score at four weeks. TWSTRS is a composite scale that covers different features of the cervical dystonia condition. The first part of the scale is based on the physical findings and severity of dystonia, the second part rates the patient’s perceived level of disability, and the third part rates the pain. The study protocols also feature a number of secondary efficacy endpoints, including duration of effect and patient-rated quality of life as measured by change from baseline in Cervical Dystonia Impact Profile (CDIP). All subjects are followed out to nine weeks, after treatment. Subjects with sustained improvement after this initial period of nine weeks continue to be assessed for duration of efficacy and other measures until they return to baseline or for up to a total of 24 weeks after treatment. Revance management will host a conference call and webcast today at 4:30 pm ET. Individuals interested in listening to the conference call today, December 12, at 1:30 pm PT/4:30 pm ET may do so by dialing (855) 453-3827 for domestic callers, or (484) 756-4301 for international callers and reference conference ID: 37266728; or from the webcast link in the investor relations section of the Company's website at: www.revance.com. In addition, key data slides on the Phase 2 interim trial results will be discussed on the conference call and are posted to Revance’s website on the INVESTORS tab in the Presentations and Corporate Materials section. A replay of the call will be available beginning December 12, 2016 at 4:30 pm PT/7:30 pm ET through 7:30 pm ET on December 13, 2016. To access the replay, dial (855) 859-2056 or (404) 537-3406 and reference Conference ID: 37266728. The webcast will be available in the investor relations section on the Company's website for 30 days following the completion of the call. According to the Dystonia Medical Research Foundation, whose mission is to advance research, promote awareness and education, and support the needs affected individuals, cervical dystonia is a painful condition in which the neck muscles contract involuntarily, causing abnormal movements and awkward posture of the head and neck. The movements may be sustained (tonic), jerky (clonic), or a combination. Cervical dystonia (also referred to as spasmodic torticollis) may be primary (meaning that it is the only apparent neurological disorder, with or without a family history) or may be brought about by secondary causes (such as physical trauma). It can result in considerable pain and discomfort. Treatments for cervical dystonia include oral medications, botulinum toxin injections, surgery, and complementary therapies. Botulinum toxin can help block the communication between the nerve and the muscle and may alleviate abnormal movements and postures. Current botulinum toxin treatments for cervical dystonia have a duration of effect of approximately three months. Cervical dystonia can occur at any age, although most individuals first experience symptoms in middle age. It affects several hundred thousand adults and children in the United States alone. Revance estimates the global market for treating muscle movement disorders with botulinum toxins, including cervical dystonia, was nearly $1 billion in 2015. Revance, a Silicon Valley-based biotechnology company, is committed to the advancement of remarkable science. The company is developing a portfolio of products for aesthetic medicine and underserved therapeutic specialties, including dermatology, orthopedics and neurology. Revance’s science is based upon a proprietary TransMTS® peptide technology, which when combined with active drug molecules, may help address current unmet needs. Revance’s initial focus is on developing daxibotulinumtoxinA, the company’s highly purified botulinum toxin, for a broad spectrum of aesthetic and therapeutic indications, including facial wrinkles and muscle movement disorders. The company’s lead drug candidate, DaxibotulinumtoxinA for Injection (RT002), is currently in development for the treatment of glabellar lines, cervical dystonia and plantar fasciitis with the potential to be the first long-acting neurotoxin. The company holds worldwide rights for all indications of RT002 injectable and RT001 topical and the pharmaceutical uses of the TransMTS technology platform. More information on Revance may be found at www.revance.com. “Revance Therapeutics,” TransMTS®, “Remarkable Science Changes Everything,” and the Revance logo are registered trademarks of Revance Therapeutics, Inc. This press release contains forward-looking statements, including statements related to the process and timing of, and ability to complete, current and anticipated future clinical development of our investigational drug product candidates, including but not limited to initiation and design of clinical studies for current and future indications, related results and reporting of such results; statements about our business strategy, timeline and other goals and market for our anticipated products, plans and prospects; and statements about our ability to obtain regulatory approval; and potential benefits of our drug product candidates and our technologies. Forward-looking statements are subject to risks and uncertainties that could cause actual results to differ materially from our expectations. These risks and uncertainties include, but are not limited to: the outcome, cost, and timing of our product development activities and clinical trials; the uncertain clinical development process, including the risks that interim results are not indicative of final results and that clinical trials may not have an effective design or generate positive results; our ability to obtain and maintain regulatory approval of our drug product candidates; our ability to obtain funding for our operations; our plans to research, develop, and commercialize our drug product candidates; our ability to achieve market acceptance of our drug product candidates; unanticipated costs or delays in research, development, and commercialization efforts; the applicability of clinical study results to actual outcomes; the size and growth potential of the markets for our drug product candidates; our ability to successfully commercialize our drug product candidates and the timing of commercialization activities; the rate and degree of market acceptance of our drug product candidates; our ability to develop sales and marketing capabilities; the accuracy of our estimates regarding expenses, future revenues, capital requirements and needs for financing; our ability to continue obtaining and maintaining intellectual property protection for our drug product candidates; and other risks. Detailed information regarding factors that may cause actual results to differ materially from the results expressed or implied by statements in this press release may be found in Revance’s periodic filings with the Securities and Exchange Commission (the “SEC”), including factors described in the section entitled “Risk Factors” of our quarterly report on Form 10-Q filed November 4, 2016. These forward-looking statements speak only as of the date hereof. Revance disclaims any obligation to update these forward-looking statements.


News Article | August 22, 2016
Site: news.mit.edu

Researchers can build complex, nanometer-scale structures of almost any shape and form, using strands of DNA. But these particles must be designed by hand, in a complex and laborious process. This has limited the technique, known as DNA origami, to just a small group of experts in the field. Now a team of researchers at MIT and elsewhere has developed an algorithm that can build these DNA nanoparticles automatically. In this way the algorithm, which is reported together with a novel synthesis approach in the journal Science this week, could allow the technique to be used to develop nanoparticles for a much broader range of applications, including scaffolds for vaccines, carriers for gene editing tools, and in archival memory storage. Unlike traditional DNA origami, in which the structure is built up manually by hand, the algorithm starts with a simple, 3-D geometric representation of the final shape of the object, and then decides how it should be assembled from DNA, according to Mark Bathe, an associate professor of biological engineering at MIT, who led the research. “The paper turns the problem around from one in which an expert designs the DNA needed to synthesize the object, to one in which the object itself is the starting point, with the DNA sequences that are needed automatically defined by the algorithm,” Bathe says. “Our hope is that this automation significantly broadens participation of others in the use of this powerful molecular design paradigm.” The algorithm first represents the object as a perfectly smooth, continuous outline of its surface. It then breaks the surface up into a series of polygonal shapes. Next, it routes a long, single strand of DNA, called the scaffold, which acts like a piece of thread, throughout the entire structure to hold it together. The algorithm weaves the scaffold in one fast and efficient step, which can be used for any shape of 3-D object, Bathe says. “That [step] is a powerful part of the algorithm, because it does not require any manual or human interface, and it is guaranteed to work for any 3-D object very efficiently,” he says. The algorithm, which is known as DAEDALUS (DNA Origami Sequence Design Algorithm for User-defined Structures) after the Greek craftsman and artist who designed labyrinths that resemble origami’s complex scaffold structures, can build any type of 3-D shape, provided it has a closed surface. This can include shapes with one or more holes, such as a torus. In contrast, a previous algorithm, published last year in the journal Nature, is only capable of designing and building the surfaces of spherical objects, and even then still requires manual intervention. Most previous work on DNA origami has explored 2-D and 3-D structures whose design required some steps to be done by hand, says Paul Rothemund, a research professor at Caltech, who was not involved in the paper. “The current work provides a complete pipeline, starting from a 3-D form, and arriving at a DNA design and a corresponding predicted atomic model which can be compared quantitatively with experiments,” he says. The team's strategy in designing and synthesizing the DNA nanoparticles was also validated using 3-D cryo-electron microscopy reconstructions by Bathe's collaborator, Wah Chiu at Baylor College of Medicine. The researchers are now investigating a number of applications for the DNA nanoparticles built by the DAEDALUS algorithm. One such application is a scaffold for viral peptides and proteins for use as vaccines. The surface of the nanoparticles could be designed with any combination of peptides and proteins, located at any desired location on the structure, in order to mimic the way in which a virus appears to the body’s immune system. The researchers demonstrated that the DNA nanoparticles are stable for more than six hours in serum, and are now attempting to increase their stability further. The nanoparticles could also be used to encapsulate the CRISPR-Cas9 gene editing tool. The CRISPR-Cas9 tool has enormous potential in therapeutics, thanks to its ability to edit targeted genes. However, there is a significant need to develop techniques to package the tool and deliver it to specific cells within the body, Bathe says. This is currently done using viruses, but these are limited in the size of package they can carry, restricting their use. The DNA nanoparticles, in contrast, are capable of carrying much larger gene packages and can easily be equipped with molecules that help target the right cells or tissue. The team is also investigating the use of the nanoparticles as DNA memory blocks. Previous research has shown that information can be stored in DNA, in a similar way to the 0s and 1s used to store data digitally. The information to be stored is “written” using DNA synthesis and can then be read back using DNA sequencing technology. Using the DNA nanoparticles would allow this information to be stored in a structured and protected way, with each particle akin to a page or chapter of a book. Recalling a particular chapter or book would then be as simple as reading that nanoparticle’s identity, somewhat like using library index cards, Bathe says. The most exciting aspect of the work, however, is that it should significantly broaden participation in the application of this technology, Bathe says, much like 3-D printing has done for complex 3-D geometric models at the macroscopic scale. Bathe’s co-authors on the paper are Rémi Veneziano, a postdoc in the Department of Biological Engineering; Sakul Ratanalert, a graduate student in the departments of Biological Engineering and Chemical Engineering; and others from Baylor College of Medicine and Arizona State University.


Research and Markets has announced the addition of the "Neuroscience in Intensive Care International Symposium - NICIS - AMERICA - Industry/Commercial Rate" conference to their offering. This year's conference is devoted to the theme of Precision Medicine for Neurocritical Care and Stroke. Advances in genetics and in image-guided therapy are already leading to major changes in the classification, management and outcomes of patients with ischemic stroke. New management paradigms are being actively explored in the domains of acute neurological injury intracerebral haemorrhage, subarachnoid haemorrhage, anoxic-ischemic brain injury, traumatic brain injury. However, more effective predictive modelling and treatment strategies are desperately needed in these populations. THE ORGANIZERS Robert Stevens, MD, Ph.D., Associate Professor of Anesthesiology and Critical Care Medicine, Johns Hopkins University Jan Claassen, MD, Ph.D., Associate Professor of Neurology, Department of Neurology, Columbia University Jose Suarez, MD, Professor, Neurology-Vascular Critical Care, Baylor College of Medicine Tarek Sharshar, MD, Senior Consultant, Department of Intensive Care Medicine, Raymond Poincaré Hospital, Professor, The University of Versailles Agenda: The following is a preliminary agenda. Please check back in the coming weeks for additions to the agenda, for additional information regarding the presentations and the full two-day tiimeline of events. March 2nd, 2017 THE POTENTIAL FOR TRANSFORMATION KEYNOTE ADDRESS: The BRAIN Initiative Walter Koroshetz, MD, Director, National Institute of Neurological Disorders and Stroke (NINDS), NIH Towards a Molecular Taxonomy of Cancer Chetan Bettegowda, MD, Ph.D., Associate Professor of Neurosurgery, Johns Hopkins University Precision Medicine for Critical Care Tim Buchman, Ph.D., MD, Director, Emory Critical Care Center, Emory University BIG SCIENCE The Precision Medicine Initiative Joni Rutter, Ph.D., Division Director, DBNBR, National Institutes of Health (NIH) Consortia for Stroke Genetics Jonathan Rosand, MD, MSc, Chief, Division of Neurocritical Care & Emergency Neurology, Harvard University Transforming Research and Clinical Knowledge (TRACK) in TBI Ramon Diaz-Arrastia, MD, Ph.D., Clinical Associate Professor of Neurology, University of Pennsylvania Cardiovascular Research Grid Rai Winslow, Ph.D., Director, Center for Cardiovascular Bioinformatics & Modeling, Johns Hopkins University The Human Connectome Project Todd Constable, Ph.D., Professor of Radiology and Neurosurgery, Director MRI Research, Yale University METHODOLOGIES Statistical Models for Dense Biosignal Analysis Ciprian Crainiceanu, Ph.D., Professor of Biostatistics, Johns Hopkins University Systems Biology for Biomarker Discovery and Validation Akhilesh Pandey, MD, Ph.D., Professor, Johns Hopkins University Adaptive Clinical Trial Design in Acute Neurology Jose Suarez, MD, Professor of Neurology-Vascular Critical Care, Baylor College of Medicine Modeling Approaches to Physiologic Data Thomas Heldt, Ph.D., MS, Mphil, Assistant Professor Electrical and Biomedical Engineering, Massachusetts Institute of Technology Machine Learning for Clinical Prediction Saria Suchi, Ph.D., Assistant Professor, Johns Hopkins University Precision Medicine in the Neuro ICU: Multiparametric Prediction of Vasospasm After Subarachnoid Hemorrhage Soojin Park, MD, FAHA, FNCS, Assistant Professor of Neurology, Neurocritical Care Fellowship Director Columbia University College of Physicians and Surgeons    BIOLOGICAL METHODS Computational Modeling of Stroke Recovery in Humans John Krakauer, MA, MD, Professor of Neurology and Rehabilitation Medicine, Johns Hopkins University Brain-microbiome Crosstalk in Ischemic Stroke Constantino Iadecola, MD, Director, Brain & Mind Research Institute, Cornell University Biological Model of Brain Dysfunction in Sepsis Tarek Sharshar, Ph.D., Senior Consultant, Intensive Care Medicine, University of Versailles, France March 3rd, 2017 CLINICAL TRIALS Goals for Blood Pressure Management in Intracerebral Hemorrhage Adnan Qureshi, MD, Professor of Neurology, Neurosurgery and Radiology, University of Minnesota Personalized Targets for Hemodynamic Management in Neurocritical Care Christos Lazaridis, MD, Assistant Professor, Neurology, Baylor College of Medicine Selection of Intracerebral Hemorrhage Patients for Minimally Invasive Surgery Daniel Hanley, MD, Professor of Neurology, Johns Hopkins University PREDICTION Predictive Analytics for Impending Clinical Deterioration Dana Edelson, MD, Assistant Professor of Medicine, University of Chicago Quantitative Electroencephalographic Signatures for Prediction in Severe Brain Injury Jan Claassen, MD, Ph.D., FNCS, Head of Neurocritical Care and Medical Director of the Neurological ICU, Columbia University MRI Pattern Classification for TBI Detection and Prediction Yvonne Lui, MD, Associate Professor, Radiology, New York University Discriminative Mapping for Coma Recovery Prediction Robert Stevens, MD, Associate Professor, Anesthesiology & Critical Care Medicine, Johns Hopkins University Speakers: Chetan Bettegowda, MD, Ph.D., Associate Professor Neurosurgery, Johns Hopkins University Tim Buchman, Ph.D., MD, Director, Emory Critical Care Center, Emory University Jan Claassen, MD, Ph.D., FNCS, Head of Neurocritical Care, Columbia University Ciprian Crainiceanu, Ph.D., Professor of Biostatistics, Johns Hopkins University Ramon Diaz-Arrastia, MD, Ph.D., Clinical Associate Professor of Neurology, University of Pennsylvania Dana Edelson, MD, Assistant Professor of Medicine, University of Chicago Daniel Hanley, MD, Professor of Neurology, Johns Hopkins University Constantino Iadecola, MD, Director, Brain & Mind Research Institute, Cornell University Walter Koroshetz, MD, Director, NINDS John Krakauer, MA, MD, Professor of Neurology and Rehabilitation Medicine, Johns Hopkins University Christos Lazaridis, MD, Assistant Professor, Neurology, Baylor College of Medicine Yvonne Lui, MD, Associate Professor of Radiology, New York University Akhilesh Pandey, MD, Ph.D., Professor, Johns Hopkins University Adnan Qureshi, MD, Professor of Neurology, Neurosurgery and Radiology, University of Minnesota Jonathan Rosand, MD, MSc, Chief, Division of Neurocritical Care & Emergency Neurology, Harvard University Joni Rutter, Ph.D., Division Director, DBNBR, National Institutes of Health Tarek Sharshar, Ph.D., Senior Consultant, Intensive Care Medicine, University of Versailles, France Robert Stevens, MD, Associate Professor of Anesthesiology & Critical Care Medicine, Johns Hopkins University Jose Suarez, MD, Professor of Neurology-Vascular Critical Care, Baylor College of Medicine Rai Winslow, Ph.D., Director, Center for Cardiovascular Bioinformatics and Modeling, Johns Hopkins University For more information about this conference visit http://www.researchandmarkets.com/research/9mbnwd/neuroscience_in Research and Markets Laura Wood, Senior Manager press@researchandmarkets.com For E.S.T Office Hours Call +1-917-300-0470 For U.S./CAN Toll Free Call +1-800-526-8630 For GMT Office Hours Call +353-1-416-8900 U.S. Fax: 646-607-1907 Fax (outside U.S.): +353-1-481-1716


Nanotechnology - What You Should Know Top Scientific Minds You Probably Never Heard Of The Breakthrough Prizes 2017 were given away at an Oscars-like function in the NASA Ames Research Center in Mountain View on Sunday, Dec. 4, to honor outstanding research in life sciences, mathematics and fundamental physics. Attended by the Who's Who of the technology industry and scientific honchos, the award function was hosted by actor Morgan Freeman. At the ceremony, a total of $25 million was awarded to the winners. The event had Grammy winner Alicia Keys rendering live pop entertainment. "There has never been a more important time to support science," said Facebook founder Mark Zuckerberg, one of the patrons of the foundation. For conceiving the gala event in science, credit goes to Yuri Milner, the Russian billionaire and investor, and his wife, Julia, who instituted the debut award in 2012 to reward theoretical physicists for outstanding scientific achievements. Since then, the number of disciplines for awards expanded with more sponsors stepping in to support the cause. Among the new patrons are Google's Sergey Brin, Mark Zuckerberg of Facebook, biotech firm 23andMe's Anne Wojcicki and Jack Ma and his wife Cathy Zhang of Alibaba. The 2017 Breakthrough Prizes ceremony also marked the organization's fifth anniversary. Since 2012, the Breakthrough Prize has disbursed close to $200 million in honoring paradigm-shifting research in science. The awardees this year in life sciences, fundamental physics and mathematics are the following. These winners get individual $3 million in prizes. - Stephen J. Elledge, Professor of Genetics and Medicine in the Department of Genetics at Harvard Medical School, for probing the role of damage detection proteins in yielding mutated DNA replication and increasing cancer risk. - Harry F. Noller, Director, Center for Molecular Biology at the University of California. His work investigates the central role of RNA in the ribosome and origin of life. - Roeland Nusse, Professor at Stanford University. He explored the Wnt gene pathway and its implications in cancer. - Yoshinori Ohsumi, Honorary Professor, Institute of Innovative Research at Tokyo Institute of Technology. The work included the investigation of autophagy by which cells recycle their components to create nutrients. - Huda Yahya Zoghbi, Professor of Pediatrics, Baylor College of Medicine. The work was the discovery of biological underpinnings of spinocerebellar ataxia. The following three recipients shared a single $3 million award for their advances in string theory, quantum field theory and quantum gravity. - Joseph Polchinski, Professor of Physics at the University of California, Santa Barbara The following three winners shared a single $1 million prize, while $2 million was divided among 1,012 members of their research team. - Ronald Drever, Professor at the California Institute of Technology, Pasadena - Kip Thorne, Feynman Professor of Physics at the California Institute of Technology, Pasadena - Rainer Weiss, Professor at the Massachusetts Institute of Technology - Jean Bourgain, Professor, Institute for Advanced Study, Princeton, for contributions to high-dimensional geometry and other theoretical areas. One of the highlights of the awarding ceremony was the speeches by female students Antonella Masini, 18 (Peru) and Deanna See, 17 (Singapore). They were the winners of the Breakthrough Junior Challenge and got $250,000 for their inspiring science videos that promoted creative thinking on life sciences, physics and mathematics. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.


CLEVELAND: A researcher from University Hospitals Seidman Cancer Center will discuss his upcoming immunotherapy clinical trial for triple-negative breast cancer at the 2016 San Antonio Breast Cancer Symposium. The annual symposium is the premier meeting for more than 7,500 physicians and scientists dedicated to breast cancer treatment, featuring state-of-the-art breast cancer research such as experimental biology, etiology, prevention, diagnosis, and therapy of both breast cancer and premalignant breast disease. Joseph Baar, MD, PhD, Director of Breast Cancer Research at UH Seidman Cancer Center and Associate Professor at Case Western Reserve University School of Medicine, will share details about a phase II clinical trial testing the effectiveness of combining the chemotherapy drugs carboplatin and nab-paclitaxel with an immunotherapeutic agent called pembrolizumab (Keytruda) for use in patients with metastatic triple-negative breast cancer. Dr. Baar's poster presentation will be part of the Ongoing Trials-Targeted Therapy session on December 8, 2016 from 5 pm to 7 pm. "Up until now, women with triple-negative breast cancer have only had one treatment option, which is chemotherapy. However, more recently, we've seen that the immune modulator pembrolizumab improves outcomes in patients with metastatic triple-negative breast cancer," said Dr. Baar. "As a result, it is now critical to explore how the addition of pembrolizumab to chemotherapy might improve survival in patients with this type of breast cancer." Triple-negative breast cancer is a highly aggressive form which comprises 10-15 percent of newly diagnosed early-stage breast cancer. Most triple-negative tumors are high grade and have a high incidence of recurrence and metastases (spreading to other organs). Unlike other types of breast cancer, there is no standard follow-up treatment for triple-negative breast cancer to prevent recurrence. As triple-negative breast cancer progresses, tumor cells express a protein ligand called PD-L1, which interacts with the PD-1 receptor on T-cells. T-cells are the immune system's primary mechanism for fighting back against harmful foreign invaders. The PD-L1 to PD-1 interaction prevents the T-cell from responding to the tumor as a threat. Pembrolizumab binds to the T-cell's PD-1 receptors and therefore blocks the PD-1 to PD-L1 interaction, allowing the T-cells to be activated against the tumor cells. The research team hypothesizes that the addition of such an immunotherapeutic agent to chemotherapy will allow the body's natural immune response to reduce disease recurrence to a greater extent than either modality alone. This is the first phase II trial to study the effectiveness of combining these two chemotherapeutic agents with the immunotherapeutic agent pembrolizumab for this type of cancer. The trial will enroll approximately 30 patients beginning in early 2017. Eligible patients must have radiologically measurable and documented metastatic triple negative breast cancer, be mostly functional day to day as measured by an ECOG performance status of between zero and one, must not have received more than two prior therapies for this disease, and must be willing to undergo a preliminary biopsy for research purposes. The trial is sponsored by Merck, which produces pembrolizumab as Keytruda. "Trials our faculty members present at SABCS and other research meetings around the world illustrate the remarkable advances in oncology taking place today," says Neal J. Meropol, MD, Chief, Division of Hematology and Oncology, University Hospitals Seidman Cancer Center and Associate Director for Clinical Research, Case Comprehensive Cancer Center at Case Western Reserve. The symposium takes place December 6-10, 2016, and is hosted by The Cancer Therapy & Research Center at the University of Texas Health Science Center at San Antonio, the American Association for Cancer Research, and Baylor College of Medicine. Founded in 1866, University Hospitals serves the needs of over 1 million patients per year through an integrated network of 18 hospitals, more than 40 outpatient health centers and 200 physician offices in 15 counties throughout northern Ohio. The system's flagship academic medical center, University Hospitals Cleveland Medical Center, located on a 35-acre campus in Cleveland's University Circle, is affiliated with Case Western Reserve University School of Medicine. The main campus also includes University Hospitals Rainbow Babies & Children's Hospital, ranked among the top children's hospitals in the nation; University Hospitals MacDonald Women's Hospital, Ohio's only hospital for women; and University Hospitals Seidman Cancer Center, part of the NCI-designated Case Comprehensive Cancer Center. UH is home to some of the most prestigious clinical and research programs in the nation, including cancer, pediatrics, women's health, orthopedics, radiology, neuroscience, cardiology and cardiovascular surgery, digestive health, dermatology, transplantation and urology. UH Cleveland Medical Center is perennially among the highest performers in national ranking surveys, including "America's Best Hospitals" from U.S. News & World Report. UH is also home to Harrington Discovery Institute at University Hospitals - part of The Harrington Project for Discovery & Development. UH is the second largest employer in northern Ohio with 26,000 employees. For more information, go to UHhospitals.org.


Chronic aortic aneurysms are permanent and localized dilations of the aorta that remain asymptomatic for long periods of time but continue to increase in diameter before they eventually rupture. Left untreated, the patients prognosis is dismal, since the internal bleeding of the rupture brings about sudden death. Although successful treatment cures the disease, the risky procedures can result in paraplegia from spinal cord ischaemia or even death, particularly for aneurysms extending from the thoracic to the abdominal aorta and thus involving many segmental arteries to the spinal cord, i.e. thoracoabdominal aortic aneurysms of Crawford type II. Although various strategies have achieved a remarkable decrease in the incidence of paraplegia, it is still no less than 10 to 20%. However, it has been found that the deliberate occlusion of the segmental arteries to the paraspinous collateral network finally supplying the spinal cord does not increase rates of permanent paraplegia. A therapeutic option, minimally invasive segmental artery coil embolization has been devised which proceeds in a staged way to occlude groups of arteries under highly controlled conditions after which time must be allowed for arteriogenesis to build a robust collateral blood supply. PAPA-ARTiS is a phase II trial to demonstrate that a staged treatment approach can reduce paraplegia and mortality dramatically. It can be expected to have both a dramatic impact on the individual patients quality of life if saved from a wheelchair, and also upon financial systems through savings in; 1) lower costs in EU health care; 2) lower pay-outs in disability insurance (est. at 500k in Year 1), and; 3) loss of economic output from unemployment. Approx. 2500 patients a year in Europe undergo these high risk operations with a cumulative paraplegia rate of over 15%; therefore >100M per year in costs can be avoided and significantly more considering the expected elimination of type II endoleaks.


News Article | January 20, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. All procedures were performed in accordance with the law on animal protection issued by the German Federal Government (Tierschutzgesetz) and approved by the institutional animal welfare committee of the University of Tübingen. For all experiments, we used 4- to 8-week-old mice of either sex. In addition to C57Bl6 (wild-type) mice, we used the transgenic lines PvalbCre (‘PV’, JAX 008069, The Jackson Laboratory; ref. 43), Pcp2Cre (‘Pcp2’, JAX 006207; ref. 44) and ChATCre (JAX 006410; ref. 51), cross-bred with the red fluorescence Cre-dependent reporter line Ai9:tdTomato (JAX 007905). Owing to the exploratory nature of our study, we did not use randomization and blinding. Animals were housed under a standard 12 h day/night rhythm. For activity recordings, animals were dark-adapted for ≥1 h, then anaesthetized with isoflurane (Baxter) and killed by cervical dislocation. The eyes were enucleated and hemisected in carboxygenated (95% O , 5% CO ) artificial cerebral spinal fluid (ACSF) solution containing (in mM): 125 NaCl, 2.5 KCl, 2 CaCl , 1 MgCl , 1.25 NaH PO , 26 NaHCO , 20 glucose, and 0.5 l-glutamine (pH 7.4). Bulk electroporation of the fluorescent Ca2+ indicator Oregon-Green BAPTA-1 (OGB-1) into the ganglion cell layer (GCL) was carried out as described before19, 47. In brief, the retina was dissected from the eyecup, flat-mounted onto an Anodisc (#13, 0.2 μm pore size, GE Healthcare) with the GCL facing up, and placed between two 4-mm horizontal plate electrodes (CUY700P4E/L, Nepagene/Xceltis). A 10 μl drop of 5 mM OGB-1 (hexapotassium salt; Life Technologies) in ACSF was suspended from the upper electrode and lowered onto the retina. After application of 10–12 pulses (+9 V, 100 ms pulse width, at 1 Hz) from a pulse generator/wide-band amplifier combination (TGP110 and WA301, Thurlby handar/Farnell), the tissue was moved to the recording chamber of the microscope, where it was continuously perfused with carboxygenated ACSF at ~37 °C and left to recover for ~60 min before the recordings started. In all experiments with wild-type mice, ACSF contained ~0.1 μM Sulforhodamine-101 (SR101, Invitrogen) to reveal blood vessels and any damaged cells in the red fluorescence channel20. All procedures were carried out under very dim red (>650 nm) light. We used a MOM-type two-photon microscope (designed by W. Denk, MPI, Martinsried; purchased from Sutter Instruments/Science Products). Design and procedures were described previously20. In brief, the system was equipped with a mode-locked Ti:Sapphire laser (MaiTai-HP DeepSee, Newport Spectra-Physics) tuned to 927 nm, two fluorescence detection channels for OGB-1 (HQ 510/84, AHF/Chroma) and SR101 (HQ 630/60, AHF), and a water immersion objective (W Plan-Apochromat 20x/1,0 DIC M27, Zeiss). For image acquisition, we used custom-made software (ScanM, by M. Müller, MPI, Martinsried, and T.E.) running under IGOR Pro 6.3 for Windows (Wavemetrics), taking 64 × 64 pixel image sequences (7.8 frames per s) for activity scans or 512 × 512 pixel images for high-resolution morphology scans. For light stimulation, we focused a DLP projector (K11, Acer) through the objective, fitted with band-pass-filtered light-emitting diodes (LEDs) (‘green’, 578 BP 10; and ‘blue’, HC 405 BP 10, AHF/Croma) that roughly match the spectral sensitivity of moose M- and S-opsins. LEDs were synchronized with the microscope’s scan retrace. Stimulator intensity (as photoisomerisation rate, 103 P* per s per cone) was calibrated as described previously52 to range from 0.6 and 0.7 (black image) to 18.8 and 20.3 for M- and S-opsins, respectively. Owing to two-photon excitation of photopigments, an additional, steady illumination component of ~104 P* per s per cone was present during the recordings (for detailed discussion, see ref. 22). For all experiments, the tissue was kept at a constant intensity level (see stimuli below) for at least 30 s after the laser scanning started before light stimuli were presented. Four types of light stimulus were used (Fig. 1b, top): (i) full-field ‘chirp’ stimulus consisting of a bright step and two sinusoidal intensity modulations, one with increasing frequency and one with increasing contrast; (ii) 0.3 × 1 mm bright bar moving at 1 mm s−1 in eight directions19; (iii) alternating blue and green 3-s flashes; and (iv) binary dense noise, a 20 × 15 matrix with 40 μm pixel-side length; each pixel displayed an independent, perfectly balanced random sequence at 5 Hz yielding a total running time of 5 min for receptive field (RF) mapping. In some experiments, we used in addition dark moving bars (like (ii) but contrast-inversed), and stationary bright or dark 0.2 × 0.8 mm bars flashed for 1 s in six orientations (see Extended Data Fig. 7h–s). Except for (iii), stimuli were achromatic, with matched photo-isomerization rates for M- and S-opsins. TdTomato- or OGB-1-labelled RGCs were targeted using two-photon imaging for juxtacellular recordings using borosilicate electrodes (4–6 MΩ) filled with ACSF with added SR101 (250 μM). Data were acquired using an Axoclamp-900A or Axopatch 200A amplifier in combination with a Digidata 1440 (all: Molecular Devices), digitized at 10 kHz and analysed offline using IGOR Pro. We presented the same light stimuli as for the Ca2+ imaging. In some experiments, electrical recordings and Ca2+ imaging was performed simultaneously. After the recording, the membrane under the electrode was opened using a voltage ‘buzz’ to let the cell fill with dye by diffusion for approximately 30 min; then two-photon image stacks were acquired to document the cell’s morphology. Filled cells were traced semi-automatically offline using the Simple Neurite Tracer plugin implemented in Fiji (http://fiji.sc/Fiji), yielding cell skeletons. If necessary, we used the original image stack to correct the skeletons for any warping of the IPL using custom-written scripts in IGOR Pro. To this end, we employed the SR101-stained blood vessel plexuses on either side of the IPL as landmarks to define the IPL borders (see below). Only cells where the filling quality allowed full anatomical reconstruction were used for analysis (see below). Following Ca2+ imaging, retinas were mounted onto filter paper (0.8 μm pore size, Millipore) and fixed in 4% paraformaldehyde (in PBS) for 15 min at 4 °C. Immunolabelling was performed using antibodies against ChAT (choline-acetyltransferase; goat anti-ChAT, 1:100, AB144P, Millipore), GAD67 (glutamate decarboxylase; mouse anti-GAD67, 1:100, MAB5046, Millipore), SMI-32 (mouse anti-SMI32, 1:100, SMI-32R-100, Covance), and melanopsin (rabbit anti-melanopsin, 1:4000, AB-N38, Advanced Targeting Systems) for 4 days. Secondary antibodies were Alexa Fluor conjugates (1:750, 16 h, Life Technologies). For each retina, the recorded region was identified by the local blood vessel pattern and confirmed by comparing size and position of individual somata in the GCL. Image stacks were acquired on a confocal microscope (Nikon Eclipse C1) equipped with a ×60 oil objective (1.4 NA). The degree of immunolabelling of GCL cells was evaluate and rated (from 0, negative, to 4 positive) using z-stacks. Attribution of labelled somata to recorded ones was performed manually using ImageJ (http://imagej.nih.gov/ij) and IGOR Pro. Data analysis was performed using Matlab 2012 and 2014a (The Mathworks Inc.), and IGOR Pro. Data were organized in a custom written schema using the DataJoint for Matlab framework (http://datajoint.github.io/; D. Yatsenko, Tolias lab, Baylor College of Medicine). Regions of interest (ROIs), corresponding to somata in the GCL, were defined semi-automatically by custom software (D. Velychko, CIN) based on a high-resolution (512 × 512 pixels) image stack of the recorded field. Then, the Ca2+ traces for each ROI were extracted (as ΔF/F) using the IGOR Pro-based image analysis toolbox SARFIA (http://www.igorexchange.com/project/SARFIA). A stimulus time marker embedded in the recording data served to align the Ca2+ traces relative to the visual stimulus with a temporal precision of 2 ms. Stimulus-aligned Ca2+ traces for each ROI were imported into Matlab for further analysis. First, we de-trended the Ca2+ traces by high-pass filtering above ~0.1 Hz. For all stimuli except the dense noise (for RF mapping), we then subtracted the baseline (median of first eight samples), computed the median activity r(t) across stimulus repetitions (typically three to five repetitions) and normalized it such that . We mapped the linear RFs of the neurons by computing the Ca2+ transient-triggered average. To this end, we resampled the temporal derivative of the Ca2+ response ċ(t) at 10-times the stimulus frequency and used Matlab’s findpeaks function to detect the times t at which Ca2+ transients occurred. We set the minimum peak height to 1 s.d., where the s.d. was robustly estimated using: We then computed the Ca2+ transient-triggered average stimulus, weighting each sample by the steepness of the transient: Here, S(x, y, t) is the stimulus, τ is the time lag (ranging from approximately −320 to 1,380 ms) and M is the number of Ca2+ events. We smoothed this raw RF estimate using a 5 × 5 pixel Gaussian window for each time lag separately. RF maps shown correspond to a s.d. map, where the s.d. is calculated over time lags τ: To extract the RF’s position and scale, we fitted it with a 2D Gaussian function using Matlab’s lsqcurvefit. The time course of the receptive field F (τ) was estimated by the average of the eight pixels closest to the fitted RF centre (according to the Mahalanobis distance) weighted by a Gaussian profile. RF quality (QI ) was measured as one minus the fraction of variance explained by the Gaussian fit To extract time course and directional tuning of the Ca2+ response to the moving bar stimulus, we performed a singular value decomposition (SVD) on the T by D normalized mean response matrix M (times samples by number of directions; T = 32; D = 8; Extended Data Fig. 7a, b): This procedure decomposes the response into a temporal component in the first column of U and a direction dependent component or tuning curve in the first column of V, such that the response matrix can be approximated as an outer product of the two: An advantage of this procedure is that it does not require manual selection of time bins for computing direction tuning, but extracts the direction tuning curve given the varying temporal dynamics of different neurons. To measure direction selectivity (DS) and its significance, we projected the tuning curve V on a complex exponential , where α is the direction in the kth condition: This is mathematically equivalent to computing the vector sum in the 2D plane or computing the power in the first Fourier component. We computed a DS index as the resulting vector length correcting for the direction spacing. We additionally assessed the statistical significance of direction tuning using a permutation test53. To this end, we created surrogate trials (that is, stimulus repetitions) by shuffling the trial labels (that is, destroying any relationship between condition and response), computed the tuning curve for each surrogate trial and projected it on the complex exponential ϕ. Carrying out the procedure 1,000 times generated a null distribution for K, assuming no direction tuning. We used the percentile of the true K as the P value for direction tuning (Extended Data Fig. 7c). Importantly, a large DSi does not necessarily result in a small P value, for example, in the case of large trial to trial variability. As a result, the DSi distributions of significantly and not significantly direction tuned neurons show substantial overlap (Extended Data Fig. 7d, e). Therefore, a simple threshold as a DS criterion (for example, DSi > 0.4) does not provide a good separation into direction selective cell types and others. Orientation selectivity (OS) was assessed in an analogous way. However, we used the complex exponential , corresponding to the second Fourier component. To measure how well a cell responded to a stimulus (chirp, moving bar, colour), we computed the signal-to-noise ratio where C is the T by R response matrix (time samples by stimulus repetitions) and 〈 〉 and Var[ ] denote the mean and variance across the indicated dimension, respectively. If all trials are identical such that the mean response is a perfect representative of the response, QI is equal to 1. If all trials are completely random with fixed variance (so that the mean response is not informative about the individual trial responses at all), QI is proportional to 1/R. For further analysis, we used only cells that responded well to the chirp and/or the moving bar stimulus (QI  > 0.45 or QI  > 0.6). The full-field index was computed as comparing the response quality to a local stimulus (moving bar) and a global stimulus (chirp). where r and r are defined as the activity during the response to the leading edge of the moving bar (the first 400 ms of the ON response) and the trailing edge of the moving bar (the first 400 ms of the OFF response). Colour selectivity was measured for the ON response using and for the OFF response using an analogous definition. Here, r and r are the responses in a time window of 1,280 ms after onset of the green and blue stimulus, respectively. We used sparse principle component analysis54, as implemented in the SpaSM toolbox by K. Sjöstrang et al. (http://www2.imm.dtu.dk/projects/spasm/), to extract sparse response features from the responses to the chirp, colour, and moving bar stimulus, resulting in features which use only a small number of time bins. The extracted features are localized in time and therefore readily interpretable (for example, ‘high-frequency feature’), although this constraint was not explicitly enforced by the algorithm (Extended Data Fig. 2e). We also explored alternative feature extraction techniques such as regular PCA, but these resulted in inferior cluster quality. In addition, they required manually defining regions corresponding to specific parts of the stimulus (for example, frequency chirp) to yield localized and interpretable features. We extracted 20 features with 10 non-zero time bins from the mean response to the chirp (averaging across trials) and 6 features with 10 non-zero time bins from the mean response to the colour stimulus. For the moving bar stimulus, we extracted 8 features with 5 non-zero time bins from the response time course (see above) and 4 features with 6 non-zero time bins from its temporal derivative. All features were in the temporal domain, ensuring spatial invariance. In addition, we used two features from the time course of the RF, extracted with regular PCA. Overall, this procedure resulted in a 40 dimensional feature vector for each cell. Before clustering, we standardized each feature separately across the population of cells. DS and non-DS cells were clustered independently, classifying cells as DS if the permutation test resulted in P < 0.05 (see above). We fit each data set with a Mixture of Gaussians model using the expectation-maximization algorithm (Matlab’s gmdistribution object). We constrained the covariance matrix for each component to be diagonal, resulting in 80 parameters per component (40 for the mean, 40 for the variances). We further regularized the covariance matrix by adding a constant (10−5) to the diagonal. To find the optimal number of clusters, we evaluated the Bayesian information criterion55 where L is the log-likelihood of the model, N is the number of cells and M is the number of parameters in the model, that is, M = 81C − 1 where C is the number of clusters and the contributions that arose from means, variances and mixture proportions (which have to add to 1). Although other choices such as the Aikaike information criterion (AIC) would have been possible, we found the BIC to yield a good compromise between model complexity and quality, since the AIC is known to find too many clusters for large sample sizes. We also computed log Bayes factors as 2ΔBIC for each candidate cluster number to test how strong the evidence for further splitting is. Values >6 were treated as strong evidence in favour of further splitting. The minimum of the BIC coincided well with the number of clusters after which there was no strong evidence for further adding more clusters. To avoid local minima, we restarted the EM algorithm 20 times per candidate number of clusters and used the solution with the largest likelihood. This procedure resulted in 24 and 48 clusters for DS and non-DS cells, respectively (Extended Data Fig. 2a). To evaluate cluster quality, we rank-ordered the posterior probabilities for cluster assignment for each cluster, normalized for cluster size and averaged across clusters for non-DS and DS cells separately (Extended Data Fig. 2b). The steep decays of the sigmoidal functions indicate good cluster separability. To check how consistent the clustering was against subsampling of the data, we created 20 surrogate data sets containing random selections of 90% of the cells. We fit these surrogate data sets with a Mixture of Gaussians model with the optimal number of clusters determined on the original data set. For each cluster mean in these models, we computed the correlations with the most similar cluster for the model fit on the original data set. To summarize the similarity of clusterings, we computed the median correlation across clusters (Extended Data Fig. 2c). On average, the clusterings obtained on the surrogate and the original data set were very similar (mean median correlation: 0.96 ± 0.19 and 0.97 ± 0.01; mean ± s.d.; for DS and non-DS cells separately). In addition, we performed an alternative clustering version, where we did not split the data in DS and non-DS cells but added DSi, OSi, soma and receptive field size as features. The identified clusters were very similar, but this strategy failed to identify most DS types as separate clusters, except for the ON–OFF DS cell. Therefore, we decided to first isolate significant DS cells and cluster them separately, before merging similarly responding DS and non-DS clusters (see below), if we did not find a reason to keep the DS group as a separate RGC type. Nevertheless, a strategy equally justified as ours could start with the alternative clustering and then split those clusters containing large fractions of DS cells. A subset of cells was stained against GAD67 to identify dACs (see above). The intensity of this staining was manually rated as follows: −2 (absent), −1 (probably absent), 0 (uncertain), 1 (probably present), and 2 (present). For each cluster, we computed the average staining from the labelled cells (average number of cells with GAD67 information per cluster: 16.8 ± 10.0, mean ± s.d.). Clusters with an average staining <-0.2 were labelled RGCs (n = 30 clusters), those with average staining >0.2 were labelled ACs (n = 26). Clusters with average staining in-between those values (n = 5), or those that contained 6 or less cells with GAD67 information (n = 8) were labelled as uncertain, unless other clear criteria such as soma size or genetic labels indicated that they are ACs or RGCs. In this case they were manually allocated to RGC or AC (n = 3 and n = 2, respectively). Two clusters automatically classified as AC were included in the uncertain group due to their functional similarity with the OFF-suppressed types (G ). This procedure resulted in 33 RGC clusters, 10 uncertain clusters and 26 AC clusters. We extracted all cells with large cell bodies (>136 μm2; mean + 1 s.d. of total soma size distribution; Extended Data Fig. 2i, j) from RGC and uncertain clusters. Predominantly, these cells had been assigned to nine of the clusters. We re-clustered those cells using a Mixture of Gaussians model as described above, resulting in 16 clusters (Extended Data Fig. 2j). Receptive field size was not used in this process. Five of these clusters could be clearly associated with the three known alpha-RGC types and their response profiles31 (trans. OFF alpha, 2; sust. OFF alpha, 2; ON alpha, 1). Cells in these clusters were SMI-32-positive, as expected from alpha RGCs (Fig. 3i, k). Probably, this procedure missed some alpha cells, as somata close to the edge of scan fields were cut and we thus underestimate the soma size of these cells (for example, G c, see Fig. 2a–c). Remaining cells were kept in their original cluster. Logistic regression was used to assess the effect cell type (alpha vs. mini) on SMI-32 staining (absent vs. present). We used the Matlab implementation fitglm with a binomial nonlinearity. 95%-confidence intervals on the proportion of SMI32-positive cells were computed using bootstrapping with 1,000 samples. We used a standard linkage algorithm on the means of the RGC groups in the standardized feature space with correlation distance and average unweighted distance and plotted the result as a dendrogram (using Matlab functions linkage and dendrogram). The leaf order was optimized using the Matlab function optimalleaforder and modified for clarity of presentation. with the number of cells in a group (n ), the median RF size (A ) within a group counting only cells that surpassed a RF quality criterion of 0.3, and the total scan area across all experiments (A ). We corrected n for 29% cells discarded by our quality criterion as well as an empirically estimated 8% of cells that did not yield a ROI in the first place due to weak or absent labelling. In addition, A was corrected for an empirically estimated 34.8% RF overhang (that is, where a cell’s RF exceeds the scan field edge). This procedure yielded a CF of 2.0 ± 0.7 for most RGC groups (Gaussian fit; see Fig. 2e, right). However, differences between studies in approaches to measure RFs (for example, checkerboards vs. bars), in the assumptions used for RF fitting (for example, homogenous RFs best fitted by Gaussians), or in the methods to estimate dendritic arbor area can easily yield different absolute estimates of CF (see also Supplementary Table 1). To determine a cell’s IPL stratification profile, we calculated dendritic density as described previously10 with spatial smoothing of 1 μm3. The resultant 3D density cloud was projected on the z axis to estimate the mean IPL depth profile. The relationship between the depth profiles and the two ChAT bands was estimated in independent experiments using mice that express tdTomato in cholinergic ACs (ChATCre × Ai9:tdTomato). We compared the IPL depth of the tdTomato-labelled dendritic plexi to the two SR101-labelled blood vessel planes that line the inner retina. We estimated the error to be ~1.5 μm (s.d.), corresponding to 3–4% IPL depth (n = 13 measurements in 2 mice). To relate each cell’s IPL profile to functional groups we calculated the mean correlation coefficient between a cell’s response to the chirp and moving bar stimuli and each group’s mean response. The correlation coefficient (−1…1) for each pair was then multiplied with the cell’s depth profile and a correlation-rank based weighting factor W = 0.9rank −1. Thus, each individual recording yielded a complete two-dimensional map, with IPL depth on one axis and functional group on the other. Next, we averaged across the maps for those cells that passed our response quality criterion (n  = 31/51; n  = 24/33; see above). The resultant matrices were normalized in two steps: First, we divided each group’s IPL depth profile by the mean depth profile of all included cells to eliminate any bias in sampling depth. Second, we divided each depth profile by its own maximum. This resulted in an automatic and unbiased estimate of dendritic stratification depth for all RGC groups (Fig. 5). Note that this automated approach is based on a relatively small sample of reconstructed cells and therefore can only provide an approximate prediction of stratification levels. This approach is invariant to differences in lateral dendritic field dimensions that may be associated with retinal position (for example, refs 10,23).


News Article | December 8, 2016
Site: www.eurekalert.org

HOUSTON - (Dec. 7, 2016) - Scientists at Baylor College of Medicine, Baylor Genetics, the University of Texas Health Science Center at Houston and Texas Children's Hospital are combining descriptions of patients' clinical features with their complex genetic information in a unified analysis to obtain more precise diagnoses of complex diseases, particularly those that involve more than one gene causing the condition. The researchers anticipate that improved clinical and genetic diagnoses could lead to patients receiving more effective treatments and families benefiting from needed counseling. The study is published in the New England Journal of Medicine. "One of the main interests of our lab is to better understand the impact of genetic variation on human health and disease," said co-first author Dr. Jennifer Posey, assistant professor of molecular and human genetics at Baylor. "Traditionally, physicians have spoken of a unifying diagnosis, meaning that genetic conditions are due to mutations in only one gene," said co-first author Dr. Tamar Harel, who was a genetics fellow at Baylor when she was working on this study and currently is a geneticist at Hadassah Medical Center in Israel. "Yet, we see here that two or more genes can be involved in a disease and produce a complex clinical picture. For many in the field, this is a revolutionary idea." The challenge of diagnosing diseases with multiple genetic causes The researchers used whole exome sequencing to analyze all the genes in the genomes of nearly 7,400 unrelated patients with the goal of identifying the genetic cause of their conditions. They found a genetic cause in 2,076 of the 7,374 patients (28 percent); among these patients, 101 (approximately 5 percent) had two or more disease genes involved. If an individual has multiple defective genes, he or she may present with a complex set of clinical features that may lead to an imprecise diagnosis. "Clinically, multiple genetic causes can be missed because a patient may present with characteristics that overlap those of two different conditions, so the patient can be diagnosed with one or the other," said Posey. "Alternatively, a patient's clinical characteristics may not match those of any described condition, so the patient may be diagnosed with what is thought to be a new condition." "In these situations, we, as physicians, have to think of the possibility that more than one gene might be involved in the patient's disease," said senior author Dr. James R. Lupski, Cullen Professor of Molecular and Human Genetics at Baylor. "Our study shows the limitations of defining a disease according to what we see in the clinic alone. Our work shows the need to consider that a patient may have two or more genetic diseases, not one, and to send for a genomic test to help sort out the patient's condition and causes of it." "One of the contributions of our work involves utilization of a structured phenotype ontology," said Posey. "This computational tool allows us to model complex clinical features (phenotypes) that can result when more than one gene is involved, in order to better understand, from the perspective of the physician, how such cases may present in the clinic." Furthermore, Dr. Regis James, now at Regeneron Pharmaceuticals, previously created OMIM Explorer while training as a graduate student at BCM. OMIM Explorer is a tool that helps analyze genomic data in the context of the clinical characteristics of the patient. Both James and his thesis advisor and mentor, Dr. Chad Shaw, director of bioinformatics at Baylor Genetics and associate professor of molecular and human genetics at Baylor, were contributors to this work. "It provides a more complete perspective of how genes and physical traits relate to each other," said Lupski. "My colleagues and I anticipate that in the future, geneticists, clinicians and mathematicians will work together using genetic and clinical information to make diagnostic and therapeutic decisions," said Harel. "This paper reinforces the need to identify the diagnosis for patients with undiagnosed rare diseases and demonstrates that an unbiased comprehensive approach, such as whole exome sequencing is essential in the 5 percent of cases where two or more disorders are present," said Dr. Ada Hamosh, Dr. Frank V. Sutland Professor and clinical director at the McKusick-Nathans Institute of Genetic Medicine (IGM), and scientific director of Online Mendelian Inheritance in Man® (OMIM) at Johns Hopkins University, who was not a contributor to this study. "This work is especially relevant in the era of precision medicine," said senior co-author Dr. Yaping Yang, senior director of Baylor Genetics and associate professor of molecular and human genetics at Baylor. "I am very happy that in addition to providing molecular diagnoses to individual patients, our data is contributing to a better understanding of genetic disorders and genomic medicine." "Helping patients and their physicians to discover the underlying genetic mechanism of their condition is our most important priority," said co-author Dr. Christine M. Eng, professor of molecular and human genetics at Baylor and chief quality officer and chief medical officer at Baylor Genetics. "The data provided by this study compels us to continue the search for genetic contributions to a patient's overall clinical presentation." Other contributors to this work include Pengfei Liu, Jill A. Rosenfeld, Zeynep H. Coban Akdemir, Magdalena Walkiewicz, Weimin Bi, Rui Xiao, Yan Ding, Fan Xia, Arthur L. Beaudet, Donna M. Muzny, Richard A. Gibbs, Eric Boerwinkle, V. Reid Sutton and Sharon E. Plon. This study was supported by the National Human Genome Research Institute-National Heart, Lung, and Blood Institute grant U54 HG006542; the National Human Genome Research Institute grant U01 HG006485, grant UM1 HG008898, and grant U54 HG003273; the National Institute of Neurological Disorders and Stroke grant R01 NS058529; the National Institutes of Health (Medical Genetics Research Fellowship T32 GM07526) and the Ting Tsung and Wei Fong Chao Foundation. Financial disclosure forms provided by the authors are available with the full text of this article at NEJM.org.


News Article | February 21, 2017
Site: www.eurekalert.org

PHILADELPHIA -- It is commonly known that testosterone levels decrease as men age, but until last year, little was known about the effects of testosterone treatment in older men with low testosterone. Today, in a group of papers published in the Journal of the American Medical Association (JAMA) and JAMA Internal Medicine, researchers found that testosterone treatment improved bone density and anemia for men over 65 with unequivocally low testosterone. However, testosterone treatment did not improve cognitive function, and it increased the amount of plaque buildup in participants' coronary arteries. A team of researchers from the Perelman School of Medicine at the University of Pennsylvania, and twelve other medical centers in the United States, in partnership with the National Institute on Aging, conducted The Testosterone Trials (TTrials), a coordinated group of seven trials, which studied the effects of testosterone treatment for one year as compared to placebo for men 65 and older with low testosterone. The first paper, which reported that testosterone treatment improved sexual function and mood, was published in February 2016. Today's publications of the Bone, Anemia, Cognition and Cardiovascular Trials conclude the primary results of the study. Researchers found that testosterone treatment improved bone density and estimated bone strength, as determined by quantitative computed tomography (CT). The treatment also increased hemoglobin concentrations, corrected the anemia of men who had no other identifiable cause of anemia and corrected the anemia of men who had an identifiable cause, such as iron deficiency. While these conclusions proved testosterone to be beneficial to the participants, testosterone treatment did not improve memory or any other measure of cognitive function. "The paper reporting the results of the first three trials published last year was the first to show there were advantages to giving testosterone treatment to older men with low testosterone levels, and the bone and anemia trial results further support a benefit," said the principal investigator Peter J. Snyder, MD, a professor of Medicine in the Division of Endocrinology, Diabetes and Metabolism. "However, the increase of plaque buildup in the coronary artery shows that this treatment may also have some risk" In the cardiovascular trial, researchers assessed coronary artery plaque buildup by CT angiography. That assessment showed more plaque buildup in men treated with testosterone than in men treated with placebo. Nonetheless, in all 788 men in the TTrials, the number of major adverse cardiovascular events was similar in the men treated with testosterone as in the men treated with placebo. However, Snyder added, "treating 788 men for one year is far too few to draw conclusions about the clinical significance of the increase in coronary artery plaque volume and the cardiovascular risk of testosterone treatment." The TTrials are now the largest trials to examine the efficacy of testosterone treatment in men 65 and older whose testosterone levels are low due seemingly to age alone. TTrials researchers screened 51,085 men to find 790 who qualified with a sufficiently low testosterone level and who met other criteria. The men enrolled were randomized into two groups: one to take a daily testosterone gel and the other a daily placebo gel, for one year. Efficacy was then evaluated at months three, six, nine and 12. "Final decisions about testosterone treatment for older men will depend on balancing the results from these seven TTrials with the results from a much larger and longer term trial designed to assess cardiovascular and prostate risk in the future," said Snyder. The TTrials were conducted at 12 additional medical centers across the country including Albert Einstein College of Medicine, Baylor College of Medicine, Brigham and Women's Hospital, Harbor-UCLA Medical Center, University of Alabama at Birmingham, Northwestern University Feinberg School of Medicine, Puget Sound Health Care System, University of California at San Diego School of Medicine, University of Florida School of Medicine, University of Minnesota School of Medicine, University of Pittsburgh School of Public Health, and Yale School of Medicine. The Testosterone Trials were supported by a grant from the National Institute on Aging (NIA), National Institutes of Health (U01 AG030644). The TTrials were also supplemented by funds from the National Heart, Lung and Blood Institute, National Institute of Neurological Diseases and Stroke, and National Institute of Child Health and Human Development. AbbVie (formerly Solvay and Abbott Laboratories) also provided funding, AndroGel, and placebo gel. Penn Medicine is one of the world's leading academic medical centers, dedicated to the related missions of medical education, biomedical research, and excellence in patient care. Penn Medicine consists of the Raymond and Ruth Perelman School of Medicine at the University of Pennsylvania (founded in 1765 as the nation's first medical school) and the University of Pennsylvania Health System, which together form a $5.3 billion enterprise. The Perelman School of Medicine has been ranked among the top five medical schools in the United States for the past 18 years, according to U.S. News & World Report's survey of research-oriented medical schools. The School is consistently among the nation's top recipients of funding from the National Institutes of Health, with $373 million awarded in the 2015 fiscal year. The University of Pennsylvania Health System's patient care facilities include: The Hospital of the University of Pennsylvania and Penn Presbyterian Medical Center -- which are recognized as one of the nation's top "Honor Roll" hospitals by U.S. News & World Report -- Chester County Hospital; Lancaster General Health; Penn Wissahickon Hospice; and Pennsylvania Hospital -- the nation's first hospital, founded in 1751. Additional affiliated inpatient care facilities and services throughout the Philadelphia region include Chestnut Hill Hospital and Good Shepherd Penn Partners, a partnership between Good Shepherd Rehabilitation Network and Penn Medicine. Penn Medicine is committed to improving lives and health through a variety of community-based programs and activities. In fiscal year 2015, Penn Medicine provided $253.3 million to benefit our community.


Two studies in the February 14 issue of JAMA examine hair loss among women with breast cancer who received scalp cooling before, during and after chemotherapy. Chemotherapy may result in hair loss (alopecia), which women rate as one of the most distressing adverse effects of chemotherapy. Scalp cooling is hypothesized to reduce blood flow to hair follicles and reduce uptake of chemotherapeutic agents. Modern methods to prevent hair loss use devices that circulate fluid in a cooling cap using refrigeration. A cap is placed on the patient prior to chemotherapy and does not have to be changed or removed until the treatment is completed. Although scalp cooling devices have been used to prevent alopecia, efficacy has not been assessed in a randomized clinical trial. In one study, Julie Nangia, M.D., of the Baylor College of Medicine, Houston, and colleagues randomly assigned 182 women with breast cancer undergoing chemotherapy to scalp cooling (n = 119) or control (n = 63). Scalp cooling was done 30 minutes prior to and during and 90 minutes after each chemotherapy infusion. Hair preservation was assessed at the end of four cycles of chemotherapy. One interim analysis was planned to allow the study to stop early for efficacy. At the time of the interim analysis, 142 participants were evaluable. The researchers found that patients who received scalp cooling were significantly more likely than patients who did not receive scalp cooling to have less than 50 percent hair loss (with 51 percent of those in the scalp cooling group retaining their hair, compared with 0 percent of those in the control group). There were no significant differences in changes in any of the measures of quality of life between the groups. Only adverse events related to device use were collected; 54 adverse events were reported in the cooling group, none serious. "Further research is needed to assess longer-term efficacy and adverse effects," the authors write. In another study, Hope S. Rugo, M.D., of the University of California, San Francisco, and colleagues included women with breast cancer receiving chemotherapy (106 patients in the scalp cooling group and 16 in the control group; 14 matched by both age and chemotherapy regimen). Scalp cooling was initiated 30 minutes prior to each chemotherapy cycle, with scalp temperature maintained at 3°C (37°F) throughout chemotherapy and for 90 minutes to 120 minutes afterward. Although scalp cooling has been available for several decades in Europe, use has been limited in the United States because of several factors, including insufficient prospective efficacy data with current chemotherapy regimens and lack of U.S. Food and Drug Administration (FDA) clearance. Among the 122 patients in the study, the average duration of chemotherapy was 2.3 months. Hair loss of 50 percent or less was seen in 67 of 101 patients (66 percent) evaluable for alopecia in the scalp cooling group vs 0 of 16 patients (0 percent) in the control group. Three of five quality-of-life measures were significantly better one month after the end of chemotherapy in the scalp cooling group. Of patients who underwent scalp cooling, 27 percent reported feeling less physically attractive compared with 56 percent of patients in the control group. Of the 106 patients in the scalp cooling group, four (3.8 percent) experienced the adverse event of mild headache and three (2.8 percent) discontinued scalp cooling due to feeling cold. "Further research is needed to assess outcomes after patients receive anthracycline [a class of drugs used in chemotherapy] regimens, longer-term measures of alopecia, and adverse effects," the authors write. Editor's Note for Nangia et al study: This work was supported by Paxman Coolers Ltd., which contracted with Baylor College of Medicine to conduct the study. Dr. Lacouture is supported in part by a grant from the National Cancer Institute. Please see the article for additional information, including other authors, author contributions and affiliations, financial disclosures, etc. Editor's Note for Rugo et al study: The study was funded partially by Dignitana AB, the Lazlo Tauber Family Foundation, the Anne Moore Breast Cancer Research Fund, and the Friedman Family Foundation. Please see the article for additional information, including other authors, author contributions and affiliations, financial disclosures, etc. Related material: The editorial, "Scalp Cooling to Prevent Chemotherapy-Induced Alopecia," by Dawn L. Hershman, M.D., M.S., of Columbia University Medical Center, New York; the article, in JAMA Oncology, "Do the Data on Scalp Cooling for Patients with Breast Cancer Warrant Broad Adoption?" by Howard (Jack) West, M.D., of the Swedish Cancer Institute, Seattle, and Web Editor, JAMA Oncology; the JAMA Patient Page, "Chemotherapy and Hair Loss,"; and images of scalp cooling and photographic results of two patients treated with scalp cooling are available at the For The Media website. To place an electronic embedded link to these studies in your story These links will be live at the embargo time: http://jamanetwork. http://jamanetwork.


News Article | December 22, 2016
Site: www.eurekalert.org

An international team of scientists has discovered that the gene, OGDHL, a key protein required for normal function of the mitochondria -- the energy-producing factory of the cell -- and its chaperone, nardilysin (NRD1) are linked to progressive loss of neurological function in humans. Working with the fruit fly, an experimental animal model in the lab, the scientists found a mechanism by which misregulation of mitochondrial function leads to neurodegeneration. The results appear in Neuron. "In our research we look for genes whose loss of function results in deterioration of neurological functions in the fruit fly Drosophila melanogaster," said first author Dr. Wan Hee Yoon, postdoctoral fellow in the laboratory of Dr. Hugo Bellen, professor at Baylor College of Medicine, investigator at the Howard Hughes Medical Institute, and senior author of the paper. "In the fly we found that loss of function of nardilysinled to a slow, progressive neurodegeneration." Yoon and colleagues discovered that nardilysin helps the folding of an important protein, an enzyme called OGDH, present in mitochondria. Loss of nardilysin function results in loss of OGDH and a build-up of a compound called a-ketoglutarate (a-KG). High levels of a-KG increase a cellular response mechanism called mTOR that normally provides clearance of cellular components such as proteins and organelles. Yoon observed that mutation of nardilysin leads to abnormal build-up of a-KG followed by mTOR activation and eventually to slow accumulation of cellular trash. Importantly, a drug named rapamycin suppresses the neurodegenerative conditions caused by this accumulation of cellular garbage. In 2009, a group led by Dr. Eiichiro Nishi in Japan genetically engineered a mouse to lack nardilysin.The mice developed neurological problems with motor coordination, balance and memory issues, findings which at the time were not known to be linked to the mechanism described above in the fruit fly. The team led by Bellen realized that the results in fruit flies and in mice might suggest a role for nardilysin and its target protein OGDH in neurological problems in humans. At the same time that Yoon was investigating nardilysinand its target protein OGDH, across the street co-author Dr. Ender Karaca, a postdoctoral fellow in the laboratory of Dr. James R. Lupski's group at Baylor, was working to solve a rare disease by sequencing the patient's genome through the Baylor-Hopkins Center for Mendelian Genomics (BHCMG). Karaca had discovered a 16-year-old patient with a rare variant in OGDHL who was unable to walk, was bound to a wheelchair and whose head had not grown normally. Yoon and Karaca connected and realized that the mechanism in flies that Yoon was working on might explain the undiagnosed patient of Karaca. "We realized that Ender had identified OGDHL as the top candidate gene for his patient at the same time that we were identifying OGDHL as a target of nardilysin," said Yoon. "After we saw a patient with a severe disorder and variants in OGDHL, we wondered about nardilysin," said Bellen. The researchers then widened their search for similar patients by posting the information of the disease-causing variants of nardilysinin GeneMatcher, a web tool for rare disease researchers developed by the BHCMG team at Johns Hopkins University. Researchers looking for patients carrying rare disease genes post the gene in GeneMatcher. If another researcher around the world has a patient with a matching gene, the teams can contact each other to share the information and collaborate. By posting nardilysinin GeneMatcher, Yoon and colleagues identified a patient whose DNA had been sequenced at the University of California in Los Angeles Clinical Genomics Center. The patient is a 15-year-old boy who presents with symptoms that are remarkably similar to those present in the patient identified by Karaca. "We knew then that these two patients had a very similar disorder, but we had to prove that the genetic variants were causing their conditions," said Yoon and Bellen. Using flies to study how human disease genes work The data from the two patients were strong evidence that the variants in nardilysin and OGDHL are linked to neurodegenerative disease in humans. However, to establish that the disease variants can cause the condition, the researchers turned back to the flies where they could use genetic technology to test the variants. "We can test a human gene side by side with a copy containing a variant from a patient in flies," said co-author Dr. Michael F. Wangler, assistant professor of molecular and human genetics at Baylor. Using this technology, Yoon showed that mutant flies carrying a normal copy of the human gene show normal development and neuronal function. However, flies carrying genes with deleterious variants found in patients failed to rescue the loss of the genes in flies. This suggests that the mutations found in patients are indeed deleterious. "These studies show how valuable the fruit fly model is to uncover and test genes linked to human conditions, and to work out how mutations may cause diseases," said Bellen. Other contributors to this work include Hector Sandoval, Sonal Nagarkar-Jaiswal, Manish Jaiswal, Shinya Yamamoto, Nele A. Haelterman, Nagireddy Putluri, Vasanta Putluri, Arun Sreekumar, Tulay Tos, Ayse Aksoy, Taraka Donti, Brett H. Graham, Mikiko Ohno, Eiichiro Nishi, Jill Hunter, Donna M. Muzny, Jason Carmichael, Joseph Shen, Valerie A. Arboleda, Stanley F. Nelson. The authors are affiliated with one or more of the following institutions: Baylor College of Medicine, Texas Children's Hospital, Dr. Sami Ulus Research and Training Hospital of Women's and Children's Health and Diseases (Turkey), Kyoto University, Valley Children's Hospital at Madera and the University of California at Los Angeles. This study was supported by grants from the National Institutes of Health (NIH R01GM067858, NIH T32 NS043124-11) and the Research Education and Career Horizon Institutional Research and Academic Career Development Award Fellowship 5K12GM084897, the Jan and Dan Duncan Neurological Research Institute at Texas Children's Hospital, the CPRIT Metabolomics Core Facility Support Award RP120092, NCI/ 2P30CA125123-09 Shared Resources Metabolomics core, Dan L. Duncan Comprehensive Cancer Center (DLDCC), Alkek Center for Molecular Discovery, Mass Spectrometry COE by Agilent and the NIH R01GM098387. Further support came from research grants 26293068, 26670139 and 26116715 and a research program of the P-Direct from the MEXT of Japan and the NIH K08NS076547 funded by National Institute of Neurological Disorders and Stroke. The authors acknowledge the support of the NIH (1RC4GM096355), the Robert A. and Renee E. Belfer Family Foundation, the Huffington Foundation and Target ALS and the Howard Hughes Medical Institute. This work was also supported in part by a grant from the National institute of Neurological Disease and Stroke (R01NS058529), the Baylor-Hopkins Center for Mendelian Genomics, the US National Human Genome Research Institute, National Heart Lung and Blood Institute grant U54HG006542. J.R.L. has stock ownership in 23andMe and Lasergen, is a paid consultant for Regeneron Pharmaceuticals and is a coinventor on multiple United States and European patents related to molecular diagnostics for inherited neuropathies, eye diseases and bacterial genomic fingerprinting. The Baylor College of Medicine derives revenue from the chromosomal microarray analysis and clinical exome sequencing offered in the Baylor Genetics Laboratory.


2017 Breakthrough Prize in Life Sciences Awarded to Stephen J. Elledge, Harry F. Noller, Roeland Nusse, Yoshinori Ohsumi, and Huda Yahya Zoghbi 2017 Breakthrough Prize in Fundamental Physics Awarded to Joseph Polchinski, Andrew Strominger, and Cumrun Vafa New Horizons in Physics Prize awarded to Asimina Arvanitaki, Peter W. Graham, and Surjeet Rajendran; Simone Giombi and Xi Yin; and Frans Pretorius New Horizons in Mathematics Prize awarded to Mohammad Abouzaid, Hugo Duminil-Copin, and Benjamin Elias and Geordie Williamson Second Annual, International Breakthrough Junior Challenge Won by Female Students Antonella Masini, 18 (Peru) and Deanna See, 17 (Singapore) 2016 Special Breakthrough Prize in Fundamental Physics, awarded in May to founders and team members of LIGO, awarded to Kip Thorne, Rainer Weiss and family of Ronald Drever Laureates to be honored at glittering awards gala hosted by Morgan Freeman, with live performance by Alicia Keys and presentations from Daniel Ek (CEO of Spotify), Jeremy Irons, Mark and Scott Kelly, Hiroshi Mikitani (CEO of Rakuten), Sienna Miller, Bryce Dallas Howard, Vin Diesel, Kevin Durant, Dev Patel, Sundar Pichai (CEO of Google), Alex Rodriguez, Will.i.am, Susan Wojcicki (CEO of YouTube) and the founders of the Breakthrough Prize SAN FRANCISCO, Dec. 5, 2016 /PRNewswire/ -- The Breakthrough Prize and founders Sergey Brin and Anne Wojcicki, Yuri and Julia Milner, and Mark Zuckerberg and Priscilla Chan, tonight announced the recipients of the 2017 Breakthrough Prizes, marking the organization's fifth anniversary recognizing top achievements in Life Sciences, Fundamental Physics and Mathematics. A combined total of $25 million was awarded at the gala ceremony in Silicon Valley, hosted by Morgan Freeman. Each of the Breakthrough Prizes is worth $3 million, the largest individual monetary prize in science. This year, a total of seven of these prizes were awarded to nine individuals, along with a $3 million Special Breakthrough Prize in Fundamental Physics, which was split between three founders and more than a thousand members of the LIGO team. In addition, three $100,000 New Horizons in Physics Prizes were awarded to six early-career physicists, and a further three $100,000 New Horizons in Mathematics Prizes were awarded to four young mathematicians. And this year there were two winners of the Breakthrough Junior Challenge, each receiving up to $400,000 in educational prizes for them, their teacher and their school. Since its inception in 2012, the Breakthrough Prize has awarded close to $200 million to honor paradigm-shifting research in the fields of fundamental physics, life sciences, and mathematics. "There has never been a more important time to support science," said Facebook founder Mark Zuckerberg. "The 2017 Breakthrough Prize laureates represent the leaders in scientific research in physics, math and life sciences. Their breakthroughs will unlock new possibilities and help make the world a better place for everyone." The 2017 Breakthrough Prize in Life Sciences was awarded to Stephen J. Elledge (Harvard Medical School); Harry F. Noller (University of California, Santa Cruz); Roeland Nusse (Stanford University); Yoshinori Ohsumi (Tokyo Institute of Technology); Huda Yahya Zoghbi (Baylor College of Medicine). The 2017 Breakthrough Prize in Fundamental Physics was awarded to Joseph Polchinski (University of California, Santa Barbara); Andrew Strominger (Harvard University); and Cumrun Vafa (Harvard University). The three honorees joined the recipients of the previously announced Special Prize in Fundamental Physics, released in May 2016. Ronald Drever (California Institute of Technology, Pasadena), Kip Thorne (California Institute of Technology, Pasadena) and Rainer Weiss (Massachusetts Institute of Technology), were recognized in May for their detection of gravitational waves, opening new horizons in astronomy and physics. The three winners of the Special Prize will share a $1 million prize, and 1,012 LIGO team members will share $2 million. The 2017 Breakthrough Prize in Mathematics was awarded to Jean Bourgain (Institute for Advanced Study). This year's ceremony will mark the fifth anniversary of the organization, and laureates will take to the stage tonight at an exclusive gala co-hosted by founders Sergey Brin and Anne Wojcicki, Yuri and Julia Milner, Mark Zuckerberg and Priscilla Chan, and Vanity Fair editor Graydon Carter. Academy Award®-winning actor Morgan Freeman will host the show, which will feature a performance by 15-time Grammy Award® winner Alicia Keys, and celebrity presenters Jeremy Irons, Mark and Scott Kelly, Hiroshi Mikitani (CEO of Rakuten), Sienna Miller, Bryce Dallas Howard, Vin Diesel, Kevin Durant, Dev Patel, Sundar Pichai (CEO of Google), Alex Rodriguez, Will.i.am, Susan Wojcicki (CEO of YouTube), as well as the founders of the Breakthrough Prize. The theme of the evening will be "the universal reach of ideas." "Science is universal," said Yuri Milner. "Tonight it brought together some of the world's greatest actors, sportsmen, musicians, academics, entrepreneurs, astronauts and, last but not least, scientists, to celebrate what the human mind can achieve. And it brought in a live audience from across the planet." One of the highlights will be the speeches by the two female students who won the Breakthrough Junior Challenge, Antonella Masini, 18 (Peru) and Deanna See, 17 (Singapore). The Breakthrough Junior Challenge is a global science video competition designed to inspire creative thinking about fundamental concepts in the life sciences, physics, or mathematics. In recognition of their winning submissions, both students received up to $400,000 in educational prizes, including a scholarship worth up to $250,000, $50,000 for an inspiring teacher, and a state-of-the-art science lab valued at $100,000. Entries from 146 countries were received in the 2016 installment of the global competition, which kicked off on September 1, 2016. The Breakthrough Junior Challenge is funded by Mark Zuckerberg and Priscilla Chan, and Yuri and Julia Milner, through the Breakthrough Prize Foundation, based on a grant from Mark Zuckerberg's fund at the Silicon Valley Community Foundation, and a grant from the Milner Global Foundation. "The Breakthrough Junior Challenge encourages students to better understand the worlds of science and mathematics and to have some fun along the way," said Breakthrough Prize co-founder Dr. Priscilla Chan. "Antonella and Deanna both have bright futures in science and I am so excited to honor their work. They are also incredible storytellers, whose ability to capture these complex ideas in accessible and exciting ways is truly inspiring. I cannot wait to see how they will change the world." In addition, six New Horizons prizes – an annual prize of $100,000 each, recognizing the achievements of early-career physicists and mathematicians – were awarded. The New Horizons in Physics Prize was awarded to: The New Horizons in Mathematics Prize was awarded to: The ceremony will be directed and produced, for the fourth time, by Don Mischer alongside executive producers Charlie Haykel and Juliane Hare of Don Mischer Productions. Broadcast live in its entirety on NATIONAL GEOGRAPHIC at 10/9c on Sunday, Dec. 4, an edited one-hour version of the ceremony will also air on FOX on Sunday, Dec. 18, at 7:00-8:00 PM ET/PT and globally on NATIONAL GEOGRAPHIC in 171 countries and 45 languages. The Breakthrough Prize in Life Sciences honors transformative advances towards understanding living systems and extending human life, with one prize dedicated to work that contributes to the understanding of neurological diseases. Each of the five Life Science winners received a $3 million prize. Stephen J. Elledge, Gregor Mendel Professor of Genetics and Medicine in the Department of Genetics at Harvard Medical School and in the Division of Genetics at the Brigham and Women's Hospital and Investigator with the Howard Hughes Medical Institute, for elucidating how eukaryotic cells sense and respond to damage in their DNA and providing insights into the development and treatment of cancer. Harry F. Noller, Director of the Center for Molecular Biology of RNA, Robert L. Sinsheimer Professor of Molecular Biology and Professor Emeritus of MCD Biology at the University of California, Santa Cruz, for discovering the centrality of RNA in forming the active centers of the ribosome, the fundamental machinery of protein synthesis in all cells, thereby connecting modern biology to the origin of life and also explaining how many natural antibiotics disrupt protein synthesis. Roeland Nusse, Professor of Developmental Biology at Stanford University and Investigator at Howard Hughes Medical Institute, for pioneering research on the Wnt pathway, one of the crucial intercellular signaling systems in development, cancer and stem cell biology. Yoshinori Ohsumi, Honorary Professor, Institute of Innovative Research at Tokyo Institute of Technology for elucidating autophagy, the recycling system that cells use to generate nutrients from their own inessential or damaged components. Huda Yahya Zoghbi, Professor in the Departments of Pediatrics, Molecular and Human Genetics, Neurology and Neuroscience at Baylor College of Medicine, Investigator at the Howard Hughes Medical Institute and Director of the Jan and Dan Duncan Neurological Research Institute (NRI) at Texas Children's Hospital, for discoveries of the genetic causes and biochemical mechanisms of spinocerebellar ataxia and Rett syndrome, findings that have provided insight into the pathogenesis of neurodegenerative and neurological diseases. The Breakthrough Prize in Fundamental Physics recognizes major insights into the deepest questions of the universe. The three winners, sharing the $3 million prize, are: Joseph Polchinski, Professor in the Department of Physics and Member of the Kavli Institute for Theoretical Physics at the University of California, Santa Barbara; Andrew Strominger, Director of the Center for the Fundamental Laws of Nature at Harvard University; and, Cumrun Vafa, Donner Professor of Science in the Department of Physics at Harvard University, All three received the Prize for transformative advances in quantum field theory, string theory, and quantum gravity. The Breakthrough Prize in Mathematics honors the world's best mathematicians who have contributed to major advances in the field. Jean Bourgain, IBM von Neumann Professor in the School of Mathematics at the Institute for Advanced Study, Princeton, New Jersey, for multiple transformative contributions to analysis, combinatorics, partial differential equations, high-dimensional geometry and number theory. The New Horizons in Physics Prize is awarded to promising early-career researchers who have already produced important work in fundamental physics. The New Horizons in Mathematics Prize is awarded to promising early-career researchers who have already produced important work in mathematics. The second annual Breakthrough Junior Challenge recognizes two winners this year - Antonella Masini, 18, from Peru, and Deanna See, 17, from Singapore. Antonella and Deanna will each receive up to $400,000 in educational prizes. Antonella's video, submitted in the physics category, focused on quantum entanglement. Deanna's life sciences video, titled "Superbugs! And Our Race against Resistance," tackled antibiotic resistance. Images and select video from the 2017 Breakthrough Prize Gala -red carpet and ceremony- can be downloaded for media use at: For the fifth year, the Breakthrough Prizes will recognize the world's top scientists. Each prize is $3 million and awarded in the fields of Life Sciences (up to five per year), Fundamental Physics (up to one per year) and Mathematics (up to one per year). In addition, up to three New Horizons in Physics and up to three New Horizons in Mathematics Prizes are given out to junior researchers each year. Laureates attend a televised awards ceremony designed to celebrate their achievements and inspire the next generation of scientists. As part of the ceremony schedule, they also engage in a program of lectures and discussions. The Breakthrough Prizes were founded by Sergey Brin and Anne Wojcicki, Mark Zuckerberg and Priscilla Chan, and Yuri and Julia Milner. Selection Committees composed of previous Breakthrough Prize laureates choose the winners. Information on the Breakthrough Prizes is available at www.breakthroughprize.org.


News Article | December 20, 2016
Site: globenewswire.com

Dublin, Dec. 20, 2016 (GLOBE NEWSWIRE) -- Research and Markets has announced the addition of the "HDAC Inhibitors Market, 2016 - 2026" report to their offering. The HDAC Inhibitors Market, 2016-2026 report was commissioned to examine the current landscape and the future outlook of the growing pipeline of products in this area. HDACs have been studied in cellular processes such as apoptosis, autophagy, metabolism, DNA damage repair, cell cycle control and senescence. Altered expression of HDACs has been observed in different tumors; this makes them a potential target for treatment of cancer and other genetic or epigenetic related disorders. Inhibition of HDACs has shown positive results in disruption of multiple cell signaling pathways and prevention of tumor growth. The study provides a detailed market forecast and opportunity analysis for the time period 2016-2026. The research, analysis and insights presented in this report include potential sales of the approved drugs and the ones in late stages of development (phase III and phase II). To add robustness to our model, we have provided three scenarios for our market forecast; these include the conservative, base and optimistic scenarios. Our opinions and insights, presented in this study were influenced by several discussions we conducted with experts in this area. All actual figures have been sourced and analyzed from publicly available information forums and primary research discussions. Financial figures mentioned in this report are in USD, unless otherwise specified. Example Highlights - Nearly 90 HDAC inhibitors are currently in clinical / preclinical stages of development; the clinical molecules account for over 30% of the pipeline while over 60% is captured by molecules in the preclinical / discovery stage. - With 66% of the pipeline molecules targeting oncological indications, cancer remains one of the most widely studied field for HDAC inhibitors. Within oncology, hematological malignancies such as PTCL and CTCL are popular targets; three HDAC inhibitors (Zolinza, ISTODAX® and BELEODAQ®) are approved for these indications. Other therapeutic areas such as autoimmune disorders, infectious diseases, inflammatory disorders, neurological disorders, are also gradually gaining traction. - Although the market was initially led by the large-size pharma players (such as Celgene, Merck, Novartis), the current market is characterized by the presence of several small / mid-sized pharma players. Notable examples of the small and mid-sized firms include 4SC, Chroma Therapeutics, CrystalGenomics, Curis, Evgen Pharma, FORUM Pharmaceuticals, Karus Therapeutics, Mirati Therapeutics, MEI Pharma, Shenzhen Chipscreen Biosciences, Syndax Pharmaceuticals and TetraLogic Pharmaceuticals. - In addition, there are several non-industry institutes and universities that are primarily carrying out preclinical research. Examples of these include Harvard Medical School (BG45), Imperial College London (C1A), Kyoto University (Jd, Sd), National Taiwan University (Quinazolin-4-one derivatives), Taipei Medical University (MPT0E028), University of Messina (MC-1575, MC-1568). - Four of the five approved drugs are pan-HDAC inhibitors targeting HDAC isoforms non-specifically. However, in the past few years, several class selective HDAC inhibitors have entered the clinic; these are associated with a higher efficacy and result in decreased toxicity from the treatment. Of the total HDAC inhibitors identified, 52% of the molecules are class specific; of these, 33% molecules target Class I specific isoforms and the rest target Class II specific isoforms of HDACs. Notable examples of molecules targeting class-specific HDACs includeentinostat (phase III), resminostat (phase II), SHP-141 (phase II), mocetinostat (phase II), CHR-3996 (phase I/II) and ricolinostat (phase I/II). - The HDAC inhibitors market is expected to grow at a healthy annual rate of 32% over the next decade.With multiple potential target indications, Istodax® is expected to capture the largest market share (close to 21%) in 2026, followed by entinostat, Farydak® and Beleodaq®. Key Topics Covered: 1. Preface 1.1. Scope Of The Report 1.2. Research Methodology 1.3. Chapter Outlines 2. Executive Summary 3. Introduction 3.1. The Central Dogma of Molecular Biology and Cell Cycle 3.2. DNA: Structure and Functions 3.3. Fundamentals of Epigenetics 3.3.1. Effect of Histone Modification on DNA Based Processes 3.3.2. Chromatin Structure Modification and its Enzymes 3.4. Histone Deacetylases (HDACs) 3.4.1. Classification of HDACs 3.4.2. Role of HDACs and HDAC Inhibitors in Cellular Processes 3.5. HDAC Inhibitors 3.5.1. Structure and Classification 3.5.2. Different Types of HDAC Inhibitors 3.5.3. Therapeutic Applications of HDAC Inhibitors 4. HDAC Inhibitors: Market Landscape 4.1. Chapter Overview 4.2. Development Pipeline of HDAC Inhibitors 4.3. Distribution by Phase of Development 4.4. Distribution by Therapeutic Area 4.5. Distribution by Class Specificity 4.6. Distribution by Type of Developer 4.7. Distribution by Geography 4.8. Active Industry Players 5. Drug Profiles: Marketed And Late-Stage HDAC Inhibitors 5.1. Chapter Overview 5.2. Company and Drug Profiles: Marketed and Phase III Molecules 5.2.1. Celgene Corporation 5.2.3. Novartis 5.2.4. Shenzhen Chipscreen Biosciences 5.2.5. Syndax Pharmaceuticals 5.3. Drug Profiles: Phase II Molecules 5.3.1. Abexinostat (PCI-24781) 5.3.2. CUDC-907 5.3.3. FRM-0334 (EVP-0334) 5.3.4. Givinostat (ITF2357) 5.3.5. Mocetinostat (MGCD103) 5.3.6. Pracinostat (SB939) 5.3.7. Resminostat (4SC-201) 5.3.8. SFX-01 5.3.9. SHAPE (SHP-141) 5.3.10. Tefinostat (CHR-2845) 6. Key Insights: Therapeutic Area, Class Specificity, Clinical Endpoints 6.1. Clinical Development Analysis: Class Specificity and Therapeutic Areas 6.2. Clinical Development Analysis: Developer Landscape 6.3. Clinical Development Analysis: Trial Endpoint Comparison 7. Market Forecast And Opportunity Analysis 7.1. Chapter Overview 7.2. Scope and Limitations 7.3. Forecast Methodology 7.4. Overall HDAC Inhibitors Market 7.5. HDAC Inhibitors Market: Individual Forecasts 7.5.1. Zolinza (Merck) 7.5.2. Istodax® (Celgene Corporation) 7.5.3. Beleodaq® (Onxeo) 7.5.4. Farydak® (Novartis) 7.5.5. Epidaza® (Shenzhen Chipscreen Biosciences) 7.5.6. Entinostat (Syndax Pharmaceuticals) 7.5.7. Abexinostat (Pharmacyclics) 7.5.8. CUDC-907 (Curis) 7.5.9. FRM-0334 (FORUM Pharmaceuticals) 7.5.10. Mocetinostat (Mirati Therapeutics) 7.5.11. Pracinostat (MEI Pharma) 7.5.12. Resminostat (4SC, Menarini, Yakult Honsha) 7.5.13. SFX-01 (Evgen Pharma) 7.5.14. SHP-141 (TetraLogic Pharmaceuticals) 7.5.15. Tefinostat (Chroma Therapeutics) 8. Publication Analysis 8.1. Chapter Overview 8.2. HDAC Inhibitors: Publications 8.3. Publication Analysis: Quarterly Distribution 8.4. Publication Analysis: Distribution by HDAC Inhibitor Class 8.5. Publication Analysis: Distribution by Drugs Studied 8.6. Publication Analysis: Distribution by Therapeutic Area 8.7. Publication Analysis: Distribution by Journals 8.8. Publication Analysis: Distribution by Phase of Development 8.9. Publication Analysis: Distribution by Type of Therapy 9. Social Media: Emerging Trends 9.1. Chapter Overview 9.1.1. Trends on Twitter 9.1.2. Trends on Facebook 10. Conclusion 10.1. The Pipeline is Healthy with Several Molecules in Preclinical Stages of Development 10.2. HDAC Inhibitors Cater to a Wide Spectrum of Disease Areas 10.3. Class Specific HDAC Inhibitors Have Been Explored for a More Targeted Approach 10.4. The Interest is Gradually Rising Amongst Both Industry and Non-Industry Players 10.5. Supported by a Robust Preclinical Pipeline, HDAC Inhibitors are Expected to Emerge as A Multi-Billion Dollar Market 11. Interview Transcripts 11.1. Chapter Overview 11.2. Dr. Simon Kerry, CEO, Karus Therapeutics 11.3. Dr. James Christensen, CSO and Senior VP, Mirati Therapeutics 11.4. Dr. Hyung J. Chun, MD, FAHA, Associate Professor of Medicine, Yale School of Medicine 12. Appendix 1: Tabulated Data 13. Appendix 2: List Of Companies And Organizations Companies Mentioned - 4SC - AACR - AbbVie - Acceleron Pharma - Acetylon Pharmaceuticals - Active Biotech - Agios Pharmaceuticals - ASH - Arno Therapeutics - Astellas Pharma - Bayer Schering Pharma - Baylor College of Medicine - BioMarin - Bionor Immuno - bluebird bio - Case Comprehensive Cancer Center - Celera Genomics - Celgene - Celleron Therapeutics - Centre de Recherche en Cancérologie - CETYA Therapeutics - CHDI Foundation - Chipscreen Biosciences - Chong Kun Dang Pharmaceutical - Chroma Therapeutics - Croix-Rousse Hospital - CrystalGenomics - Curis - DAC - Diaxonhit - DNA Therapeutics - Duke University - ECOG-ACRIN Cancer Research Group - Eddingpharm - Eisai - Epizyme - Errant Gene Therapeutics - European Calcified Tissue Society - Evgen Pharma - FORMA Therapeutics - FORUM Pharmaceuticals - Fudan University - Genentech - Genextra - Gilead - Gloucester Pharmaceuticals - GNT Biotech - GSK - Harvard Medical School - Henan Cancer Hospital - HUYA Biosciences - Ikerchem - Imperial College London - In2Gen - International Bone and Mineral Society - Israel Cancer Association and Bar Ilan University - Italfarmaco - Johnson and Johnson - Kalypsys - Karus Therapeutics - King's College, University of London - Kyoto Prefectural University of Medicine - Kyoto University - Kyowa Hakko Kirin - Leukemia and Lymphoma Society - Lymphoma Academic Research Organization - Massachusetts General Hospital - Mayo Clinic - MedImmune - MEI Pharma - Memorial Sloan-Kettering Cancer Center - Menarini - Merck - MethylGene - Mirati Therapeutics - Morphosys - Mundipharma-EDO - National Brain Research Centre - National Comprehensive Cancer Network - National Taiwan University - NCI - Novartis - NuPotential - Oceanyx Pharma - Oncolys Biopharma - Onxeo - Onyx - Orchid Pharma - Paterson Institute for Cancer Research - Pfizer - Pharmacyclics - Pharmion Corporation - Quimatryx - Quintiles - Repligen - Respiratorius - Roche - Rodin Therapeutics - Royal Veterinary College, University of London - Ruijin Hospital - S*Bio - Sarcoma Alliance for Research through Collaboration - Seattle Genetics - Servier Canada - Shape Pharmaceuticals - Sidney Kimmel Comprehensive Cancer Center - Sigma Tau Pharmaceuticals - Signal Rx - SpeBio - Spectrum Pharmaceuticals - Stanley Center for Psychiatric Research - Sutro Biopharma - Syndax Pharmaceuticals - Synovo GmbH - Taipei Medical University - TetraLogic Pharmaceuticals - University of Liverpool - University of Messina - University of Miami - Vanderbilt University School of Medicine - Ventana Medical Systems - Vilnius University - Yakult Honsha - Yale University - Yonsei University College of Medicine For more information about this report visit http://www.researchandmarkets.com/research/srvj3j/hdac_inhibitors


Unless mentioned otherwise, the experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. The fibroblast studies were performed on anonymized cells devoid of all identifiers. The data analysis involving urine orotic acid levels were performed under a protocol approved by the Institutional Review Board of Baylor College of Medicine. Urine samples were prepared by mixing 200 μl of with isotopic internal standard [15N ]orotic acid (Cambridge Isotope Laboratories). Orotic acid and orotidine were assayed on a Micromass Quattro mass spectrometer (Waters). HPLC was performed on a Waters ODS-AQ analytical column (150 mm × 2.0 mm internal diameter 5 μm bead size). Mobile phase was isocratic 0.05 M ammonium formate (pH 4.0). The MS–MS system was set at a flow rate of 0.2 ml min−1. The mass spectrometer was operated in electrospray ionization negative multiple-reaction monitoring mode. Nitrogen was used as nebulizer gas at a flow rate of 60–90 l h−1 and desolvation gas 500 l h−1. Other optimized mass spectrometer parameters were cone voltage 15 V, capillary 3,250 V and collision voltage 10 V. A metabolic network consisting of m metabolites and n reactions can be represented by a stoichiometric matrix S, where the entry S represents the stoichiometric coefficient of metabolite i in reaction j17. A constraint-based mode imposes mass balance, directionality and flux capacity constraints on the space of possible fluxes in the metabolic network’s reactions through a set of linear equations: where v stands for the flux vector for all of the reactions in the model (that is, the flux distribution). The exchange of metabolites with the environment is represented as a set of exchange (transport) reactions, enabling a pre-defined set of metabolites to be either taken up or secreted from the growth media. The steady-state assumption represented in equation (1) constrains the production rate of each metabolite to be equal to its consumption rate. Enzymatic directionality and flux capacity constraints define lower and upper bounds on the fluxes and are embedded in equation (2). In the following, flux vectors satisfying these conditions will be referred to as feasible steady-state flux distributions. The analyses were performed under the Roswell Park Memorial Institute Medium (RPMI)-1640m. We used the biomass function introduced in ref. 16. To determine the relation between ASS1 activity, CAD activity and growth rate, we used a generic human model and simulated the inactivation and activation of the reaction catalysed by ASS1. The inactivation was simulated by constraining the flux through the ASS1 reaction to zero, while the activation was simulated by enforcing increased positive flux through the ASS1 reaction up to the maximal possible flux, as computed via flux variability analysis17. At each such point, the maximal growth rate was computed via flux balance analysis17. Additionally, we estimated the flux through the reaction catalysed by CAD under maximal growth rate on the basis of 1,000 different feasible flux samples18. We next used genome-scale metabolic models for each of the NCI-60 cancer cell lines on the basis of their gene expression measurements10. In each cell-line model, we performed the following analyses. (1) We computed the production of each biomass component under both the inactivation and maximal activation of ASS1, as described above. The difference between the predicted production rates of each biomass component in the two states was then computed on the basis of the results of this optimization problem. (2) Similarly, we examined the flux change of each reaction under maximal biomass production in both the inactivation and activation states, as described above. In each of these states, we sampled the solution space and obtained 1,000 feasible flux distributions18. Focusing on the reactions associated with aspartate and glutamine, we computed the fold-change in flux rate together with its significance level. The latter was computed via a two-sided Wilcoxon rank-sum test. The largest fold-change among these reactions was predicted for the reactions catalysed by the CAD enzyme. For each tumour, normalized gene expression levels measured using RSEM19 were obtained from the RNASeqV2 data sets at the TCGA portal (https://tcga-data.nci.nih.gov/tcga/). Only matched tumour–normal pairs were used. For each tumour type, we computed the mean expression levels in the tumour and normal samples, added a pseudo-count of 1 to each mean and plotted the ratio between the means. Osteosarcoma or melanoma cell lines were seeded at 3 × 106 to 5 × 106 cells per 10 cm plate and incubated with either 4 mM l-glutamine, (α-15N, 98%, Cambridge Isotope Laboratories) for 24 h. Subsequently, cells were washed with ice-cold saline, lysed with 50% methanol in water and quickly scraped followed by three freeze–thaw cycles in liquid nitrogen. The insoluble material was pelleted in a cooled centrifuge (4 °C) and the supernatant was collected for consequent GC–MS analysis. Samples were dried under air flow at 42 °C using a Techne Dry-Block Heater with sample concentrator (Bibby Scientific) and the dried samples were treated with 40 μl of a methoxyamine hydrochloride solution (20 mg ml−1 in pyridine) at 37 °C for 90 min while shaking followed by incubation with 70 μl N,O-bis (trimethylsilyl) trifluoroacetamide (Sigma) at 37 °C for an additional 30 min. GC–MS. GC–MS analysis used a gas chromatograph (7820AN, Agilent Technologies) interfaced with a mass spectrometer (5975 Agilent Technologies). An HP-5ms capillary column 30 m × 250 μm × 0.25 μm (19091S-433, Agilent Technologies) was used. Helium carrier gas was maintained at a constant flow rate of 1.0 ml min−1. The GC column temperature was programmed from 70 to 150 °C via a ramp of 4 °C min−1, 250–215 °C via a ramp of 9 °C min−1, 215–300 °C via a ramp of 25 °C min−1 and maintained at 300 °C for an additional 5 min. The MS was by electron impact ionization and operated in full-scan mode from m/z = 30–500. The inlet and MS transfer line temperatures were maintained at 280 °C, and the ion source temperature was 250 °C. Sample injection (1 μl) was in splitless mode. Materials. Ammonium acetate (Fisher Scientific) and ammonium bicarbonate (Fluka) of LC–MS grade were used. Sodium salts of AMP, CMP, GMP, TMP and UMP were obtained from Sigma-Aldrich. Acetonitrile of LC grade was supplied from Merck. Water with resistivity 18.2 MΩ was obtained using Direct 3-Q UV system (Millipore). Extract preparation. The obtained samples were concentrated in speedvac to eliminate methanol, and then lyophilized tol dryness, re-suspended in 200 μl of water and purified on polymeric weak anion columns (Strata-XL-AW 100 μm (30 mg ml−1, Phenomenex)) as follows. Each column was conditioned by passing 1 ml of methanol, then 1 ml of formic acid/methanol/water (2/25/73) and equilibrated with 1 ml of water. The samples were loaded, and each column was washed with 1 ml of water and 1 ml of 50% methanol. The purified samples were eluted with 1 ml of ammonia/methanol/water (2/25/73) followed by 1 ml of ammonia/methanol/water (2/50/50) and then collected, concentrated in speedvac to remove methanol and lyophilized. Before LC–MC analysis, the obtained residues were re-dissolved in 100 μl of water and centrifuged for 5 min at 21,000 g to remove insoluble material. LC–MS analysis. The LC–MS/MS instrument consisted of an Acuity I-class UPLC system (Waters) and Xevo TQ-S triple quadruple mass spectrometer (Waters) equipped with an electrospray ion source and operated in positive ion mode was used for analysis of nucleoside monophosphates. MassLynx and TargetLynx software (version 4.1, Waters) were applied for the acquisition and analysis of data. Chromatographic separation was done on a 100 mm × 2.1 mm internal diameter, 1.8-μm UPLC HSS T3 column equipped with 50 mm × 2.1 mm internal diameter, 1.8-μm UPLC HSS T3 pre-column (both Waters Acuity) with mobile phases A (10 mM ammonium acetate and 5 mM ammonium hydrocarbonate buffer, pH 7.0 adjusted with 10% acetic acid) and B (acetonitrile) at a flow rate of 0.3 ml min−1 and column temperature 35 °C. A gradient was used as follows: for 0–6 min the column was held at 0% B, then 6–6.5 min a linear increase to 100% B, 6.5–7.0 min held at 100% B, 7.0–7.5 min back to 0% B and equilibration at 0% B for 2.5 min. Samples kept at 8 °C were automatically injected in a volume of 3 μl. For mass spectrometry, argon was used as the collision gas with a flow of 0.25 ml min−1. The capillary voltage was set to 2.90 kV, source temperature 150 °C, desolvation temperature 350 °C, desolvation gas flow 650 l min−1. Analytics were detected using multiple-reaction monitoring and applying the parameters listed in Supplementary Table 3. Single-molecule FISH (smFISH) was performed with probe libraries for Ass1 (74 probes, sequences described in Supplementary Methods) and Ki67 (96 probes20). Imaging was performed as previously described20. smFISH images were filtered with a Laplacian of Gaussian filter of size 15 pixels and standard deviation of 1.5 pixels. Each image is a maximum projection of ten stacks spaced 0.3 μm apart in the z-direction. Each dot in these figures represents a cell and the quantification dots were counted on eight z-stacks spaced 0.3 μm apart (total tissue volume 2.4 μm). Proximity ligation assay. The assay was performed as published21 using Sigma Aldrich kit (DUO 92004-30-RXN). Antibodies used for detection were diluted in PBS: ASS1 (1:200, ab170952, abcam), citrin (1:100, H00010165-M01, clone 4F4, abnova) and anti-CAD (1:100, ab40800, abcam). All cell lines were authenticated. Melanoma cell lines LOX IMVI and MALME-3m and osteosarcoma cell lines MNNG/HOS and U2OS were purchased from American Type Culture Collection (ATCC) and cultured using standard procedures in a 37 °C humidified incubator with 5% CO in RPMI (Invitrogen) supplemented with 10–20% heat-inactivated fetal bovine serum, 10% pen-strep and 2 mM glutamine. All cells are tested routinely for mycoplasma using a Mycoplasma EZ-PCR test kit (20–700-20, Biological Industries). MTT assay. Cells were seeded in 12-well plates at 4 × 104 to 8 × 104 cells per well in a triplicate. After 6 h for adherence of the cells, 0.1 mg ml-1 of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide) (CAS 298-93-1, Calbiochem) in PBS was added to each cell type, starting at 0 h, in 24 h intervals. Deoxynucleotide Set (DNTP100-1KT, Sigma-Aldrich) was added to the cells’ medium first after adherence and then daily at a final concentration of 10 μM. Cells were lysed with dimethylsulfoxide (DMSO). Absorbance was measured at 570 nm. Crystal violet staining. Cells were seeded in 12-well plates at 40,000–100,000 cells per well in a triplicate. Time 0 was calculated as the time the cells became adherent, which was after about 6 h from plating. For each time point, cells were washed with PBS X1 and fixed in 4% PFA (in PBS). Cells were then stained with 0.1% Crystal Violet (C0775, Sigma-Aldrich) for 20 min (1 ml per well) and washed with water. Cells were then incubated with 10% acetic acid for 20 min with shaking. Extract was then diluted 1:4 in water and absorbance was measured at 590 nm every 24 h. Western blotting. Cells were lysed in RIPA (Sigma-Aldrich) and 0.5% protease inhibitor cocktail (Calbiochem). After centrifugation, the supernatant was collected and protein content was evaluated by the Bradford assay. One hundred micrograms from each sample under reducing conditions were loaded into each lane and separated by electrophoresis on a 10% SDS polyacrylamide gel. After electrophoresis, proteins were transferred to Immobilon transfer membranes (Tamar). Non-specific binding was blocked by incubation with TBST (10 mM Tris–HCl (pH 8.0), 150 mM NaCl, 0.1% Tween 20) containing 3% albumin from bovine serum for 1 h at 25 °C. Membranes were subsequently incubated with antibodies against ASS1 (1:500, sc-99178, Santa Cruz Biotechnology)22, p97 (1:10,000, PA5-22257, Thermo Scientific), GAPDH (1:1,000, 14C10, 2118, Cell Signaling)23, CAD (1:1,000, ab40800, abcam)24, phospho-CAD (Ser1859) (1:1,000, 12662, Cell Signaling)15, p70 S6 Kinase (1:1,000, 9202, Cell Signaling) and phospho-p70 S6 Kinase (Ser371) (1:1,000, 9208, Cell Signaling)25. Antibody was detected using peroxidase-conjugated AffiniPure goat anti-rabbit IgG or goat anti-mouse IgG (Jackson ImmunoResearch) and enhanced chemiluminescence western blotting detection reagents (EZ-Gel, Biological Industries). Gels were quantified by Gel Doc XR+ (BioRad) and analysed by ImageLab 4.1 software (BioRad). The band area was calculated by the intensity of the band. The obtained value was then divided by the value obtained from the loading control. RNA extraction and complementary DNA (cDNA) synthesis. RNA was extracted from cells by using PerfectPure RNA Cultured Cell Kit (5′-PRIME). cDNA was synthesized from 1 μg RNA by using qScript cDNA Synthesis Kit (Quanta). Quantitative PCR. Detection of ASS1 on cDNAs (see above) was performed using SYBR green PCR master mix (Tamar) and the required primers. Primer sequences were as follows. Human ASS1: forward, 5′-TTATAACCTGGGATGGGCACC-3′; reverse, 5′-TGGACATAGCGTCTGGGATTG-3′. Human HPRT: forward, 5′-ATTGACACTGGCAAAACAATGC-3′; reverse,: 5′-TCCAACACTTCGTGGGGTCC-3′. Analysis used StepOne real-time PCR technology (Applied Biosystems). Cells were seeded in 12-well plates at 30,000 cells per well, or in 10 cm plates at 106 cells per plate, in triplicate. The following day, cells were transfected with either 20 pmol or 600 pmol siRNA siGenome SMARTpool targeted to Citrin mRNA (M-007472-01, Thermo Scientific), respectively. Transfection was performed with Lipofectamine 2000 Reagent (11668-019, Invitrogen) in the presence of Opti-MEM I Reduced Serum Medium (31985-062, Invitrogen). Four hours after transfection, medium was replaced and experiments were performed starting 24 h after transfection. Over-expression. Cells were infected with pLenti3.3/TR and with pLenti6.3/TO/V5-DEST-based lentiviral vector with or without the human ASS1 transcript. Transduced cells were selected with 1 mg ml−1 Geneticin and with 7.5 μg ml−1 Blasticidin for each plasmid, respectively. When induction of expression was needed, cells were added with 10 μg ml−1 tetracycline/doxycycline. Cells were infected with pLKO-based lentiviral vector with or without the human ASS1 short hairpin RNA (shRNA) encoding one or two separate sequences combined (RHS4533-EG445, GE Healthcare, Dharmacon). Transduced cells were selected with 2 μg ml−1 puromycin. U2OS human osteosarcoma cell line was seeded in 6-well plates at 80,000 cells per well. The following day, cells were treated with either 100 nM rapamycin (R0395, Sigma-Aldrich) or with 10 μM 5FU (F6627, Sigma-Aldrich) in regular medium, with 10% dialysed FCS-arginine-free-RPMI (06-1104-34-1A, Biological Industries) or with both arginine-depleted medium and one of these drugs. Rapamycin and 5FU were renewed into the medium every day, whereas fresh arginine-free medium was supplemented twice a week. According to the approved IACUC protocol 17270415-2, tumours did not exceed the limits of more than 10% of the animal weight and were not longer than 1.5 cm in length in any dimension (Supplementary Fig. 2). Ten million MALME-3m melanoma cells suspended in 500 μl PBS with 5% Matrigel (4132053 Corning) were injected subcutaneously to 8- to 12-week-old male SCID mice that were purchased from Harlan. There were 22 SCID mice, from which 5 or 6 were used for each cell line in each of the three experiments performed. No randomization was used. Mice were monitored for survival and tumour burden twice a week by a veterinarian investigator who was blinded to the expected outcome. Tumours were measured using a calliper. After euthanization, tumours were removed and incubated in medium containing [15N]glutamine for 6 h followed by GC–MS analysis. Tumour size was calculated as published26. We used genome-scale metabolic models of NCI-60 cancer cell lines. The reconstruction method (on the basis of methods termed PRIME10 requires several key inputs: (1) the generic human model7; (2) gene expression data for each cell line19; and (3) growth rate measurements (available at the NCI website: https://dtp.cancer.gov/discovery_development/nci-60/cell_list.htm). The algorithm then reconstructs a specific metabolic model for each sample by modifying the upper bounds of reactions in accordance with the expression of the individual gene microarray values. Specifically, the model reconstruction process is as follows. (1) Decompose reversible reactions into unidirectional forward and backward reactions. (2) Evaluate the correlation between the expression of each reaction in the network and the measured growth rate. The expression of a reaction is defined as the mean over the expression of the enzymes catalysing it. (3) Modify upper bounds on reactions demonstrating significant correlation to the growth rate (after correcting for multiple hypothesis using false discovery rate) in a manner that is linearly related to expression value. All statistical analyses were performed using Tukey’s honest significant difference test or independent-samples Student’s t-test of multiple or two groups, respectively. Log-transformed data were used where differences in variance were significant and variances were correlated with means. The sample size was chosen in advance on the basis of common practice of the described experiment and is mentioned for each experiment. No statistical methods were used to predetermine sample size. Each experiment was conducted with biological and technical replicates and repeated at least three times unless specified otherwise. On the basis of pre-established criteria, individual outlier data points that were more than 2 standard deviations away from the mean were excluded from the data analysis. Statistical tests were done using Statsoft’s STATISTICA, version 10. All error bars are standard errors. P < 0.05 was considered significant in all analyses (*P < 0.05, **P < 0.005, ***P < 0.0005). Kaplan–Meier. For each cancer type, the Kaplan–Meier plot indicates the survival rates of the four different groups of patients as labelled. We analysed the cancer types for which there were sufficient survival data.


Goodell M.A.,Baylor College of Medicine | Rando T.A.,Stanford University | Rando T.A.,Center for Regenerative Rehabilitation
Science | Year: 2015

Research into stem cells and aging aims to understand how stem cells maintain tissue health, what mechanisms ultimately lead to decline in stem cell function with age, and how the regenerative capacity of somatic stem cells can be enhanced to promote healthy aging. Here, we explore the effects of aging on stem cells in different tissues. Recent research has focused on the ways that genetic mutations, epigenetic changes, and the extrinsic environmental milieu influence stem cell functionality over time.We describe each of these three factors, the ways in which they interact, and how these interactions decrease stem cell health over time.We are optimistic that a better understanding of these changes will uncover potential strategies to enhance stem cell function and increase tissue resiliency into old age.


Molofsky A.V.,University of California at San Francisco | Deneen B.,Baylor College of Medicine
GLIA | Year: 2015

Astrocytes are the predominant cell type in the brain and perform key functions vital to CNS physiology, including blood brain barrier formation and maintenance, synaptogenesis, neurotransmission, and metabolic regulation. To fully understand the contributions of astrocytes to brain function, it will be important to bridge the existing gap between development and physiology. In this review, we provide an overview of Astrocyte development, including recent insights into molecular mechanisms of astrocyte specification, regional patterning and proliferation. This developmental perspective is complemented with recent findings that describe the functional maturation of astrocytes and their prospective diversity. Future progress in understanding Astrocyte development will depend on the development of astrocyte- stage specific markers and tools for manipulating astrocytes without affecting neuron production. Ultimately, a mechanistic approach to Astrocyte development will be crucial to developing new treatments for the many neurodevelopmental, neurodegenerative, neuroimmune, and neoplastic diseases involving astrocyte dysfunction. © 2015 Wiley Periodicals, Inc.


Healy C.M.,Texas Childrens Hospital | Healy C.M.,Baylor College of Medicine | Pickering L.K.,Centers for Disease Control and Prevention
Pediatrics | Year: 2011

Development of safe and effective vaccines is one the greatest medical triumphs. However, despite high immunization rates in the United States, 85% of health care providers (HCPs) will have a parent refuse a vaccine for his or her child each year. HCPs have the greatest influence on a parent's decision to vaccinate his or her child. To effectively communicate with vaccine-hesitant parents, HCPs must first understand the concerns of parents regarding immunization and understand influences that can lead to misinformation about the safety and effectiveness of vaccines. HCPs should establish an open, nonconfrontational dialogue with vaccine-hesitant parents at an early stage and provide unambiguous, easily comprehensible answers about known vaccine adverse events and provide accurate information about vaccination. Personal stories and visual images of patients and parents affected by vaccine-preventable diseases and reports of disease outbreaks serve as useful reminders of the need to maintain high immunization rates. Ongoing dialogue including provider recommendations may successfully reassure vaccine-hesitant parents that immunization is the best and safest option for their child. Copyright © 2011 by the American Academy of Pediatrics.


El-Serag H.B.,Baylor College of Medicine | Sweet S.,Research Evaluation Unit | Winchester C.C.,Research Evaluation Unit | Winchester C.C.,University of Aberdeen | Dent J.,Royal Adelaide Hospital
Gut | Year: 2014

Objective: To update the findings of the 2005 systematic review of population-based studies assessing the epidemiology of gastro-oesophageal reflux disease (GERD). Design: PubMed and Embase were screened for new references using the original search strings. Studies were required to be population-based, to include ≥200 individuals, to have response rates ≥50% and recall periods <12 months. GERD was defined as heartburn and/or regurgitation on at least 1 day a week, or according to the Montreal definition, or diagnosed by a clinician. Temporal and geographic trends in disease prevalence were examined using a Poisson regression model. Results: 16 studies of GERD epidemiology published since the original review were found to be suitable for inclusion (15 reporting prevalence and one reporting incidence), and were added to the 13 prevalence and two incidence studies found previously. The range of GERD prevalence estimates was 18.1%-27.8% in North America, 8.8%-25.9% in Europe, 2.5%-7.8% in East Asia, 8.7%-33.1% in the Middle East, 11.6% in Australia and 23.0% in South America. Incidence per 1000 person-years was approximately 5 in the overall UK and US populations, and 0.84 in paediatric patients aged 1-17 years in the UK. Evidence suggests an increase in GERD prevalence since 1995 (p<0.0001), particularly in North America and East Asia. Conclusions: GERD is prevalent worldwide, and disease burden may be increasing. Prevalence estimates show considerable geographic variation, but only East Asia shows estimates consistently lower than 10%.


Long E.O.,National Institute of Allergy and Infectious Diseases | Sik Kim H.,National Institute of Allergy and Infectious Diseases | Sik Kim H.,University of Ulsan | Liu D.,National Institute of Allergy and Infectious Diseases | And 3 more authors.
Annual Review of Immunology | Year: 2013

Understanding how signals are integrated to control natural killer (NK) cell responsiveness in the absence of antigen-specific receptors has been a challenge, but recent work has revealed some underlying principles that govern NK cell responses. NK cells use an array of innate receptors to sense their environment and respond to alterations caused by infections, cellular stress, and transformation. No single activation receptor dominates; instead, synergistic signals from combinations of receptors are integrated to activate natural cytotoxicity and cytokine production. Inhibitory receptors for major histocompatibility complex class I (MHC-I) have a critical role in controlling NK cell responses and, paradoxically, in maintaining NK cells in a state of responsiveness to subsequent activation events, a process referred to as licensing. MHC-I-specific inhibitory receptors both block activation signals and trigger signals to phosphorylate and inactivate the small adaptor Crk. These different facets of inhibitory signaling are incorporated into a revocable license model for the reversible tuning of NK cell responsiveness. © Copyright 2013 by Annual Reviews. All rights reserved.


Dabaghian Y.,Baylor College of Medicine | Brandt V.L.,Baylor College of Medicine | Frank L.M.,University of California at San Francisco
eLife | Year: 2014

The role of the hippocampus in spatial cognition is incontrovertible yet controversial. Place cells, initially thought to be location-specifiers, turn out to respond promiscuously to a wide range of stimuli. Here we test the idea, which we have recently demonstrated in a computational model, that the hippocampal place cells may ultimately be interested in a space's topological qualities (its connectivity) more than its geometry (distances and angles); such higher-order functioning would be more consistent with other known hippocampal functions. We recorded place cell activity in rats exploring morphing linear tracks that allowed us to dissociate the geometry of the track from its topology. The resulting place fields preserved the relative sequence of places visited along the track but did not vary with the metrical features of the track or the direction of the rat's movement. These results suggest a reinterpretation of previous studies and new directions for future experiments. Copyright © 2014, Dabaghian et al.


Grant
Agency: Cordis | Branch: H2020 | Program: RIA | Phase: PHC-02-2015 | Award Amount: 5.70M | Year: 2016

Despite of their great promise, high-throughput technologies in cancer research have often failed to translate to major therapeutic advances in the clinic. One challenge has been tumour heterogeneity, where multiple competing subclones coexist within a single tumour. Genomic heterogeneity renders it difficult to identify all driving molecular alterations, and thus results in therapies that only target subsets of aggressive tumour cells. Another challenge lies in the integration of multiple types of molecular data into mathematical disease models that can make actionable clinical statements. We aim to develop predictive computational technology that can exploit molecular and clinical data to improve our understanding of disease mechanisms and to inform clinicians about optimized strategies for therapeutic intervention. We propose to focus on prostate cancer, a leading cause of cancer death amongst men in Europe, but also prone to over-treatment. Our approach combines the exploitation of genomic, transcriptomic, proteomic, and clinical data in primary and metastatic tumours, prospective cohorts of well characterized prostate cancer patients, drug screenings in cell lines, and the use of the Watson technology, a last generation cognitive computer developed at IBM. The translational objective of this study is to develop technology for identifying disease mechanisms and produce treatment recommendations for individual patients based on a therapeutic biomarker panel. The proposed software framework will be accessible through a graphical interface that will facilitate its dissemination and use by researchers, clinicians, and biomedical industries. The framework will provide intuitive tools to deposit, share, analyze, and visualize molecular and clinical data; as well as to infer prognosis, elucidate implicated mechanisms and recommend therapy accordingly. This software framework will serve as a proof of concept for future development by industrial partners in Europe.


Schlomer B.J.,Baylor College of Medicine | Copp H.L.,University of California at San Francisco
Journal of Urology | Year: 2014

Purpose Secondary data analysis is the use of data collected for research by someone other than the investigator. In the last several years there has been a dramatic increase in the number of these studies being published in urological journals and presented at urological meetings, especially involving secondary data analysis of large administrative data sets. Along with this expansion, skepticism for secondary data analysis studies has increased for many urologists. Materials and Methods In this narrative review we discuss the types of large data sets that are commonly used for secondary data analysis in urology, and discuss the advantages and disadvantages of secondary data analysis. A literature search was performed to identify urological secondary data analysis studies published since 2008 using commonly used large data sets, and examples of high quality studies published in high impact journals are given. We outline an approach for performing a successful hypothesis or goal driven secondary data analysis study and highlight common errors to avoid. Results More than 350 secondary data analysis studies using large data sets have been published on urological topics since 2008 with likely many more studies presented at meetings but never published. Nonhypothesis or goal driven studies have likely constituted some of these studies and have probably contributed to the increased skepticism of this type of research. However, many high quality, hypothesis driven studies addressing research questions that would have been difficult to conduct with other methods have been performed in the last few years. Conclusions Secondary data analysis is a powerful tool that can address questions which could not be adequately studied by another method. Knowledge of the limitations of secondary data analysis and of the data sets used is critical for a successful study. There are also important errors to avoid when planning and performing a secondary data analysis study. Investigators and the urological community need to strive to use secondary data analysis of large data sets appropriately to produce high quality studies that hopefully lead to improved patient outcomes. © 2014 by AMERICAN UROLOGICAL ASSOCIATION EDUCATION AND RESEARCH, INC.


Hoersch D.,University of California at San Francisco | Roh S.-H.,Baylor College of Medicine | Chiu W.,Baylor College of Medicine | Kortemme T.,University of California at San Francisco
Nature Nanotechnology | Year: 2013

Natural protein assemblies have many sophisticated architectures and functions, creating nanoscale storage containers, motors and pumps. Inspired by these systems, protein monomers have been engineered to self-assemble into supramolecular architectures including symmetrical, metal-templated and cage-like structures. The complexity of protein machines, however, has made it difficult to create assemblies with both defined structures and controllable functions. Here we report protein assemblies that have been engineered to function as light-controlled nanocontainers. We show that an adenosine-5′-triphosphate-driven group II chaperonin, which resembles a barrel with a built-in lid, can be reprogrammed to open and close on illumination with different wavelengths of light. By engineering photoswitchable azobenzene-based molecules into the structure, light-triggered changes in interatomic distances in the azobenzene moiety are able to drive large-scale conformational changes of the protein assembly. The different states of the assembly can be visualized with single-particle cryo-electron microscopy, and the nanocages can be used to capture and release non-native cargos. Similar strategies that switch atomic distances with light could be used to build other controllable nanoscale machines. © 2013 Macmillan Publishers Limited.


Isis Pharmaceuticals synthesized all ASOs as previously described15. All ASOs consist of 20 chemically modified nucleotides (MOE gapmer). The central gap of 10 deoxynucleotides is flanked on its 5′ and 3′ sides by five 2′-O-(2-methoxyethyl) (MOE)-modified nucleotides. The backbone modifications from 5′ to 3′ are: 1-PS, 4-PO, 10-PS, 2-PO and 2-PS. Phosphorothioate (PS) modifications were replaced with native phosphodiester (PO) in the MOE wings to reduce the overall PS content of the ASO, since a fully modified PS ASO is not necessary for robust CNS activity15. The sequence of each ASO is listed in Extended Data Table 1. The first MeCP2-overexpressing mice were MECP2-TG mice on a FVB/N pure background19. These mice show normal locomotion in the open field and an increase in vertical activity, which was interpreted as less anxiety, but there was no difference in anxiety-like behaviour in the light–dark test. Mice on a pure FVB/N background, however, develop premature retinal degeneration, which can confound the interpretation of some behavioural tests31. To overcome issues related to a pure inbred strain, our laboratory characterized F hybrid MECP2-TG mice (FVB/N × C57Bl/6 or FVB/N × 129S6/SvEv), and showed that these mice display several phenotypes as early as 7 weeks of age20, including increased anxiety and a trend towards hypoactivity. Therefore, for both the genetic rescue and the ASO treatment experiments, we decided to continue using F hybrid MECP2-TG mice. For experiments related to the validation of the Flox;TG mouse model (Extended Data Figs 1 and 2), we generated F hybrid animals by mating male MECP2-TG1 mice on a pure FVB/N background19 to female mice heterozygous for the Mecp2lox allele (Flox) (B6;129S4-Mecp2tm1Jae/Mmucd obtained from MMRRC, and backcrossed to C57Bl/6J for more than 10 generations; see also scheme in Extended Data Fig. 1a). For experiments related to conditional rescue of MECP2-TG mice (Figs 1 and 2), we first mated Flox C57Bl/6 females with C57Bl/6 Cre-ER males (B6.Cg-Tg(UBC-cre/ERT2)1Ejb/J obtained from Jackson Laboratories). The F Flox;Cre females were then mated to FVB/N MECP2-TG1 males to generate the F hybrid, triple-transgenic Flox;TG;Cre male mice and their control littermates (Flox and Flox;TG) (see scheme in Fig. 1a). For studies related to MECP2-ASOs, we generated F hybrid animals by mating FVB/N MECP2-TG1 females and wild-type 129S6/SvEv male mice (Taconic Farms). For the EEG experiment (Fig. 4b), we used MECP2-TG1 males on a pure FVB/N background. We routinely used mouse littermates as controls for our experiments. Throughout the experiments, mice were maintained in a temperature-controlled, AALAS-certified level 3 facility on a 12 h light–dark cycle. Food and water were given ad libitum. All procedures to maintain and use these mice were approved by the Institutional Animal Care and Use Committee for Baylor College of Medicine. Animals were randomly selected using Excel software to generate a table of random numbers for all genetic and treatment studies. For all experiments, the individuals performing the behavioural and electrophysiological studies were blinded to the genotype or treatment. Brains were dissected and homogenized in cold lysis buffer (20 mM Tris-HCl, pH 8.0, 180 mM NaCl, 0.5% NP-40, 1 mM EDTA and Complete Protease Inhibitor, Roche). Lysates were rotated for 20 min at 4 °C. After centrifugation at 4 °C, the supernatant was mixed with NuPAGE sample buffer, heated for 5 min at 95 °C, and run on a NuPAGE 4–12% Bis-Tris gradient gel with MES SDS running buffer (NuPAGE). Proteins were transferred to a nitrocellulose membrane using NuPAGE Transfer Buffer for 1.5 h at 4 °C. The membrane was blocked for 1 h with 5% milk in TBS with 2% Tween-20 (TBST) followed by overnight incubation with primary antibody at 4 °C. After four 10-min washes with TBST, the membrane was incubated with secondary antibody for 1–2 h at room temperature. Horseradish peroxidase (HRP) was detected using SuperSignal West Dura kit, Thermo Scientific. Western blot images were acquired by ImageQuant LAS 4000 (GE Healthcare) and quantified by an ImageJ software package. Primary antibodies: rabbit antiserum raised against the amino terminus of MeCP2 (1:5,000; Zoghbi laboratory), mouse anti-GAPDH 6C5 (1:20,000; Advanced Immunochemicals, 2-RGM2). Secondary antibodies: goat anti-rabbit HRP (1:20,000; Bio-Rad), donkey anti-mouse HRP (1:20,000; Jackson ImmunoResearch Labs, 715-035-150). The subset of mice for RT–qPCR was selected randomly, using Excel software to generate a table of random numbers. No significant differences on behavioural measurements were found between the selected mice and the rest (per genotype group). Total RNA from mouse brain tissue was extracted using miRNeasy minikit (Qiagen), and 1 μg of total RNA was used to synthesize cDNA by Quantitect reverse transcription kit (Qiagen). For human lymphoblasts, 2 μg of total RNA was used to synthesize cDNA. RT–qPCR was performed in a CFX96 Real-Time System (Bio-Rad) using PerfeCTa SYBR Green Fast Mix (Quanta Biosciences). Sense and antisense primers were selected to be located on different exons, and the RNA was treated with DNase, to avoid false-positive results caused by DNA contamination. The specificity of the amplification products was verified by melting curve analysis. All RT–qPCR reactions were conducted in technical triplicates and the results were averaged for each sample, normalized to Hprt levels, and analysed using the comparative ΔΔC method. The following primers were used in the RT–qPCR reactions: MECP2 (common to human and mouse): 5′-TATTTGATCAATCCCCAGGG-3′ (sense), 5′-CTCCCTCTCCCAGTTACCGT-3′ (antisense); MECP2 (human-specific): 5′-GATGTGTATTTGATCAATCCC-3′ (sense), 5′-TTAGGGTCCAGGGATGTGTC-3′ (antisense); Mecp2-e1 (mouse-specific): 5′-AGGAGAGACTGGAGGAAAAGTC-3′ (sense), 5′-CTTAAACTTCAGTGGCTTGTCTCTG-3′ (antisense); Mecp2-e2 (mouse-specific): 5′-CTCACCAGTTCCTGCTTTGATGT-3′ (sense), 5′-CTTAAACTTCAGTGGCTTGTCTCTG-3′ (antisense); MECP2-e1 (human-specific): 5′-AGGAGAGACTGGAAGAAAAGTC-3′ (sense), 5′-CTTGAGGGGTTTGTCCTTGA-3′ (antisense); MECP2-e2 (human-specific): 5′-CTCACCAGTTCCTGCTTTGATGT-3′ (sense), 5′-CTTGAGGGGTTTGTCCTTGA-3′ (antisense); Hprt (mouse-specific): 5′-CGGGGGACATAAAAGTTATTG-3′ (sense), 5′-TGCATTGTTTTACCAGTGTCAA-3′ (antisense); HPRT (human-specific): 5′-GACCAGTCAACAGGGGACAT-3′ (sense), 5′-CCTGACCAAGGAAAGCAAAG-3′ (antisense); Sst: 5′-CCCAGACTCCGTCAGTTTCT-3′ (sense), 5′-GAAGTTCTTGCAGCCAGCTT-3′ (antisense); Crf: 5′-TACCAAGGGAGGAGAAGAGA-3′ (sense), 5′-GATCAGAACCGGCTGAGGT-3′ (antisense); Npbwr1: 5′-TCTCTTACTTCATCACCAGCC-3′ (sense), 5′-GCATAGAGGAAAGGGTTGAG-3′ (antisense); Gamt: 5′-GGATTATTGAGTGCAATGATGG-3′ (sense), 5′-TCAAGGGAACAACCTTATGTG-3′ (antisense); Agrp: 5′-TCAAGAAGACAACTGCAGAC-3′ (sense), 5′-TCTGTGGATCTAGCACCTC-3′ (antisense); Rcor2: 5′-ACCCGAAGTCGAACTAGTG-3′ (sense), 5′-CTAGTTCATCACTGTCTTCTTTG-3′ (antisense); Prl2c2: 5′-CATGAGCACCATGCTTCAG-3′ (sense), 5′-GCGAGCATCTTCATTGTCAG-3′ (antisense). Animals were anaesthetized with a mix of ketamine 37.6 mg ml−1, xylazine 1.92 mg ml−1 and acepromazine 0.38 mg ml−1, and transcardially perfused with 20 ml PBS followed by 100 ml of cold PBS-buffered 4% paraformaldehyde (PFA). The brains were removed and post-fixed overnight in 4% PFA. Next, brains were cryoprotected in 4% PFA with 30% sucrose at 4 °C for two additional days and embedded in Optimum Cutting Temperature (O.C.T., Tissue-Tek). Free-floating 40-μm brain sections were cut using a Leica CM3050 cryostat and collected in PBS. The sections were blocked for 1 h in 2% normal goat serum, 0.3% Triton X-100 in PBS at room temperature. Sections were then incubated overnight at 4 °C with either rabbit anti-MeCP2 antibody (1:1,000; Cell Signaling) or rabbit anti-ASO antibody (1:10,000; Isis Pharmaceuticals). The sections were washed three times for 10 min with PBS, and incubated for 3 h at room temperature with goat anti-rabbit antibody (1:500; Alexa Fluor 488, Invitrogen, A-11034). Sections were washed again three times for 10 min with PBS and mounted onto glass slides with Vectashield mounting medium with DAPI (Vector Laboratories). Tamoxifen (Sigma-Aldrich, T5648) was dissolved to 20 mg ml−1 in peanut oil, aliquotted and frozen at −20 °C until use. Peanut oil was also used as a vehicle. Tamoxifen or vehicle was injected intraperitoneally at a dose of 100 mg kg−1, three alternative days a week for 4 weeks (as described in Fig. 1b). All data acquisition and analyses were carried out by an individual blinded to the genotype and treatment. All behavioural studies were performed during the light period. Mice were habituated to the test room for 1 h before each test. At least one day was given between assays for the mice to recover. All the tests were performed as previously described23 with few modifications. After habituation in the test room (150 lx, 60 dB white noise), mice were placed in the centre of an open arena (40 × 40 × 30 cm), and their behaviour was tracked by laser photobeam breaks for 30 min. General locomotor activity was automatically analysed using AccuScan Fusion software (Omnitech) by counting the number of times mice break the laser beams (activity counts). In addition, rearing activity, the time spent in the centre of the arena, entries to the centre and distance travelled were analysed. In this study, we found that MECP2-TG mice are hypoactive in the open field test. In contrast, in ref. 20, MECP2-TG mice show a non-significant trend towards hypoactivity. This difference might be the result of our study assessing locomotor activity by measuring activity counts, and in ref. 20 by measuring the distance travelled, which is calculated by the software from the activity counts. After habituation in the test room (700 lx, 60 dB white noise), mice were placed in the centre part of the maze facing one of the two open arms. Mouse behaviour was video-tracked for 10 min, and the time mice spent in the open arms and the entries to the open arms, as well as the distance travelled in the open arms, were recorded and analysed using ANY-maze system (Stoelting). After habituation in the test room (700 lx, 60 dB white noise), motor coordination was measured using an accelerating rotarod apparatus (Ugo Basile). Mice were tested for two consecutive days, four trials each, with an interval of 60 min between trials to rest. Each trial lasted for a maximum of 10 min, and the rod accelerated from 4 to 40 r.p.m. in the first 5 min. The time that it took for each mouse to fall from the rod (latency to fall) was recorded. The three-chamber apparatus consists of a clear Plexiglas box (24.75 × 16.75 × 8.75) with removable partitions that separate the box into three chambers. In both the left and right chambers a cylindrical wire cup was placed with the open side down. Age- and gender-matched C57Bl/6 mice were used as novel partners. Two days before the test, the novel partner mice were habituated to the wire cups (3 inches diameter by 4 inches in height) for 1 h per day. After habituation in the test room (700 lx, 60 dB white noise), mice were placed in the central chamber and allowed to explore the three chambers for 10 min (habituation phase). Next, a novel partner mouse was placed into a wire cup in either the left or the right chamber. An inanimate object was placed as control in the wire cup of the opposite chamber. The location of the novel mouse was randomized between left and right chambers across subjects to control for side preference. The mouse tested was allowed to explore again for an additional 10 min. The time spent investigating the novel partner (defined by rearing, sniffing or pawing at the wire cup) and the time spent investigating the inanimate object were measured manually. Mice were euthanized under anaesthesia and the hippocampi were quickly dissected over ice. Total RNA of 30 hippocampal samples (three biological replicates of each genotype from three experiments) was extracted using miRNeasy minikit (Qiagen), following the manufacturer’s instructions. Isolated RNA was eluted in RNase-free water and submitted to the Genomic and RNA Profiling Core at Baylor College of Medicine. Sample quality checks using the NanoDrop spectrophotometer and Agilent Bioanalyzer 2100 were conducted. Then Illumina TruSeq RNA library preparation protocol was used as follows. A double-stranded DNA library was created using 250 ng of total RNA (measured by picogreen), preparing the fragments for hybridization onto a flow-cell. First, cDNA was created using the fragmented 3′ poly(A) selected portion of total RNA and random primers. During second-strand synthesis, dTTP is replaced with dUTP, which quenches the second strand during amplification, thereby achieving strand specificity. Libraries were created from the cDNA by first blunt-ending the fragments, attaching an adenosine to the 3′-end and finally ligating unique adapters to the ends. The ligated products were then amplified using 15 cycles of PCR. The resulting libraries were quantified using the NanoDrop spectrophotometer and fragment size assessed with the Agilent Bioanalyzer. A qPCR quantification was performed on the libraries to determine the concentration of adaptor ligated fragments using Applied Biosystems ViiA7 Real-Time PCR System and a KAPA Library Quant Kit. Using the concentration from the ViiA7 qPCR machine, 21 pM of library was loaded onto a flow-cell and amplified by bridge amplification using the Illumina cBot machine. A paired-end 100 cycle run was used to sequence the flow-cell on a HiSeq Sequencing System. For each sample, about 10 million 100-base-pair pair-end reads were generated. Raw reads were first groomed by removing adapters from both the 3′- and 5′-ends before mapping to the reference genome. Then, trimmed reads were aligned to the Mus musculus genome (UCSC mm10; the gene model for the mapping was obtained from http://ccb.jhu.edu/software/tophat/igenomes.shtml) using TopHat v2.0.9 (ref. 32) with default parameters (-r 200 -p 5). The mappability for all 30 samples was above 85%. To prepare the aligned sequence reads into expression level for differential gene analysis, we used the free Python program HTSeq33. The htseq-count function of HTSeq allowed us to accumulate the number of aligned reads that fall under the exons of the gene (union of all the exons of the gene). These read counts are analogous to the expression level of the gene. Using the obtained read counts, differential gene analyses were carried out using the DESeq package and glm.nb function in the R environment. DESeq includes functions for us to normalize the read counts of multiple samples across several genotypes by the use of the negative binomial distribution and a shrinkage estimator for the distribution’s variance34. glm.nb allows us to fit a negative binomial regression model to test the gene changes between genotypes. Specifically, for data from the ASO experiment, each gene was tested to check whether its expression levels in wild-type and TG-ASO mice differed from that in transgenic mice. Similarly, for data from the genetic rescue experiment, expression levels in Flox and Flox;TG;Cre-TMX were tested for differences from the expression in Flox;TG;Cre-vehicle and Flox;TG. The statistical significance of the observed changes was reported by the false discovery rate, which is the P value adjusted for multiple testing with the Benjamini–Hochberg procedure. A gene was considered significantly different between genotypes if it fell under a false discovery rate of 10% and changed in a coherent direction. To assess the similarity of expression patterns between samples of different genotypes, we carried out unbiased clustering: expressions of the identified significantly changed genes were clustered by sample based on Euclidean distance on average linkage and by genes based on Euclidean distance on complete linkage. Heat maps were then used to plot the clustered gene expressions for visual inspection. The plotted expressions (Z-scores) for each gene were the expressions normalized at the gene level to have an average of zero and a standard deviation of one. Mice were deeply anaesthetized with isofluorane, followed by decapitation. The brain was removed into oxygenated and ice-cold cutting solution (CS) containing (in mM): 110 sucrose, 60 NaCl, 3 KCl, 1.25 NaH PO , 28 NaHCO , 0.5 CaCl , 7 MgCl and 5 glucose, and the caudal portion of the forebrain containing the hippocampus and entorhinal cortex was isolated by razor blade cuts. Transverse slices (400 μm) were prepared with a Vibratome (Vibratome). Cortical tissue was then removed and hippocampal slices were equilibrated in a mixture of 50% CS and 50% artificial cerebrospinal fluid (ACSF) containing (in mM): 125 NaCl, 1.25 NaH PO , 2.5 KCl, 25 NaHCO , 2 CaCl , 1 MgCl and 15 glucose, at room temperature for 10–20 min before transfer to the recording chamber. All data acquisition and analyses were carried out blinded to the genotype and treatment. Electrophysiology was performed in an interface chamber (Fine Science Tools). Oxygenated ACSF (95%/5% O /CO , 31 °C) was perfused into the recording chamber at the rate of 1.5 ml min−1. Electrophysiological traces were digitized and stored using a Digidata 1320A and Clampex software (Axon Instruments). fEPSPs were recorded in the stratum radiatum with an ACSF-filled glass recording electrode (1–3 MΩ). The relationship between fibre volley amplitude and fEPSP slope over various stimulus intensities was used to assess baseline synaptic transmission. All subsequent experimental stimuli were set to an intensity that evoked a 30–40% of the maximal fEPSP slope. Slices that did not exhibit stable fEPSP slopes during the first 20 min of recording were excluded from the analysis. Paired-pulse facilitation was measured at varying interstimulus intervals (20, 50, 100, 200 and 300 ms). LTP was induced by two trains of high-frequency stimulation (100 Hz for 1 s) with a 20-s intertrain interval. Synaptic efficacy was monitored for 20 min before and 70 min after LTP induction by recording fEPSPs every 20 s (three traces were averaged over succeeding 1-min intervals). For the quantification of the last 10 min of the LTP recording (Fig. 2i), slices were averaged per mouse, and statistical analysis was done on the animals (n = 6–7 mice, 15–20 slices, two-tailed t-test). Mice were anaesthetized with isoflurane and placed on a computer-guided stereotaxic instrument (Angle Two Stereotaxic Instrument, Leica Microsystems) that is fully integrated with the Franklin and Paxinos35 mouse brain atlas through a control panel. Anaesthesia (isoflurane 3%) was continuously delivered via a small face mask. Ketoprofen 5 mg kg−1 was administered subcutaneously at the initiation of surgery. After sterilizing the surgical site with betadine and 70% alcohol, a midline incision was made over the skull and a small hole was drilled through the skull above the right lateral ventricle. A total of 500 μg MECP2-ASO or saline was delivered using a Hamilton syringe connected to a motorized nanoinjector at 0.3 μl min−1. The coordinates used relative to bregma were: anteroposterior (AP) = −0.2 mm, medial lateral (ML) = 1 mm, dorsal ventral (DV) = −3 mm, based on a calibration study indicating these coordinates as leading to the right ventricle in our mice. To allow diffusion of the solution into the brain, the needle was left for 5 min on the site of injection. The incision was manually closed with suture. Carprofen-containing food pellets were provided for 5 days after the surgery. Two weeks after the surgery,the animals were euthanized and their brains were dissected for RNA and protein analysis. Two days before surgery, a micro-osmotic pump (Alzet model 1004, Durect) was filled with 500 μg MECP2-ASO or control-ASO dissolved in 100 μl saline. The pump was then connected through a plastic catheter to a cannula (Alzet Brain Infusion Kit 3, Durect) (see Extended Data Fig. 6a). The pump was designed to deliver the drug at a rate of 0.11 μl h−1 for 28 days. The cannula plus pump assembly was primed in sterile saline for 2 days at 37 °C. Mice were anaesthetized with isoflurane and placed on a computer-guided stereotaxic instrument (Angle Two Stereotaxic Instrument, Leica Microsystems). Anaesthesia (isoflurane 3%) was continuously maintained via a small face mask. Ketoprofen 5 mg kg−1 was administered subcutaneously at the initiation of the surgery. After sterilizing the surgical site with betadine and 70% alcohol, a midline incision was made over the skull and a subcutaneous pocket was generated on the back of the animal. Next, the pump was inserted into the pocket and the cannula was stereotactically implanted to deliver the drug in the right ventricle using the following coordinates: AP = −0.2 mm, ML = 1 mm, DV = −3 mm. The incision was sutured shut. Carprofen-containing food pellets were provided for 5 days after the surgery. The pump was disconnected and removed 28 days after the initiation of treatment. Two additional weeks were given to the animals to recover before any behavioural testing. Mice were anaesthetized with isoflurane and mounted in a stereotaxic frame. Under aseptic conditions, each mouse was surgically implanted with three recording electrodes (Teflon-coated silver wire, 125 μm in diameter) aimed at the subdural space of left frontal cortex, left parietal cortex and right parietal cortex. The reference electrode was then positioned in the occipital region of the skull. All electrode wires were attached to a miniature connector (Harwin Connector). After 3–5 days of post-surgical recovery, cortical EEG activity (filtered between 0.5 and 5 kHz, sampled at 2 kHz) and behaviour were simultaneously recorded in freely moving mice for 2 h per day over 3–5 days36. All the EEG recordings were qualitatively and manually analysed by experimenters blinded to the mouse genotype and treatment. Electrographic seizure activities were visually identified and matched with the behavioural seizure, if applicable. Other abnormal epileptiform spikes were also identified visually37. Following informed consent, approved by the Institutional Review Board for Human Subject Research at Baylor College of Medicine (H-18122), a venous blood sample was provided by five individuals affected with MECP2 duplication syndrome and five age-matched controls to establish immortalized B-lymphoblastoid cell lines, following standard procedures. Human B-lymphoblastoid cells were cultured in suspension in RPMI 1640 medium with L-glutamine, penicillin–streptomycin and 10% (v/v) FBS. A day before transfection, cells were seeded in 6-wells plates at a density of 1 × 106 cells in a total volume of 2 ml complete medium. Transfection mixture was prepared by combining 20 μl ASO (at the desire concentration), 4 μl transfection reagent (TurboFect, R0531, Thermo Scientific) and 180 μl serum-free RPMI medium. The mix was incubated at room temperature for 15 min before adding to the cells. RNA was extracted from lymphoblasts 48 h after transfection. Lymphoblastoid cells from the age-matched control donors and the non-treated MECP2 duplication cells were incubated with 4.8 μM control-ASO. Statistical significance was analysed using GraphPad Prism. The number of animals used (n), and the specific statistical tests used are indicated for each experiment in the figure legends. Sample size in behavioural studies was based on previous reports using transgenic mice with the same background. Mice were randomly assigned to vehicle or treatment groups using Excel software to generate a table of random numbers, and the experimenter was always blinded to the treatment. For behavioural assays, all population values appear normally distributed. Equal variances were never assumed, and the Geisser–Greenhouse correction for sphericity was always applied when using ANOVA.


News Article | March 1, 2017
Site: www.24-7pressrelease.com

WILLIAMSBURG, VA, March 01, 2017-- Dr. Mary L. Voorhess is a celebrated Marquis Who's Who biographee. As in all Marquis Who's Who biographical volumes, individuals profiled are selected on the basis of current reference value. Factors such as position, noteworthy accomplishments, visibility, and prominence in a field are all taken into account during the selection process.Marquis Who's Who, the world's premier publisher of biographical profiles, is proud to name Dr. Voorhess a Lifetime Achiever. An accomplished listee, Dr. Voorhess celebrates many years' experience in her professional network, and has been noted for achievements, leadership qualities, and the credentials and successes she has accrued in her field.Dr. Voorhess, Professor Emerita, Dept. of Pediatrics, College of Medicine and Biomedical Sciences, State University of New York at Buffalo, prepared for her role as co-chief of the Division of Endocrinology at Children's Hospital of Buffalo by earning a Doctor of Medicine degree from Baylor College of Medicine (Houston); a Bachelor of Arts in Zoology from the University of Texas (Austin); and became an RN after graduating from City Hospital School of Nursing in Binghamton, NY.Dr. Voorhess received a Research Career Development Award from the National Cancer Institute (NIH), and the Dean's Award for Service to the University from SUNY Buffalo. She has been featured in numerous Marquis Who's Who publications, including Who's Who of American Women, Who's Who in the World, Who's Who in the South and Southwest, Who's Who in Science and Engineering, Who's Who in Medicine and Healthcare and Who's Who in America.In recognition of outstanding contributions to her profession and the Marquis Who's Who community, Dr. Voorhess has been featured on the Marquis Who's Who Lifetime Achievers website. Please visit https://wwlifetimeachievement.com/2016/12/12/mary-voorhess/ to view this distinguished honor.About Marquis Who's Who :Since 1899, when A. N. Marquis printed the First Edition of Who's Who in America , Marquis Who's Who has chronicled the lives of the most accomplished individuals and innovators from every significant field of endeavor, including politics, business, medicine, law, education, art, religion and entertainment. Today, Who's Who in America remains an essential biographical source for thousands of researchers, journalists, librarians and executive search firms around the world. Marquis publications may be visited at the official Marquis Who's Who website at www.marquiswhoswho.com


News Article | February 20, 2017
Site: www.eurekalert.org

Understanding how the brain remembers can one day shed light on what went wrong when memory fails, such as it occurs in Alzheimer's disease. Researchers at Baylor College of Medicine and Rice University reveal for the first time the specific patterns of electrical activity in rat brains that are associated with specific memories, in this case a fearful experience. They discovered that before rats avoid a place in which they had a fearful experience, the brain recalled memories of the physical location where the experience occurred. The results appear in Nature Neuroscience. "We recall memories all the time," said senior author Dr. Daoyun Ji, associate professor of molecular and cellular biology at Baylor. "For example, I can recall the route I take from home to work every morning, but what are the brain signals at this moment when I hold this memory in my mind?" Studying the workings of the brain in people is difficult, so scientists have turned to the laboratory rat. They have learned that when the animal is in a particular place, neurons in the hippocampus, appropriately called place cells, generate pulses of activity. "A number of place cells generates electrical activity called a 'spiking pattern,'" Ji said. "When the rat is in a certain place, a group of neurons generates a specific pattern of spikes and when it moves to a different place, a different group of neurons generates another pattern of spikes. The patterns are very distinct. We can predict where the animal is by looking at its pattern of brain activity." But, are these spiking patterns involved in memory? How to know what a rat is thinking "Our laboratory rats cannot tell us what memory they are recalling at any particular time," Ji said. "To overcome that, we designed an experiment that would allow us to know what was going on in the animal's brain right before a certain event." In the experiment, conducted by first author Chun-Ting Wu, graduate researcher at the Ji lab, a rat walked along a track, back and forth. After a period of rest, the rat walked the same track again, but when the animal approached the end of the track, it received a mild shock. After it rested again, the rat was placed back on the track. This time, however, when it approached the end of the track where it had received the mild shock before, the rat stopped and turned around, avoiding crossing the fearful path. "Before a rat walked the tracks the first time, we inserted tiny probes into its hippocampus to record the electrical signals generated by groups of active neurons," Ji said. "By recording these brain signals while the animal walked the track for the first time we could examine the patterns that emerged in its brain - we could see what patterns were associated with each location on the track, including the location where the animal later got shocked." "Because the rat turns around and avoids stepping on the end of the track after the shocks, we can reasonably assume that the animal is thinking about the place where it got shocked at the precise moment that it stops walking and turns away," Ji said. "Our observations confirmed this idea." When the researchers, in collaboration with co-author Dr. Caleb Kemere at Rice University, looked at the brain activity in place neurons at this moment, they found that the spiking patterns corresponding to the location in which the rat had received the shock re-emerged, even though this time the animal was only stopping and thinking about the location. "Interestingly, from the brain activity we can tell that the animal was 'mentally traveling' from its current location to the shock place. These patterns corresponding to the shock place re-emerged right at the moment when a specific memory is remembered," Ji said. The next goal of the researchers is to investigate whether the spiking pattern they identified is absolutely required for the animals to behave the way they did. "If we disrupt the pattern, will the animal still avoid stepping into the zone it had learned to avoid?" Ji said. "We are also interested in determining how the spiking patterns of place neurons in the hippocampus can be used by other parts of the brain, such as those involved in making decisions." Ji and his colleagues are also planning on exploring what role spiking patterns in the hippocampus might play in diseases that involve memory loss, such as Alzheimer's disease. "We want to determine whether this kind of mechanism is altered in animal models of Alzheimer's disease. Some evidence shows that it is not that the animals don't have a memory, but that somehow they cannot recall it. Using our system to read spiking patterns in the brains of animal models of the disease, we hope to determine whether a specific spiking pattern exists during memory recall. If not, we will explore the possibility that damaged brain circuits are preventing the animal from recalling the memory and look at ways to allow the animal to recall the specific activity patterns, the memory, again." Dr. Daniel Haggerty, a post-doctoral associate in the Ji lab, also contributed to this work. This study was supported by grants from the National Institutes of Health (R01MH106552) and the Simons Foundation (#273886).


News Article | October 27, 2016
Site: techcrunch.com

A Houston-based startup called BrainCheck has raised $3 million in seed funding for an app that helps users understand, by simply playing some games on an iPad, if they or a loved one may have suffered a concussion. Founded in 2014 by Dr. David Eagleman, a neuroscientist at Baylor College of Medicine, BrainCheck adapts to an interactive format the accepted assessments that neuropsychologists and neurologists administer to patients offline. If concussion sounds like a health problem limited to pro football players, it is not, said Eagleman, and BrainCheck CEO Yael Katz, who has a PhD in biological informatics. There are 1.6 million to 3.8 million sport-related concussions, also known as mild traumatic brain injuries, in the U.S. every year, according to data cited by the Journal of Head Trauma and Rehabilitation. In 2009, Washington state became the first state to attempt to stem the public health epidemic of concussion among student athletes with its Zackery Lystedt Law, requiring policies for the “management of head injury in youth sports.” Since then, the issue has gotten more notice thanks to a PBS Frontline documentary in 2013, League of Denial, and a Hollywood film called Concussion last year starring Will Smith. Now, the president’s 2017 budget proposal requests $5 million for the Centers for Disease Control and Prevention (CDC) to establish and run a National Concussion Surveillance System, which would allow the organization to more precisely grasp how mildly traumatic brain injuries are effecting the U.S. population. Data gathered by BrainCheck could contribute to such studies and our collective understanding about neurocognitive health, the founders said. While BrainCheck has seen early traction in the U.S., selling to school districts, athletic trainers and families whose kids participate in sports, the company is seeking to expand internationally and beyond concussion monitoring, Katz said. Specifically, BrainCheck is developing features and functionality to assess older users at risk of dementia. There are 46.8 million people suffering with dementia worldwide today, according to Alzheimer’s Disease International. “This is projected to double over 20 years,” the CEO noted, reaching 74.7 million by 2030. Dementia assessments will be accessible through BrainCheck as of January 2017. BrainCheck is currently part of the Texas Medical Center accelerator (TMCx) at Texas Medical Innovation Center. An advisor to the center and investor in BrainCheck’s seed round, Brett Giroir, said, “There is an absolute need for a simple, personal take-home neurologic assessment that is complete and has complexity and sophistication to it, but can be done rapidly and by anyone, for dementia, especially.” He sees BrainCheck as democratizing sophisticated, psychological neuro-testing in a way that can help an aging world population to identify and treat dementia earlier than ever before. Giroir, who was previously the director of DARPA’s science office, lauded BrainCheck’s “scientific  pedigree,” and the potential extensibility of its app. “Beyond concussion and dementia, there are things you can study like the side effects and safety of drugs, and polypharmacy. There are things that can cause people not to remember well, or lose coordination that are not brain injury related, or dementia but would be related to the drugs that they are taking.” Rather than move into new areas of digital technology, like virtual reality, Katz and Eagleman say BrainCheck will invest its seed capital and resources into doing the most it can via the mobile platform. The company’s app is a health “tracking” app, rather than diagnostic tool for clinical use at this point. But the company intends to work with the FDA to become a class 2 medical device, soon. But even without further classifications, Eagleman said the app is making a positive difference to families simply because it can be used at home. He said: “With dementia, especially, most people don’t go into a neurologist until it is too late. If you ever have someone with this problem in your life, you’ll see there’s a lot of denial and rationalization that happens. People will say they are feeling sleep deprived, and that’s why they couldn’t remember a word, or had trouble putting their clothes on. A lot of that is because nobody wants to go to the doctor, it’s just too much of a pain in the ass. We put this in people’s hands, and they can take the best of what’s known in the science and have that at home.”


News Article | November 18, 2016
Site: www.rdmag.com

The Brazilian doctor who has been at the forefront of the fight against Zika for the past year has weighed in on some of the potential birth defects. Dr. Vanessa van der Linden, the physician who was one of the first researchers linking Zika to microcephaly—a birth defect where infants are born with smaller and misshapen heads—has expressed concerns over many of her patients she has observed in the last year. Van der Linden, a pediatric neurologist at the Barão de Lucena Hospital, in Recife, Brazil, said in a Science News for Students article that while microcephaly remains the most common symptom, she has observed a number of other symptoms including muscle spasms, extreme irritability, difficulty swallowing and the possibility of crying for 24 hours straight. Another issue van der Linden observed is a deformity called arthrogryposis, which can leave a child with contractures or joints stuck in contorted positions.  This disease has shown up in babies both with and without microcephaly. Van der Linden described much of her findings and observations during a Sept. 22 workshop hosted by the National Institute of Health in North Bethesda, Md. In the article, Peter Hotez, a pediatrician and microbiologist at Baylor College of Medicine in Houston, Texas, said some of the long-term impacts of Zika are still relatively unknown and symptoms including learning disabilities or developmental delays might emerge in the future. Zika has become a growing concern in South America, the Caribbean and Florida. Other symptoms observed include ear and eye problems in newborns. In a Sept. 2 report from the U.S. Centers for Disease Control and Prevention (CDC), one in every 10 of the 70 Zika-exposed infants with microcephaly also experienced some hearing loss. Another study shows of 29 Brazilian babies observed with microcephaly more than one in every three had some eye oddity. Other scientists have begun to study how Zika could impact the brain. Marco Onorati, a scientist at Yale University, said in the article that he and colleagues found that the virus can invade and kill two different brain cells in neuroepithelial stem cells and radial glial cells.


News Article | December 21, 2016
Site: www.eurekalert.org

Crafting a vaccine against RSV (respiratory syncytial virus) has been a minefield for 50 years, but scientists believe they have found the right balance. Researchers at Emory University School of Medicine and Children's Healthcare of Atlanta report that they have engineered a version of RSV that is highly attenuated - weakened in its ability to cause disease - yet potent in its ability to induce protective antibodies. The researchers examined the engineered virus using cryo-electron microscopy and cryo-electron tomography techniques, and showed that it is structurally very similar to wild type virus. When used as a vaccine, it can protect mice and cotton rats from RSV infection. The results are scheduled for publication in Nature Communications on December 21. "Our paper shows that it's possible to attenuate RSV without losing any immunogenicity," says senior author Martin Moore, PhD, associate professor of pediatrics at Emory University School of Medicine and a Children's Healthcare of Atlanta Research Scholar. "This is a promising live-attenuated vaccine candidate that merits further investigation clinically." The next steps for this vaccine are to produce a clinical grade lot and conduct a phase 1 study of safety and immunogenicity in infants, Moore says. RSV is the number one cause of pneumonia deaths in children worldwide and one of the top causes of infant hospitalization in the United States. Most children in the USA become infected in the first year of life. Even so, there is no vaccine against RSV available. In the 1960s, an attempt to develop an RSV vaccine by chemically inactivating the virus, like in a standard flu shot, backfired. Exposure to this vaccine actually made natural RSV infection in infants worse. More recently, a clinical trial of a protein-only RSV vaccine in older adults showed disappointing results. Several successful vaccines against other viruses, likes measles, polio, and mumps, have been created by weakening the viruses in cell culture. A strain that is safe enough for use as a vaccine, but still stimulates the immune system, is supposed to result. "Achieving that balance is a challenge," Moore says. "Weakening RSV by passage hasn't worked out satisfactorily. It turns out that for RSV, the natural virus does not induce a lot of immunity itself." Instead, Moore and his colleagues engineered RSV to enhance production of a key protein, called F (for fusion). F is critical for RSV's ability to enter cells and is the target of several vaccines in development. By making mutations in the viral gene that encodes F, the researchers also made the virus more stable with respect to heat, which could help vaccine manufacturing and distribution. At the same time, the researchers removed or weakened several other viral genes that promote infection and suppress the immune system. One measure of this is that the modified virus, called OE4, stimulates high levels of antibody production. Moore and his team rewrote several of the viral genes in the OE4 strain using a process called codon-deoptimization, which makes it less likely for a re-engineered virus to mutate back to its original form. When examined via cryo-electron microscopy and cryo-electron tomography, OE4 virions were structurally very similar to standard RSV virions. The researchers used techniques that allow the virions to be preserved in their native states, says co-senior author Elizabeth R. Wright, PhD, associate professor of pediatrics at the Emory University School of Medicine. Wright is director of the Robert P. Apkarian Integrated Electron Microscopy Core and a Georgia Research Alliance Distinguished Investigator. Immuno-EM experiments revealed that OE4 had higher levels of the pre-fusion, form of the F protein and lower levels of the attachment protein called G. In addition, a Georgia Tech graduate student in Wright's lab, Zunlong Ke, analyzed cryo-ET data and found that that the majority of F proteins on both viruses preserved immediately after budding was in the pre-fusion conformation. This is the structural evidence that the vaccine candidate (OE4) is highly immunogenic though highly attenuated, Wright says. OE4 vaccination could completely protect mice and cotton rats against later infection by standard forms of RSV. In contrast with a chemically inactivated RSV vaccine, OE4 did not result in enhanced lung disease in cotton rats. Christopher Stobart, PhD, now assistant professor of biology at Butler University, and instructor Christina Rostad, PhD are co-first authors of the paper. Cotton rat studies were performed at Baylor College of Medicine and at Sigmovir Biosystems. Emory has optioned the vaccine technology to a startup company, Meissa Vaccines, Inc. Moore co-founded and serves as chief scientific officer for Meissa Vaccines, Inc. Moore, Stobart, Rostad, and co-authors Anne Hotard and Jia Meng are co-inventors in a patent application describing the RSV vaccine reported in the Nature Communications paper. Emory and Moore could benefit financially from this technology, and this relationship has been reviewed and approved by Emory University School of Medicine. The research was supported by the National Institute of Allergy and Infectious Diseases (R01AI087798, U19AI095227, T32AI074492), the Atlanta Pediatric Scholars program (K12HD072245) and a pilot grant from the Emory/Children's/Georgia Tech Center for Childhood Infections and Vaccines.


Home > Press > Tattoo therapy could ease chronic disease: Rice-made nanoparticles tested at Baylor College of Medicine may help control autoimmune diseases Abstract: A temporary tattoo to help control a chronic disease might someday be possible, according to scientists at Baylor College of Medicine who tested antioxidant nanoparticles created at Rice University. A proof-of-principle study led by Baylor scientist Christine Beeton published today by Nature's online, open-access journal Scientific Reports shows that nanoparticles modified with polyethylene glycol are conveniently choosy as they are taken up by cells in the immune system. That could be a plus for patients with autoimmune diseases like multiple sclerosis, one focus of study at the Beeton lab. “Placed just under the skin, the carbon-based particles form a dark spot that fades over about one week as they are slowly released into the circulation,” Beeton said. T and B lymphocyte cells and macrophages are key components of the immune system. However, in many autoimmune diseases such as multiple sclerosis, T cells are the key players. One suspected cause is that T cells lose their ability to distinguish between invaders and healthy tissue and attack both. In tests at Baylor, nanoparticles were internalized by T cells, which inhibited their function, but ignored by macrophages. "The ability to selectively inhibit one type of cell over others in the same environment may help doctors gain more control over autoimmune diseases," Beeton said. "The majority of current treatments are general, broad-spectrum immunosuppressants," said Redwan Huq, lead author of the study and a graduate student in the Beeton lab. "They're going to affect all of these cells, but patients are exposed to side effects (ranging) from infections to increased chances of developing cancer. So we get excited when we see something new that could potentially enable selectivity." Since the macrophages and other splenic immune cells are unaffected, most of a patient's existing immune system remains intact, he said. The soluble nanoparticles synthesized by the Rice lab of chemist James Tour have shown no signs of acute toxicity in prior rodent studies, Huq said. They combine polyethylene glycol with hydrophilic carbon clusters, hence their name, PEG-HCCs. The carbon clusters are 35 nanometers long, 3 nanometers wide and an atom thick, and bulk up to about 100 nanometers in globular form with the addition of PEG. They have proven to be efficient scavengers of reactive oxygen species called superoxide molecules, which are expressed by cells the immune system uses to kill invading microorganisms. T cells use superoxide in a signaling step to become activated. PEG-HCCs remove this superoxide from the T cells, preventing their activation without killing the cells. Beeton became aware of PEG-HCCs during a presentation by former Baylor graduate student Taeko Inoue, a co-author of the new study. "As she talked, I was thinking, 'That has to work in models of multiple sclerosis,'" Beeton said. "I didn't have a good scientific rationale, but I asked for a small sample of PEG-HCCs to see if they affected immune cells.” "We found they affected the T lymphocytes and not the other splenic immune cells, like the macrophages. It was completely unexpected," she said. The Baylor lab's tests on animal models showed that small amounts of PEG-HCCs injected under the skin are slowly taken up by T lymphocytes, where they collect and inhibit the cell's function. They also found the nanoparticles did not remain in T cells and dispersed within days after uptake by the cells. "That's an issue because you want a drug that's in the system long enough to be effective, but not so long that, if you have a problem, you can't remove it," Beeton said. “PEG-HCCs can be administered for slow release and don't stay in the system for long. This gives us much better control over the circulating half-life." "The more we study the abilities of these nanoparticles, the more surprised we are at how useful they could be for medical applications," Tour said. The Rice lab has published papers with collaborators at Baylor and elsewhere on using functionalized nanoparticles to deliver cancer drugs to tumors and to quench the overproduction of superoxides after traumatic brain injuries. Beeton suggested delivering carbon nanoparticles just under the skin rather than into the bloodstream would keep them in the system longer, making them more available for uptake by T cells. And the one drawback – a temporary but visible spot on the skin that looks like a tattoo – could actually be a perk to some. "We saw it made a black mark when we injected it, and at first we thought that's going to be a real problem if we ever take it into the clinic," Beeton said. "But we can work around that. We can inject into an area that's hidden, or use micropattern needles and shape it. "I can see doing this for a child who wants a tattoo and could never get her parents to go along," she said. "This will be a good way to convince them." Co-authors are Rice alumnus Errol Samuel, now a postdoctoral associate at Baylor College of Medicine, and graduate students William Sikkema and Lizanne Nilewski; Baylor rotation student Thomas Lee, graduate students Mark Tanner, Rajeev Tajhya and alumni Fatima Khan and Rutvik Patel; and Paul Porter, an instructor in the Department of Medicine, Division of Immunology, Allergy and Rheumatology at Baylor; Robia Pautler, an associate professor in the Department of Molecular Physiology and Biophysics, and David Corry, a professor of medicine and chief of the Division of Immunology, Allergy and Rheumatology, all at Baylor. Tour is the T.T. and W.F. Chao Professor of Chemistry as well as a professor of computer science and of materials science and nanoengineering. Beeton is an associate professor of molecular physiology and biophysics at Baylor. The research was supported by Baylor College of Medicine, the National Multiple Sclerosis Society, National Institutes of Health, the Dan L. Duncan Cancer Center, John S. Dunn Gulf Coast Consortium for Chemical Genomics and the U.S. Army-funded Traumatic Brain Injury Consortium. About Rice University Located on a 300-acre forested campus in Houston, Rice University is consistently ranked among the nation’s top 20 universities by U.S. News & World Report. Rice has highly respected schools of Architecture, Business, Continuing Studies, Engineering, Humanities, Music, Natural Sciences and Social Sciences and is home to the Baker Institute for Public Policy. With 3,910 undergraduates and 2,809 graduate students, Rice’s undergraduate student-to-faculty ratio is 6-to-1. Its residential college system builds close-knit communities and lifelong friendships, just one reason why Rice is ranked No. 1 for happiest students and for lots of race/class interaction by the Princeton Review. Rice is also rated as a best value among private universities by Kiplinger’s Personal Finance. To read “What they’re saying about Rice,” go to tinyurl.com/RiceUniversityoverview. Follow Rice News and Media Relations via Twitter @RiceUNews If you have a comment, please us. Issuers of news releases, not 7th Wave, Inc. or Nanotechnology Now, are solely responsible for the accuracy of the content.


News Article | April 27, 2016
Site: www.nature.com

Not many graduate students who spend 50–60 hours in the laboratory each week are eager to take on an outside job — especially one that pays nothing. But Michael Lang, a PhD student in cell and developmental biology at the University of Michigan in Ann Arbor, has added two part-time, unpaid positions to his workload. He's the president of miLEAD Consulting, an independent, non-profit company based in Ann Arbor that connects the university's graduate students and postdoctoral researchers with local biotechnology and health-care companies that need help with product development, market analysis or branding. And he works directly for miLEAD to provide his own insights and analyses to companies. Lang thinks that the long hours are worth it. The consulting work helps him to build leadership and management skills that would come in handy if he were to reach his ideal goal of running an academic lab. And if that doesn't work out, he'll have a fall-back position: “I've always wanted to be a scientist, but a US$130,000 job at a top consulting firm sounds pretty good too.” Lang's group is one of several consulting organizations that have sprung up on US campuses in the past few years. They supply teams of postdocs and graduate students who can take a scientific approach to common questions faced by local biotechnology and pharmaceutical start-ups — what is the demand for a new product, what is the competition, what can be done to make a product better and what is the best way to profit from a good idea? Consultants do not always know how companies use their input or whether their advice makes a difference, but the value of the experience is undeniable. “We want to give people another bullet point on their CV,” Lang says. “It can get them over the hurdle to getting a job.” A few of these consulting groups, including miLEAD, are independent, non-profit companies with no official ties to their home institute. But most are affiliated with their host institutions, including Harvard University in Cambridge, Massachusetts, Stanford University in California and the University of Pennsylvania in Philadelphia. Such campus-based organizations haven't caught on outside the United States, but at least one global company, 180 Degrees Consulting, recruits postdocs and graduate students for consulting projects and gives scientific trainees in the United Kingdom and elsewhere a chance to add to their skill set. Whatever group they work for, trainees in consulting get valuable experience in analysis, decision making and team-based problem solving that can give them a boost in the job market. It is also a break from the normal routine. “Fast-paced teamwork can be a lot of fun,” says Huadi Zhang, a medical-science PhD student and co-president of Harvard Graduate Consulting Club. “I didn't have that kind of experience in the laboratory.” But on-the-side consulting is also a serious commitment and time drain — and there are several hoops to be jumped through if students want to start a group from scratch (see 'How to start a consultancy'). The field is not for everyone, but an increasing number of trainees have found that it is possible to consult their way into a career. For Lang, consulting has turned into a second life outside the lab. He estimates that he spends 10–15 hours a week fulfilling his duties as president of miLEAD: overseeing the search for clients, recruiting consultants and, importantly, training them in the basics of business. Working on a project — which might involve meeting with a company's board, talking to doctors or digging through research articles — generally takes him another 10–15 hours each week. These are huge time commitments for a graduate student with experiments to run and papers to write. But it's worth it, he says, for the boost it gives to his CV and research. “The additional work has helped me streamline my science,” he says. “There's not a lot of downtime in the lab.” Lang's recent projects include an eight-week gig for a Michigan pharmaceutical company that is developing a therapeutic drug for newborns. (Because of non-disclosure agreements, he cannot name the company.) He and his team studied the market for the drug, scoped out the competition and gauged its potential applications in neonatal medicine. Previously, he was on a team that spent four weeks assessing an app-based learning tool for college students that was developed at the University of Michigan. Lang says that miLEAD brought in $6,000 in revenue in 2015 and is aiming for $12,000 in 2016. The board uses all of the revenue for group-related activities, including flying in speakers for panel discussions and funding team-building gatherings. If the coffers get sufficiently full, Lang hopes to start a grant programme to help local businesses to get off the ground. miLEAD's fees for client companies are a tiny fraction of what a big-time consulting company would charge, but they underscore the professionalism of the process. “We treat this like a business,” he says. “If money is involved, better work gets done.” Conversely, Zhang says that the Harvard Graduate Consulting Club has no plans to start charging clients. “It's a way for us to give back to the community,” he notes. Although it is likely that local start-ups get some value from their consulting, improving a company's bottom line is not the main point of the exercise. “It's a learning experience for us,” says Zhang. Consulting organizations are starting to pop up on other campuses, giving more postdocs and graduate students a chance to try out the field. Simran Madan, a PhD student in translational biology at Baylor College of Medicine in Houston, Texas, is helping to kick-start consulting services as senior vice-president of the Consulting Club at the Texas Medical Center in Houston. This independent, non-profit group is drawing talent from several local institutions, including Baylor and the University of Texas Heath Science Center and MD Anderson Cancer Center in Houston. The group aims to begin offering consulting services by the end of the year. For now, Madan and club president Redwan Huq, a Baylor PhD student in molecular physiology and biophysics, are learning how to recruit potential consultants, provide training, structure consulting teams and attract clients. The plan is to charge local companies about $500 for 6 weeks of work analysing a product and coming up with a marketing or development plan, a price that should be attractive to cash-strapped start-ups. “Professional consultants are expensive, and you almost never see a start-up hiring a firm,” Madan says. “But they can get the same sort of analysis from a trainee.” One source of inspiration for Madan and Huq is the BALSA (Biotechnology and Life Sciences Advising) group, a successful consulting organization at Washington University in St Louis, Missouri. BALSA, which started in 2011, has 100 active members who participate in around 40 projects a year. About 60% of the members are science PhD students, 30% are science postdocs and a few are business or law students. Each job lasts six weeks, and each team includes three consultants, a project manager and an adviser. Most of the work involves product development and market analysis for local start-ups and entrepreneurs in the biotechnology, agriculture and health-care industries. The group also has clients in South Dakota; San Francisco, California; and Philadelphia, Pennsylvania, says Shivam Shah, who is the BALSA president and a PhD student in biomedical engineering at Washington University. A frequent BALSA client is Washington University's Office of Technology Management, which has often hired the team to help evaluate patent applications from faculty members. Shah says that the group tries to avoid having students evaluate their direct supervisors, but that is not always possible. Students aim to judge patent applications strictly on their scientific merit and real-world potential, he says. Since joining the group in 2013, Shah has worked on more than 20 projects as either a consultant or a project manager. Working on multiple projects has given him a chance to fine-tune his management style and learn more about the scientific marketplace, he says. He hopes to land a consulting job soon after getting his degree, perhaps with a health-care venture-capital firm looking for advice about wise places to invest. But a consulting career is hardly the only destination for BALSA members. Many have ended up working in industry as research scientists, patent specialists or consultants for companies such as the multinational agrochemical company Monsanto, based in St Louis, Missouri, and the New York-based computing giant IBM. And of the roughly 200 alumni of the programme, he estimates that about one-third have continued in academic careers. The skills learned in the consulting game — management, leadership and teamwork — would prove valuable to anyone running their own lab, Shah says. There is a paucity of organizations such as miLEAD and BALSA outside the United States, but early-career scientists in the United Kingdom, Europe and elsewhere can still get real-life consulting training. One option is a position with 180 Degrees Consulting, a global organization with branches in Cambridge, UK; King's College London; Munich, Germany; the University of Tokyo; the University of Sydney; and the University of California, Los Angeles, among many other sites. The company enlists students and postdocs to provide pro bono consulting to non-profit and humanitarian organizations around the world. Although the work generally is not focused on scientific issues, science PhD students and postdocs can bring valuable skills to the organization, says Daniel Jiang, a PhD student in computer science who in 2015 founded the 180 Degrees Consulting branch at King's College London. “I know more about data sets than a political-science major does,” he says. Jiang's group is working with a children's charity and sports charity in London, and a school in the Philippines. The company attracts people who want to make a positive difference in the world, Jiang says, but there are benefits for the consultants themselves. “It's a great opportunity for students to find out about a different career before they graduate,” he says. Lang of miLEAD is still technically a student, but he's racking up professional-grade experience and isn't slowing down: he'll jump into two new projects as an adviser this summer. He can't discuss details, but the big picture is clear: he'll be working long hours, thinking about tough problems and moving closer to a postgraduate career. Are the long days worth it? That's a cost–benefit analysis that he has figured out on his own, no consultant required.


News Article | November 10, 2016
Site: www.eurekalert.org

EL PASO, Texas -- Co-principal investigators Richard McCallum, M.D., and Irene Sarosiek, M.D., have received a five-year, $1.8 million grant from the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK). The funds will support basic research and clinical trials on patients living with a digestive disorder named gastroparesis. "Gastroparesis is prevalent here in El Paso; about 100,000 people in our region are affected by it," says Dr. McCallum, a professor at Texas Tech University Health Sciences Center El Paso (TTUHSC El Paso). "This grant will help us collect new and important data on how the disorder affects Hispanics and others, but it will also help us provide health care to more patients." Gastroparesis is a disorder in which food moves through the stomach much slower than normal. The condition affects more than 10 million Americans and symptoms include chronic nausea, vomiting and abdominal pain. In severe cases, a permanent feeding tube is required to ensure adequate nutrition; a medical implant to stimulate the digestive system can also be provided for patients with profoundly severe, drug-resistant symptoms. With the funding, the TTUHSC El Paso team will enroll patients to help test a new drug that may reduce the severity and frequency of their gastrointestinal problems. They'll also examine the effectiveness of a novel diagnostic procedure for the condition. The technique was invented by the TTUHSC El Paso team, and if successful, could replace an invasive surgical procedure that's currently used in patients with gastroparesis. Individuals with gastroparesis who opt to participate in the TTUHSC El Paso studies will receive free health care related to the disorder, such as access to diagnostic tests like endoscopies and the latest treatment options. "Many El Paso patients appreciate the opportunity to participate in our NIH-funded research," Dr. Sarosiek says. "It gives them access to cutting-edge health care that they otherwise would not receive, and at the same time, it helps us find possible risk factors that could play a role in initiating the progression of gastroparesis in affected patients." Drs. McCallum and Sarosiek are studying the disease as part of their membership in the Gastroparesis Clinical Research Consortium (GpCRC), a prestigious national partnership that focuses on the cause of gastroparesis and therapies for the disorder. Membership includes Baylor College of Medicine, Johns Hopkins University and the Mayo Clinic, as well as TTUHSC El Paso.


News Article | November 1, 2016
Site: www.eurekalert.org

PITTSBURGH, Nov. 1, 2016 - A University of Pittsburgh-developed program successfully boosts vaccination rates in adult patients seen at primary care offices, two recent studies demonstrated. Physician offices participating in the 4 Pillars Practice Transformation Program had nearly three times the increase in patients getting the Tdap vaccine for protection against pertussis (whooping cough) compared to non-participating offices, according to research published in the journal Vaccine. Another study, published in the Journal for Healthcare Quality, demonstrated that certain characteristics already embedded into some primary care practices, such as open leadership and staff communication, organizational flexibility and experience with quality improvement, predicted which practices would garner the most vaccination rate improvement from the 4 Pillars program. "Vaccination is the single best way to prevent communicable diseases," said Richard K. Zimmerman, M.D., M.P.H., professor in the Pitt School of Medicine's Department of Family Medicine, and senior or co-author on the two studies. "In recent years, we've seen surges in cases of whooping cough, which can be deadly in newborns who can contract it from unvaccinated adults. And we recently learned from federal health officials that the rate of people getting vaccinated against the flu -- another virus that kills hundreds annually -- fell last season. We need to find ways to get more people immunized." The 4 Pillars program is a step-by-step guide, backed by decades of research, for increasing adult immunizations at primary care clinics by using an online tool that tracks vaccination rates. It's based on four key pillars: convenient vaccination services; communication with patients about the importance of immunization; enhanced office systems to facilitate immunization; and motivation through an office "Immunization Champion" who is charged with implementing the strategies and maintaining the program. In the first-ever study to focus on increasing Tdap immunization rates since it was universally recommended for all adults by the federal Advisory Committee on Immunization Practices in 2012, the researchers enrolled 25 primary care practices in Pittsburgh and Houston. Half received the 4 Pillars program in the first year, while the other half acted as a control group and didn't receive the program until the second year. At the beginning of the study, the practices had Tdap immunization rates ranging from a low of 6.8 percent to a high of 79.5 percent. With the 4 Pillars program, the practices increased their immunization rates by an average of 7.6 percent in the first year compared to a national increase of about 3 percent. One practice increased by 17 percent in the first year. In a different analysis using the same enrolled practices, Mary Hawk, Dr.P.H., assistant professor of behavioral and community health sciences at Pitt's Graduate School of Public Health, examined factors that made the 4 Pillars program more effective at some practices. Those that had the highest implementation of the 4 Pillars program strategies, resulting in the best immunization rate improvement, were those with: "The ability to implement change within primary care settings requires more than simply intent to participate, especially when it comes to improving immunization rates," said Dr. Hawk. "Even with a proven, research-backed program like 4 Pillars, practices also may need to make internal adjustments for the program to work to its full ability." Additional researchers on both studies are Mary Patricia Nowalk, Ph.D., Krissy K. Moehling, M.P.H., Jonathan M. Raviotta, M.P.H., and Edmond E. Ricci, Ph.D., all of Pitt; and Valory Pavlik, Ph.D., and Anthony E. Brown, M.D., both of Baylor College of Medicine. The Vaccine study also included Chyongchiou J. Lin, Ph.D., Song Zhang, M.S., Jeannette E. South-Paul, M.D., Donald B. Middleton, M.D., all of Pitt; and Suchita A. Patel, D.O., and Faruque Ahmed, Ph.D., both of the U.S. Centers for Disease Control and Prevention (CDC). This work was supported by CDC grant U011P000662 and National Institutes of Health grants UL1RR024153 and UL1TR000005. About the University of Pittsburgh Schools of the Health Sciences The University of Pittsburgh Schools of the Health Sciences include the schools of Medicine, Nursing, Dental Medicine, Pharmacy, Health and Rehabilitation Sciences and the Graduate School of Public Health. The schools serve as the academic partner to the UPMC (University of Pittsburgh Medical Center). Together, their combined mission is to train tomorrow's health care specialists and biomedical scientists, engage in groundbreaking research that will advance understanding of the causes and treatments of disease and participate in the delivery of outstanding patient care. Since 1998, Pitt and its affiliated university faculty have ranked among the top 10 educational institutions in grant support from the National Institutes of Health. For additional information about the Schools of the Health Sciences, please visit http://www. .


News Article | February 21, 2017
Site: www.eurekalert.org

LOS ANGELES -- Research published today found testosterone treatment improved bone density and anemia for men over 65 with low testosterone. But the treatment didn't improve patients' cognitive function, and it increased the amount of plaque buildup in participants' coronary arteries, according to four studies published in the Journal of the American Medical Association (JAMA) and JAMA Internal Medicine. A team of researchers from LA BioMed and 12 other medical centers in the U.S., in partnership with the National Institute on Aging, conducted The Testosterone Trials (TTrials), a coordinated group of seven trials, which studied the effects of testosterone treatment for one year as compared to placebo for men 65 and older with low testosterone. Four of those studies were published today. "While we have long known that testosterone levels decrease as men age, very little was known about the effects of testosterone treatment in older men with low testosterone until last year," said Ronald S. Swerdloff, MD, an LA BioMed researcher and co-author of the four studies. "Our first published research last year found benefits to testosterone treatment, and this latest series of studies finds further benefits in terms of improving bone density and anemia. However, the cardiovascular study showed that the testosterone treatment group had increased plaque buildup in coronary arteries, suggesting a possible risk factor." In the cardiovascular trial, researchers assessed coronary artery plaque buildup by CT angiography. That assessment showed more plaque buildup in men treated with testosterone than in men treated with placebo. Nonetheless, in all 788 men in the TTrials, the number of major adverse cardiovascular events was similar in the men treated with testosterone as in the men treated with placebo. "We want to emphasize that this study was exploratory and emphasizes the need for a large-scale, well-controlled, long-term safety trial to determine if there is an increased risk of heart damage or death," Dr. Swerdloff said. "As with all medications the physician and patient need to balance the benefits and risks of treatment." Dr. Christina Wang, an LA BioMed researcher and co-author of the four studies, noted that the researchers also found that testosterone treatment improved bone density and estimated bone strength, as determined by CT. "After one year of treatment, older men with low testosterone significantly increased bone density and estimated bone strength compared to those on placebo," said Dr. Wang. "A larger and longer trial would be needed to determine if testosterone treatment reduces fracture risk." Testosterone treatment also increased hemoglobin concentrations, corrected the anemia of men who had no other identifiable cause of anemia and corrected the anemia of men who had an identifiable cause, such as iron deficiency. While these conclusions proved testosterone to be beneficial to the participants, testosterone treatment did not improve memory or any other measure of cognitive function. "As a result of these findings, physicians may wish to consider measuring testosterone in men age 65 and older who have unexplained anemia and symptoms suggestive of low testosterone levels," said Dr. Swerdloff. The TTrials are now the largest trials to examine the efficacy of testosterone treatment in men 65 and older whose testosterone levels are low due seemingly to age alone. TTrials researchers screened 51,085 men to find 790 who qualified with a sufficiently low testosterone level and who met other criteria. The men enrolled were randomized into two groups: one to take a daily testosterone gel and the other a daily placebo gel, for one year. Efficacy was then evaluated at months three, six, nine and 12. "Final decisions about testosterone treatment for older men will depend on balancing the results from these seven TTrials with the results from a much larger and longer term trial designed to assess cardiovascular and prostate risk in the future," said principal investigator Peter J. Snyder, MD, University of Pennsylvania Perelman School of Medicine professor of medicine in the Division of Endocrinology, Diabetes and Metabolism. In addition to LA BioMed and University of Pennsylvania, the TTrials were conducted at Albert Einstein College of Medicine, Baylor College of Medicine, Brigham and Women's Hospital, University of Alabama at Birmingham, Northwestern University Feinberg School of Medicine, Puget Sound Health Care System, University of California at San Diego School of Medicine, University of Florida School of Medicine, University of Minnesota School of Medicine, University of Pittsburgh School of Public Health and Yale School of Medicine. The Testosterone Trials were supported by a grant from the National Institute on Aging (NIA), National Institutes of Health (U01 AG030644). The TTrials were also supplemented by funds from the National Heart, Lung and Blood Institute, National Institute of Neurological Diseases and Stroke, and National Institute of Child Health and Human Development. AbbVie (formerly Solvay and Abbott Laboratories) also provided funding, AndroGel, and placebo gel. Founded in 1952, LA BioMed is one of the country's leading nonprofit independent biomedical research institutes. It has approximately 100 principal researchers conducting studies into improved treatments and therapies for cancer, inherited diseases, infectious diseases, illnesses caused by environmental factors and more. It also educates young scientists and provides community services, including prenatal counseling and childhood nutrition programs. LA BioMed is academically affiliated with the David Geffen School of Medicine at UCLA and located on the campus of Harbor-UCLA Medical Center. For more information, please visit http://www.


News Article | November 15, 2016
Site: www.sciencedaily.com

West Nile virus may be much more deadly than previously believed, with deaths attributable to the mosquito-borne disease occurring not just in the immediate aftermath of the infection but also years later, long after patients seem to have recovered from the initial illness, according to a new study presented at the 2016 Meeting of the American Society of Tropical Medicine and Hygiene (ASTMH). "While we understand the current focus on Zika virus, for many people in the United States today, West Nile virus is the much more serious mosquito-borne threat and that threat may persist even for patients who appear to have survived the infection unscathed," said Kristy O. Murray, DVM, PhD, of Baylor College of Medicine and Texas Children's Hospital, who is the principal author of the study. Murray and her colleagues looked at 4,144 West Nile virus (WNV) infections that occurred in Texas between 2002 and 2012, focusing on both "acute" deaths recorded in the first 90 days after infection and also on WNV patients who died months to years later -- yet far sooner than other people of similar age and overall health condition. The researchers found there were 286 people who died in the acute phase of WNV. But after examining causes of deaths and symptoms from the initial infection, Murray and her colleagues concluded that 268 people who survived infection subsequently died early (they call it "delayed mortality") due to the virus. Overall, counting both the acute and delayed group, the researchers attributed 554 deaths to WNV during the 10-year period, a 13 percent fatality rate. That's much higher than the 4 percent national fatality rate for WNV recorded between 1999 and 2015 by the U.S. Centers for Disease Control and Prevention (CDC), though those statistics accounted only for deaths that occurred during the acute phase of illness. WNV, which also can infect birds that help spread the virus further, has been detected in all of the lower 48 states since it was introduced into the United States in 1999. It belongs to the same family of viruses as Zika and yellow fever. Like Zika, most people infected with WNV never experience symptoms. Those who do typically have a fever, nausea, fatigue or a rash, though in rare cases, it can cause severe neurological complications that can lead to swelling of the brain and spinal cord. There is not a specific treatment for WNV infections nor is there a vaccine to prevent it. Murray noted that the Texas study is the largest study to date to investigate what has been seen in much smaller groups of WNV patients, which is that the disease appears capable of causing health problems years after someone is over the initial infection. "For several years, we had followed smaller groups of patients and felt that many had died prematurely," Murray said. "We saw many people who were otherwise healthy until they had West Nile virus -- and then their health just went downhill." Murray said most of the delayed deaths were clustered around a large outbreak of WNV in Texas in 2012, which means they occurred just a few years after the initial infections. But Murray said other early deaths were recorded up to 10 years after the initial epidemic of West Nile. She said her research team feels confident in its conclusions because, for each patient, they had access to both information about the course of the initial infection and records maintained by the Texas state death registry that document cause of death. Murray said that the delayed deaths appeared to be more common in patients who had suffered significant neurological complications during the acute phase of their illness. Also, for patients suffering delayed deaths, Murray said kidney disease, increasingly suspected as a potential long-term complication of WNV, was statistically found to be a significant cause of death. Murray was the principal investigator of a 2012 study that followed 139 patients diagnosed with WNV and found 40 percent of them developed chronic kidney disease. Murray said kidney issues caused by WNV could also explain why it was not just elderly patients who were found to be at risk of delayed death but especially patients under 60 years old. "We had been surprised in the 2012 study to see so much chronic kidney disease develop in younger West Nile patients because it's not that common in people under 60," she said. "In much the same way that research into Zika virus is showing a more destructive virus than originally thought, we are still discovering previously unreported long-term destructive effects of West Nile," said Stephen Higgs, PhD, president of the American Society of Tropical Medicine and Hygiene. "Those of us in the tropical medicine community have long been concerned that West Nile is a significant public health problem and that U.S. federal investments are warranted in finding better ways to treat and prevent it."


News Article | April 24, 2016
Site: www.techtimes.com

A new report mulls options on how female astronauts can manage menstrual bleeding while on a space mission. Researchers from King's College London and Baylor College of Medicine are exploring the idea of suppressing menstruation during space missions with the use of contraceptive devices, which are presently being used by aviation staff and military personnel. Discontinuing menstruation during space missions is a popular choice for astronauts because of the challenges faced during spaceflight. Some astronauts time short duration missions with their menstrual cycles. But this is not possible during long-haul spaceflights. For longer missions, astronauts suppress their menstrual period by using combined oral contraceptive (COC) pills. Past studies have shown that microgravity in space cause the bone to lose minerals making astronauts prone to osteoporosis later in life. The paper suggests that extensive studies should be done to identify whether continued use of COCs factor in bone demineralization. Menstruation in space has much impracticality. Packaging of pills and tampons contributes to the mass and disposal issues aboard the International Space Station (ISS). Menstrual blood disposal is also challenging as ISS's waste disposal system only allows for reclamation of water from urine. The paper suggests the use of long acting reversible contraceptives (LARCs) like subdermal implants and IUDs. LARCs would omit the packaging and disposal issue and management in-flight. The report stated that LARCs are not seen to hinder tasks. Moreover, no notable information suggests that G-loading during space launch or landing displaces the IUD or subdermal implant. Varsha Jain, a researcher at the Centre of Human and Aerospace Physiological Sciences (CHAPS), said that early studies of women in the military revealed that there is a high preference to suppress menstruation during deployment. Jain said that since more and more women are joining space missions, it is important that they have the proper information about menstrual suppression and the options available for them, if any. Due to the challenges faced in studying female astronauts, the report recommends that pharmacological data during spaceflights should be compared with and complemented by ground-based studies. Assistant Professor at the Centre for Space Medicine Virginia Wotring said that women should be given options catered to her lifestyle and needs. She acknowledges that spaceflight environment during menstruation can be particularly challenging and recommendations on how to suppress it should not be given haphazardly. "[W]e need more data regarding health effects, including bone health, with long-term use of hormone treatments, not just for contraception (as most women use them), but also for the less-common use to suppress menses," Wotring said. © 2016 Tech Times, All rights reserved. Do not reproduce without permission.


News Article | November 10, 2016
Site: www.eurekalert.org

Chagas disease (Trypanosoma cruzi infection) is a parasitic infection that can lead to fatal cardiac disease. While Latin America is known as an endemic area, there have been relatively few studies investigating the prevalence of Chagas disease in the Rio Grande Valley of Texas. A paper published in PLOS Neglected Diseases led by researchers at the National School of Tropical Medicine at Baylor College of Medicine suggests that the disease burden in southern Texas is much higher than previously thought. Considering up to 30% of people infected with Trypanosoma cruzi can develop fatal cardiomyopathy, this study's findings carry important implications to the health of the population of south Texas. "Kissing bugs", (triatominae) who feed on both humans and animals, are the vectors primarily responsible for the transmission of Chagas disease. The disease is predominantly found in impoverished regions where substandard living conditions can lead to increased exposure to the parasitic kissing bugs. In order to assess the infection status of vectors and seroprevalence among human and mammal populations living in in the lower Rio Grande Valley, Dr. Melissa Nolan Garcia, instructor of pediatrics at Baylor who is also with Texas Children's Hospital, and colleagues tested kissing bug vectors and retrospectively analyzed previously collected sera from coyotes, stray dogs, and human participants. Out of 841 human sera samples, 3 people (0,4%) tested positive for T. cruzi, while 8% of coyotes and 3.8% of stray dogs were found to be infected. Among the insects sampled, 56.5% were found to be T. cruzi carriers. Based on the findings of the study, the authors estimate that around 4,600 people in the Rio Grande Valley are currently infected with Chagas disease, and of those, an estimated 1,300 are at risk for developing cardiomyopathy. These results not only confirm the risk for disease transmission in south Texas, but indicate that the regional burden of Chagas disease is 23 times higher than previously estimated. The study does have limitations, as the authors acknowledge that the specimens were originally collected for other studies, and they are now conducting larger, more extensive surveillance studies targeting Chagas risk in this region. Overall, the findings point to a greater need for attention to Chagas disease in United States, particularly the identification of high risk groups. The authors assert that, "with up to 30% of infected individuals developing a potentially fatal cardiac disease, it is imperative that we identify and treat patients before heart disease occurs." Please contact plosntds@plos.org if you would like more information about our content and specific topics of interest. All works published in PLOS Neglected Tropical Diseases are open access, which means that everything is immediately and freely available. Use this URL in your coverage to provide readers access to the paper upon publication: http://dx. (Link goes live upon article publication) Funding: This study was supported in part by MD000170 P20 funded from the National Center on Minority Health and Health Disparities, the Centers for Translational Science Award 1U54RR023417-01 from the National Center for Research Resources and the Centers for Disease Control Award RO1 DP000210-01, the United States Department of Defense, Army (W81XWH-04-2-0035), the Drugs for Neglected Diseases Initiative (DNDi), and NIH/NIAID 1R21AI114877-01A1. TPF and RP are supported by the NIH grant 5R25GM100866-02 564 awarded to Robert K. Dearth and Jason G. Parsons. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist.


News Article | March 1, 2017
Site: www.eurekalert.org

HOUSTON ? Anyone who uses an employee badge to enter a building may understand how a protein called ENL opens new possibilities for treating acute myeloid leukemia (AML), a fast-growing cancer of bone marrow and blood cells and the second most common type of leukemia in children and adults. Findings from a study at The University of Texas MD Anderson Cancer Center revealed the leukemia-boosting abilities of ENL, which contains a protein component called YEATS that "reads" histone proteins. Histone proteins make up chromatin, large clusters of DNA- and RNA-containing molecules comprising our body's chromosomes. Just as a scanner "reads" data on an identification badge, ENL recognizes a type of histone modification known as acetylation. Research results, which build upon a previous MD Anderson study of histone-reading proteins, are published in the March 1 online issue of Nature. The findings indicated treatment against ENL with a class of experimental drugs called bromodomain and extra-terminal (BET) inhibitors may be effective for treating AML. "Our study showed that ENL is required for disease maintenance in AML," said Xiaobing Shi, Ph.D., associate professor of Epigenetics and Molecular Carcinogenesis. "Depletion of ENL led to anti-leukemic effects, suppressing growth both in vivo and in vitro. Notably, disrupting ENL further sensitized leukemia cells to BET inhibitors." Histone modifications like acetylation serve as docking sites for reader proteins which recognize specific modifications, influencing downstream biological outcomes. While many such reader proteins have been identified for histone modifications called methylation, few are known to recognize histone acetylation. Shi's team employed CRISPR, a gene-editing tool, to deplete ENL and suppress cancer gene expression, which was crucial given that cancer cells often co-opt chromatin regulatory pathways. "Targeting epigenetic readers represents a class of anti-cancer therapy that we believe holds clinical promise," said Hong Wen, Ph.D., research assistant professor of Epigenetics and Molecular Carcinogenesis and co-first author of the paper. "Our study revealed ENL as a chromatin reader that regulates oncogenic programs, thus establishing ENL as a potential drug target for AML." MD Anderson study team members included Xiaolu Wang of the Department of Epigenetics and Molecular Carcinogenesis. Other participating institutions included The Rockefeller University, New York; Memorial Sloan Kettering Cancer Center, New York; Dana-Farber Cancer Institute, Boston; Tsinghua University, Beijing; Baylor College of Medicine, Houston; Icahn School of Medicine at Mount Sinai, New York; and Harvard Medical School; Boston. The study was funded by the National Institutes of Health (P30CA016672, RO1CA204639-01, CA66996, CA140575, 1R01CA204020, R01HG007538 and R01CA193466), the Cancer Prevention Research Institute of Texas (RP160237 and RP170285), the Leukemia and Lymphoma Society (LLS-SCOR 7006-13), the Robert A. Welch Foundation (G1719), the Major State Basic Research Development Program in China (2016FA0500700 and 2015CB910503), and the Tsinghua University Initiative Research program.


News Article | February 28, 2017
Site: www.eurekalert.org

Tens of millions of Americans with lung disease use metered-dose inhalers each day, and new studies by Rice University electrical engineers and pulmonologists at Baylor College of Medicine have identified critical errors that are causing many inhaler users to get only about half as much medicine as they should from each puff. "Metered-dose inhalers are used every day by people with asthma, COPD and other chronic lung diseases, and the vast majority of the time -- between 70 and 90 percent -- patients make mistakes that keep some of the medicine from making it to their lungs," said Ashutosh Sabharwal, professor of electrical and computer engineering at Rice and co-author of two recent studies about the phenomenon. "While inhalers are the most efficient delivery mechanism for many patients, these devices require deft maneuvers on the part of patients. The common errors are well-known, but fixing them continues to be a challenge." Sabharwal's team at Rice's Scalable Health Lab uses the latest electronic technology -- smartphones, wearable devices and inexpensive sensors and components -- to address this and similar health and wellness issues. The lab's creations to date include a self-use retinal imaging system, a mobile spirometer, wearable technology for dietary monitoring and apps for evaluating depression and extracting accurate vitals signs from videos. In partnership with pulmonologist Nick Hanania, associate professor of medicine and director of the Airways Clinical Research Center at Baylor College of Medicine, Sabharwal and Rice graduate student Rajoshi Biswas co-authored of two recent studies aimed at finding out which mistakes are most common and how they impact the amount of medicine that reaches patients' lungs. "For years, we as clinicians have known that our patients do not use their inhalers as they should," Hanania said. "In the best case, a puff from an inhaler results in about 40 percent of the medicine reaching the lungs. In the worst case, if someone does everything wrong, that drops to 7 percent. We know the two extremes, but the vast majority of everyday use falls somewhere in the middle. In this study, we have been able to objectively measure the errors, and, using new technology, learn about their impact on drug delivery to the lungs." Biswas, a Ph.D. student in Rice's Scalable Health Lab, spent six years gathering evidence for the studies. She has measured how patients use inhalers, explored the mathematics of their inhalation patterns, examined how doctors and therapists evaluate inhaler use and created an experimental setup to mimic human inhaler use. The research was spurred by an observation she kept returning to just after she came to Rice in 2011 Virtually all the inhaler-dosing studies she found focused on best-case scenarios, the rare cases where patients used the inhaler perfectly, even though the average case was far from perfect. Biswas said it's important to have accurate dosing information for average use. "What's been lacking is a rigorous quantitative examination of how much medicine is making it to the lungs for those everyday cases," she said. Biswas said errors are common because inhaler use requires precision, timing and coordination. Even the slightest deviation can significantly reduce the amount of medicine that reaches the lungs. For example, in a study in the journal CHEST involving 23 Houston patients who have asthma or COPD, each patient made at least one error. Inhalers should be shaken for a few seconds before each use. Biswas said patients often forget to shake the device or don't shake it long enough, particularly on subsequent puffs. The angle at which the inhaler is held is also critical. Slight deviations can result in much of the medicine striking and sticking to the tongue or mouth. Patients also must draw a breath when they activate the inhaler, and the timing, duration and force of this inhalation are critical. Finally, patients are supposed to hold their breath for 10 seconds to allow for uptake of medicine that reaches the lungs. To model how much medicine reaches the lungs for everyday cases, Biswas started by measuring the airflow characteristics from eight patients as they drew breath at various rates. With that data, she programed a machine to simulate the flow, duration and force of different patterns of human inhalation. This breathing device became one piece of an experimental setup that included a robotic finger to activate the inhaler and a metal tube milled in the precise configuration of an adult mouth and throat. Once the metal "throat" was sprayed with a thin coating of oil, it precisely mimicked the wet, sticky conditions that tend to trap medicine in the mouth and throat of patients. Using these components, she was able to precisely measure how much medicine made it to the lungs in a variety of scenarios where patients mistime their breaths or make other common mistakes. "The thing that matters the most is coordination," she said. "It's vital to start breathing just before or at the exact same time the inhaler is activated. A delay of just a half second between pressing the inhaler and breathing in was enough to limit lung deposition to about 20 percent -- about half of what a patient would get in the ideal case." In cases where the machine started inhaling just before the inhaler was activated, Biswas found that more than 35 percent of medication reached the lungs. "In this situation, where timing is coordinated, the determining factor for lung deposition is the flow rate," Biswas said. "Based on our findings, the ideal scenario is to inhale deeply at higher flow rates for about three seconds to fully inhale, and to activate the inhaler about a half second after starting to inhale. This helps ensure the medication clears the mouth-throat cavity and reaches the lungs." Sabharwal, Hanania and Biswas said they hope the medical community will examine their latest study in the Journal of Aerosol Medicine and Pulmonary Drug Delivery and consider further research to evaluate and update recommended guidelines for inhaler use and set up educational strategies for their patients. "Our results differ from the current Global Initiative for Asthma inhaler use guidelines," Sabharwal said. "The propellant used in inhalers has changed in recent years, and the current guidelines were developed based on studies of the old inhalers. Our findings, coupled with the recent changes in inhaler propellants, suggest it is time to revisit these guidelines." The research was funded partially by the National Institutes of Health. The DOI of the study in the Journal of Aerosol Medicine and Pulmonary Drug Delivery is: 10.1089/jamp.2015.1278 A copy of the study in the Journal of Aerosol Medicine and Pulmonary Drug Delivery is available at: http://online. The DOI of the CHEST paper is: 10.1016/j.chest.2016.08.017 A copy of the CHEST paper is available at: http://dx. This release can be found online at news.rice.edu. Located on a 300-acre forested campus in Houston, Rice University is consistently ranked among the nation's top 20 universities by U.S. News & World Report. Rice has highly respected schools of Architecture, Business, Continuing Studies, Engineering, Humanities, Music, Natural Sciences and Social Sciences and is home to the Baker Institute for Public Policy. With 3,879 undergraduates and 2,861 graduate students, Rice's undergraduate student-to-faculty ratio is 6-to-1. Its residential college system builds close-knit communities and lifelong friendships, just one reason why Rice is ranked No. 1 for happiest students and for lots of race/class interaction by the Princeton Review. Rice is also rated as a best value among private universities by Kiplinger's Personal Finance. To read "What they're saying about Rice," go to http://tinyurl. .


News Article | February 24, 2017
Site: www.eurekalert.org

The genetic material of an organism encodes the instructions that guide its development. These codes are not written in stone; they can change or mutate any time during the life of the organism. Single changes in the code can occur spontaneously, as a mutation, causing developmental problems. Others, as an international team of researchers has discovered, are too numerous to be explained by random mutation processes present in the general population. When such multiple genetic changes occur before or early after conception, they may inform scientists about fundamental knowledge underlying many diseases. The study appears in Cell. "As a part of the clinical evaluation of young patients with a variety of developmental issues, we performed clinical genomic studies and analyzed the genetic material of more than 60,000 individuals. Most of the samples were analyzed at Baylor Genetics laboratories," said lead author Dr. Pengfei Liu, assistant professor of molecular and human genetics Baylor College of Medicine and assistant laboratory director of Baylor Genetics. "Of these samples, five had extreme numbers of genetic changes that could not be explained by random events alone." The researchers looked at a type of genetic change called copy number variants, which refers to the number of copies of genes in human DNA. Normally we each have two copies of each gene located on a pair of homologous chromosomes. "Copy number variants in human DNA can be compared to repeated or missing paragraphs or pages of text in a book," said senior author Dr. James R. Lupski, Cullen Professor of Molecular and Human Genetics at Baylor. "For instance, if one or two pages are duplicated in a book it could be explained by random mistakes. On the other hand, if 10 different pages are duplicated, you have to suspect that it did not happen by chance. We want to understand the basic mechanism underlying these multiple new copy number variant mutations in the human genome." A rare, early and transitory phenomenon that can affect human development The researchers call this phenomenon multiple de novo copy number variants. As the name indicates, the copy number variants are many and new (de novo). The latter means that the patients carrying the genetic changes did not inherit them from their parents because neither the mother nor the father carries the changes. In this rare phenomenon, the copy number variants are predominantly gains - duplications and triplications - rather than losses of genetic material, and are present in all the cells of the child. The last piece of evidence together with the fact that the parents do not carry the alterations suggest that the extra copies of genes may have occurred either in the sperm or the egg, the parent's germ cells, and before or very early after fertilization. "This burst of genetic changes happens only during the early stages of embryonic development and then it stops," Liu said. "Interestingly, despite having a large number of mutations, the young patients present with relatively mild neurological problems." The researchers are analyzing more patient samples looking for additional cases of multiple copy number variants to continue their investigation of what may trigger this rare phenomenon. "We hope that as more researchers around the world learn about this and confirm it, the number of cases will increase," Liu said. "This will improve our understanding of the underlying mechanism and of why and how pathogenic copy number variants arise not only in developmental disorders but in cancers." "A new era of clinical genomics-supported medicine and research" This discovery has been possible in great measure thanks to the breadth of genetic testing performed and genomic data available at Baylor Genetics laboratory. "The diagnostics lab Baylor Genetics is one of the pioneers in this new era of clinical genomics-supported medical practice and disease gene discovery research," Lupski said. "They are developing the clinical genomics necessary to foster and support the Precision Medicine Initiative of the National Institutes of Health, and generating the genomics data that further drives human genome research." Using state-of-the art technologies and highly-trained personnel, Baylor Genetics analyzes hundreds of samples daily for genetic evaluation of patients with conditions suspected to have underlying genetic factors potentially contributing to their disease. Having this wealth of information and insight into the genetic mechanisms of disease offers now the possibility of advancing medicine and basic research in ways that were not available before. "There is so much that both clinicians and researchers can learn from the data generated in diagnostic labs," Liu said. "Clinicians receive genomic information that can aid in diagnosis and treatment of their patients, and researchers gather data that can help them unveil the mechanisms underlying the biological perturbations resulting in the patients' conditions." Other contributors to this work include Bo Yuan, Claudia M.B. Carvalho, Arthur Wuster, Klaudia Walter, Ling Zhang, Tomasz Gambin, Zechen Chong, Ian M. Campbell, Zeynep Coban Akdemir, Violet Gelowani, Karin Writzl, Carlos A. Bacino, Sarah J. Lindsay, Marjorie Withers, Claudia Gonzaga-Jauregui, Joanna Wiszniewska, Jennifer Scull, Pawel Stankiewicz, Shalini N. Jhangiani, Donna M. Muzny, Feng Zhang, Ken Chen, Richard A. Gibbs, Bernd Rautenstrauss, Sau Wai Cheung, Janice Smith, Amy Breman, Chad A. Shaw, Ankita Patel and Matthew E. Hurles. The researchers are affiliated with one of more of the following institutions Baylor, Wellcome Trust Sanger Institute in the U.K., Fudan University in China, the University of Texas MD Anderson Cancer Center Houston, the Clinical Institute of Medical Genetics in Slovenia and the Medical Genetics Center in Germany. This work was supported in part by grants from the US National Institute of Neurological Disorders and Stroke (R01NS058529), the National Human Genome Research Institute (U54HG003273), a joint NHGRI/National Heart Blood and Lung Institute grant (U54HG006542) to the Baylor Hopkins Center for Mendelian Genomics, and the BCM Intellectual and Developmental Disabilities Research Center, IDDRC Grant Number 5P30HD024064-23, from the Eunice Kennedy Shriver National Institute of Child Health and Human Development. The work was also partially supported by the Wellcome Trust (WT098051).


News Article | November 16, 2016
Site: www.techtimes.com

The West Nile Virus infection could be deadlier than previously thought, reports a recent study presented at the 2016 American Society of Tropical Medicine and Hygiene meeting. The mosquito-borne disease is found to cause fatalities even years after initial exposure to the virus. Kristy O. Murray, the lead author of the study from the Baylor College of Medicine and Texas Children's Hospital said that, amid Zika virus threats prevailing in the United States, it was found that WNV is potentially fatal in people affected with the virus years after infection. WNV infection that first appeared in the United States in 1999 infected around 45,000 people and claimed the lives of about 2,000 people accounting to four percent of fatality rate in the country. The WNV also belongs to the family of viruses that cause yellow fever and Zika. People infected with WNV do not experience any symptoms much similar to Zika infection. However, in rare cases some people experience symptoms like fatigue, rash, fever and nausea. The complications of WNV infection include swelling of brain and spinal cord. Though WNV is known to be potentially fatal, no vaccine to prevent or treatment to contain the infection is found by far. For the purpose of the study, Murray and her team studied 4,144 WNV cases reported in Texas between 2002 and 2012. The researchers reviewed acute fatalities that occurred in first 90 days of infection as well as deaths that were reported months and years after infection. About 286 people were reported to have died of acute WNV infection and around 268 patients were found to have survived the disease. However, on deliberate analysis, it was found that all the patients that survived initial infection have died subsequently in upcoming months. The overall deaths from WNV infection from both acute and delayed mortalities between 2002 and 2012 were found to be 554, which accounts to 13 percent of fatality rate in the country. The figure is much higher than four percent fatality rate between 1999 and 2015 reported by the U.S. Centers for Disease Control and Prevention. In addition Murray found in a study in 2012 that among 139 patients infected with WNV about 40 percent of them developed kidney diseases. It is therefore clear that the WNV infection leads to chronic kidney diseases not only in elderly but also in patients under 60 years of age. "We had been surprised in the 2012 study to see so much chronic kidney disease develop in younger West Nile patients because it's not that common in people under 60," Murray said. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.


News Article | December 6, 2016
Site: www.sciencemag.org

In a hospital conference room here in Saudi Arabia's capital, a lieutenant colonel in the Saudi army, dressed in fatigues and a black beret, stoically tells a story of genetic casualties. His and his wife's first child, born in 2004, seemed healthy at first, but at 6 months old the baby girl could not yet sit up and barely cried. Doctors in France, where the family was living at the time, found no explanation. "We were sure that lack of oxygen" during delivery had caused brain damage, the father says. Although their next baby, a boy, was healthy, a second girl born 5 years later had similar developmental delays. Meanwhile, the officer's sister had given birth to six children, two healthy but four with similar medical problems: Each had crossed eyes and an IQ below 70, didn't talk, and didn't walk until about age 5. Both the lieutenant colonel, who asked not to be identified, and his sister had married first cousins, who were also related. Suspicions that this close kinship played some role in their kids' problems led the two families to this clinic at King Faisal Specialist Hospital and Research Centre (KFSHRC) and into the care of Fowzan Alkuraya, a young Saudi geneticist who had recently returned from the United States. Some months after the families gave him DNA samples, Alkuraya delivered the results: All four parents carried one copy of the exact same disease mutation, a change of a single DNA base in a gene called ADAT3. Although the mutation was harmless to the parents because each retained a working copy of the gene, their severely disabled children had inherited two faulty copies. As a result, their cells couldn't make an enzyme that helps translate DNA into proteins. Alkuraya's news brought the families some measure of comfort, and hope. "It was a big relief for my wife, for me, for my sister, for everyone" to know what had gone wrong, the officer says. Hoping to break their bad genetic luck, he and his wife decided they would turn to in vitro fertilization (IVF) and use preimplantation genetic diagnosis to select embryos that inherited no ADAT3 mutation. They now have 2-year-old twins, a boy and a girl. "And they are perfectly healthy," the father says. The officer's family is one of hundreds that have come to Alkuraya, 39, who may be the country's leading genetics sleuth. His work is part of a boom in human genetics research in Saudi Arabia over the past decade, which has culminated in a Saudi version of a human genome project, called the Saudi Human Genome Program (SHGP). Largely because many Arabs marry cousins or other close relatives, the country, like others in the Middle East, has an increased rate of inherited genetic diseases—nearly double the rate in Europe and the United States and 10 times higher for certain disorders, according to some estimates. As a result, the country has long drawn Western scientists eager to bag disease genes new to science. But Alkuraya and other geneticists here at KFSHRC are bringing such research home. They are harnessing cheap, next-generation DNA sequencing to pin down mutations underlying unexplained diseases, cranking through more than 10,000 cases in the past 5 years. Although most of the solved cases involve known mutations, some have yielded novel disease genes— more than 200 from Alkuraya's group alone, including ADAT3. The output of the relatively small team rivals that of larger groups of disease gene hunters in the United States and Europe, colleagues say. "I am very impressed with what [Alkuraya] has achieved in Saudi Arabia," says Joris Veltman, a human geneticist at Radboud University Medical Center in Nijmegen, the Netherlands. Alkuraya and his colleagues hope the growing catalog of disease mutations they have found will not only help individual families with inherited diseases have healthy babies, but lead to premarriage DNA tests for young people that could bring down the high rate of those diseases here. The broader sequencing effort could also have payoffs beyond the Middle East. The country's closely related population should make it easier to identify "healthy knockouts"—people who lack both copies of a specific gene yet remain healthy and even gain protection against disease, providing clues to new drugs. "If there's any place they should be discovered, it's here," Alkuraya says. But first, Saudi geneticists will have to get past the worsening budget crisis here triggered by the global drop in oil prices. Funding is on hold for the next phase of the overall genome project, and even ongoing research grants, including Alkuraya's, have been slashed this year. It's vital that his gene sleuthing and other genomics efforts in the country don't stall out, observers say. As human geneticist Daniel MacArthur of the Broad Institute in Cambridge, Massachusetts, notes, "There's no question the opportunities there are massive." Outside the research wing of KFSHRC on the traffic-clogged streets here, women cannot mingle with unrelated men and must wear a loose black robe called an abaya. But in this surprisingly cosmopolitan space, women swap their abayas for lab coats and work side by side with male staff. Some take off their head scarves, but others retain their black face veils, known as niqabs, even in the lab. Such adherence to tradition helps explain why about 40% or more of native Saudis—two-thirds of the country's 30 million people—still marry first cousins or other close relatives. The practice, once common in Europe, lives on in much of the Middle East today, helping preserve wealth and tribal ties. But the downside of consanguineous marriage is a relatively high risk for recessive genetic diseases, which develop when both the maternal and paternal copy of a gene are faulty. If both parents carry the same recessive disease mutation, their children have a 25% chance of inheriting two copies and developing the disease; and in the large families still common in Saudi Arabia, the genetic dice are rolled repeatedly. By one estimate, 8% of babies in Saudi Arabia are born with a genetic or partly genetic disease, compared with 5% in most high-income countries. Often the diseases have never been seen before. For decades, Middle Eastern clinicians puzzled by these cases have called in European or U.S. scientists, who collected DNA samples from the afflicted families and claimed lead authorship on papers describing new disease genes. After the draft human genome was unveiled in 2001, the country's homogeneous population—made up of about two dozen major tribes descended from a small number of founders— also attracted broader genetics efforts. Brian Meyer, an Australian expat scientist who has long worked in Saudi Arabia and now chairs the KFSHRC genetics department, recalls a proposal from genome sequencing pioneer Craig Venter to launch a company modeled after Iceland's deCODE, which would have mined the DNA of Saudis for drug targets. The plan fizzled out because of local concerns about privacy and exporting genetic data for commercial purposes, however. "The population wasn't ready," Meyer says. Saudi Arabia also declined to contribute DNA samples to HapMap, an international effort to map human genetic diversity that began in 2002. Middle Easterners are still virtually missing from human genome reference databases, a problem some Arab scientists are now trying to remedy. In the late 1990s, however, the seeds of a Saudi genome effort began to take root. After finding that the mutations causing cystic fibrosis in Saudis were different from those in Europeans, KFSHRC geneticists began to do their own disease gene hunting. Alkuraya soon joined the chase. A star medical student from a small town in Saudi Arabia's north, Alkuraya says he realized that the nation's inherited diseases were a "major problem"—and an unparalleled research opportunity. After training in the United States in pediatrics and medical genetics, he completed a postdoc in developmental genetics at the Harvard University-affiliated Brigham and Women's Hospital in Boston and became first author on a 2006 paper in Science on a gene that controls palate formation. Alkuraya could have found a U.S. faculty position and traveled to Saudi Arabia to collect disease cases, but he worried that "I would have felt like an opportunist." In 2007, he returned to launch his own research group at KFSHRC and nearby Alfaisal University. He's acutely aware of what he's missing compared with Boston: In Riyadh, he has no world-class experts from other disciplines down the hall with which to exchange ideas and faces long delays in getting reagents such as antibodies. To stay productive—he's published more than 270 papers since he got back—he juggles multiple projects. "You really need to anticipate everything ahead of time," he says. In his gene hunt, Alkuraya takes advantage of a shortcut known as exome sequencing, which analyzes just the 1% of DNA in a genome that codes for proteins. Instead of scanning entire genomes for mutated genes, a disease hunter can just compare the exome of a sick child with one or two exomes of normal, healthy people, such as the child's parents—a process that takes weeks rather than years. In 2011, Alkuraya's team used that exome strategy for the first time to find a new disease gene: DOCK6, which causes limb malformations when mutated. The team picked up its pace 3 years ago when Saudi Arabia announced plans for a 100,000-person genome project modeled after efforts in countries such as the United Kingdom and Iceland. Saudi leaders decided to focus a $40 million pilot project on diagnosing patients with single-gene diseases who are recruited by physicians at Saudi research institutions. That proved to be a "wise decision," says Sultan Al-Sedairy, the project's principal investigator and executive director of KFSHRC. The Saudi genome team uses two shortcuts to find the culprit mutations. In one, instead of sequencing a patient's full exome, the genome project analyzes only the genes most likely to be involved in the condition—genes already tied to facial malformations for those with facial abnormalities, for example. The project assembled a team of some 90 geneticists, clinicians, and others, who developed 13 panels of known disease genes for conditions such as deafness, vision loss, heart disease, and metabolic disorders. This "Mendeliome" approach, the SHGP reported in Genome Biology last year, diagnosed 43% of 2357 cases for about $75 to $150 a person within days. That success rate, from a cut-rate approach, impresses observers. (The team solved another 11% using costlier exome sequencing.) Although clinical geneticists in other countries have begun using gene panels before turning to exome sequencing, "people haven't systematically done it the way they have in Riyadh," says geneticist James Lupski of Baylor College of Medicine in Houston, Texas. "I think we can learn things from them." If the Mendeliome strategy doesn't pinpoint the responsible mutation, the team can also try to take advantage of the second shortcut. When the child of a consanguineous union develops a recessive disease, the responsible mutation usually lies within a larger identical block of DNA inherited from both parents. Researchers can therefore ignore most of the child's exome and look for the mutation at fault by only probing these shared parental regions, which they find by scanning the DNA for known markers. "That gives us x-ray vision," Alkuraya says. "You know just where to look." Beyond the practical payoff of diagnosing genetic diseases, the Saudi team is excited by the science it's generating. Among the more than 200 genes newly linked to human illness by Alkuraya's team is one called DNASE1L3 that causes an inherited form of lupus and is being pursued as a drug target for the immune disorder. The group has found dozens of additional genes that cause intellectual disability. Other genes are among the first known to be fatal in early embryonic development. Identifying mutations behind such failed pregnancies is difficult because it requires DNA from the lost embryo, but Alkuraya has enrolled pregnant mothers with a history of miscarriage and collects a fetal tissue sample when they show signs of miscarrying again. He acknowledges that some of his published connections between genes and a disease are preliminary—often a mutation has only been found in one family so far—and that he doesn't do much of the functional work needed to pin down what these genes do. "My philosophy is always to get the genes out" so that other geneticists can build on them, Alkuraya says. The SHGP group soon plans to publish the full database of its genome data on more than 10,000 individuals. Some of these data may also challenge previously reported gene-disease links. In a paper last month in Genome Biology, Alkuraya reports that hundreds of gene variants labeled as pathogenic in other databases are commonly found in Saudis without the relevant disease. In the next phase of the SHGP, researchers want to study common disorders such as heart disease and diabetes—a rare inherited form of diabetes afflicts some Saudis—and personalize cancer therapies based on a person's DNA. Alkuraya also aims to recruit up to 10,000 people who receive health care at KFSHRC in hopes of finding healthy knockouts, a potential boon to drug developers. A Texas woman lacking the gene PCSK9, for example, led to a new class of drugs that drastically reduces cholesterol by mimicking the effect of the gene knockout. The hunt should be easier in Saudi Arabia's consanguineous population. "I'm really optimistic that we're going to find something like" PCSK9, Alkuraya says. All of this will depend on funding, however. The Saudi government has approved $200 million in the budget of the country's main science agency, King Abdulaziz City for Science and Technology (KACST) here, to fund the next 5 years of the SHGP, including the purchase of the latest DNA sequencers, which Alkuraya hopes to use. But the money hasn't yet been released, and existing funds dwindled this year. Alkuraya's own grants have been cut by 50% and his lab has been unable to replace equipment for the past 2 years. But Alkuraya says that for the moment, he's not too worried about his science. "I'm sitting on so much data. If I were to shut my lab down now, I could continue to write papers for the next 3 years." While the genomics research slows, what has been learned so far is starting to pay off for Saudi families. There is often little to be done for children who inherit a recessive disease, but genetic knowledge can save future children from a similar outcome. In addition to selecting IVF embryos without disease mutations, potential Saudi parents can turn to prenatal diagnosis if the wife is already pregnant. (Islamic law allows abortion to save the mother's life, and clerics in Saudi Arabia have ruled that this also applies before 120 days of gestation if she is likely to have a severely malformed fetus.) Five years ago, about 80 families a year came to KFSHRC's prenatal diagnostics lab for genetic testing. Now, about 500 families annually seek testing, and as a result as many as 125 pregnancies have been terminated because the babies would have had severe or fatal diseases. "That's a huge economic burden on the country that we have eliminated," says geneticist Faiqa Imtiaz, who heads the hospital's prenatal testing lab. Ultimately, the Saudi genome team would like to screen all 150,000 Saudi couples who plan to marry each year for disease genes. Each couple is now required by the Ministry of Health to have their blood biochemically analyzed for signs they are carriers of sickle cell anemia and thalassemia, two genetic diseases that are common here. If DNA testing were done instead, "the same sample could be used for thousands of diseases," Meyer says. He says that the SHGP's next phase includes a plan to begin using a custom, chiplike device, known as a genotyping array, to screen couples' DNA samples for the 2300 most common disease mutations in the Saudi population. Earlier screening, perhaps in high school before a marriage is arranged or a couple falls in love, might be even more effective, Alkuraya says. "We can't change the culture, but just by screening and prevention we can help people," adds his colleague Dorota Monies, a Polish expat researcher who has lived in Riyadh for more than a decade and who runs the DNA sequencers for the genome project. Such a compulsory national test for that many genetic diseases would be "unparalleled in scale," says Stephen Kingsmore, a geneticist at Rady Children's Hospital in San Diego, California. The country would also have to greatly expand its cadre of genetic counselors—it now has just nine. "If you have proper counseling in the clinic, then they understand and stop the marriage," says Ayman Alsulaiman, a genetic counselor at KFSHRC who consults for the Ministry of Health's current premarital screening program. "With no proper counseling, they don't listen." In the meantime, the Saudi team encourages parents who have a child with a genetic disorder to have their immediate and extended family tested, to reduce the risk in future births. This can be a sensitive matter, says Shatha Al Rasheed, a research genetic counselor with KACST. A mother may worry that her husband will take a second wife if he learns they both carry a disease gene. Or families may fear that their sons and daughters will never get married. But most families end up sharing the information: "I feel success stories are much more common than negative ones," Al Rasheed says. Mohammad Al Samel, a 27-year-old medical student in his residency in Jeddah, Saudi Arabia, grew up with three siblings severely disabled by a mutation identified by Alkuraya's lab. After their diagnosis, Al Samel agreed to have his DNA tested and learned that he is a carrier of the same genetic flaw. His fiancée is also being tested, even though the two aren't related and she's unlikely to have the mutation. If she does, Al Samel says, they will still marry but consider "other solutions" such as IVF to avoid having a sick child. "I didn't have brothers or sisters who were healthy enough to play with me, and we had to stay in the hospital for long times," he says. "I don't want my kids to have the same memories. You cannot imagine."


News Article | October 26, 2016
Site: www.eurekalert.org

New Rochelle, NY, October 24, 2016--When Smart Snacks sold in schools-reformulated versions of less nutritious snacks sold in stores--are packaged to look like their commercial counterparts, consumer confusion is likely, compromising dietary health gains and affecting perceptions about both brands and schools, according to an article in Childhood Obesity, a peer-reviewed journal from Mary Ann Liebert, Inc., publishers. The article is available free on the Childhood Obesity website until November 28, 2016. Jennifer Harris, PhD, MBA and Marlene Schwartz, PhD, University of Connecticut, Hartford, and Maia Hyary, MPA, Brandeis University, Waltham, MA, examine these issues in the article entitled "Effects of Offering Look-Alike Products as Smart Snacks in Schools". The researchers compared how students and parents rated look-alike Smart Snacks and store versions of the same snacks based on taste, healthfulness, and intent to purchase. The finding that most of the study participants wrongly believed that they had seen Smart Snacks sold in stores demonstrated consumer confusion. The authors caution that the look-alike Smart Snacks available in schools could lead people to believe that the same brands sold in stores meet similar nutritional standards. "This important study highlights the confusion students and parents experience when viewing nutritionally different versions of similar food items marketed in schools versus in stores," says Childhood Obesity Editor-in-Chief Tom Baranowski, PhD, Baylor College of Medicine, Houston, TX. "The fact that students rated the healthier versions of the snacks as equal in taste to the unhealthy versions is an important milestone for healthy snacks. Hopefully this article will lead to a national discussion about what types of foods parents, students, and citizens in general want offered in schools." Childhood Obesity is a bimonthly peer-reviewed journal, published in print and online, and the journal of record for all aspects of communication on the broad spectrum of issues and strategies related to weight management and obesity prevention in children and adolescents. Led by Editor-in-Chief Tom Baranowski, PhD, Baylor College of Medicine, and Editor Elsie M. Taveras, MD, MPH, Massachusetts General Hospital for Children & Harvard Medical School, the Journal provides authoritative coverage of new weight management initiatives, early intervention strategies, nutrition, clinical studies, comorbid conditions, health disparities and cultural sensitivity issues, community and public health measures, and more. Complete tables of content and a sample issue may be viewed on the Childhood Obesity website. Mary Ann Liebert, Inc., publishers is a privately held, fully integrated media company known for establishing authoritative medical and biomedical peer-reviewed journals, including Metabolic Syndrome and Related Disorders, Population Health Management, Diabetes Technology & Therapeutics (DTT), and Journal of Women's Health. Its biotechnology trade magazine, GEN (Genetic Engineering & Biotechnology News), was the first in its field and is today the industry's most widely read publication worldwide. A complete list of the firm's 80 journals, newsmagazines, and books is available on the Mary Ann Liebert, Inc., publishers website.


News Article | October 12, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. When relevant (such as experiments requiring multiple trials), randomization was carried out. Behavioural trial experiments were randomized. There was blinding of initial allocation of animals into groups, but not thereafter. Cell counts were blinded. All animals used in this study were treated in compliance with US Department of Health and Human Services and Baylor College of Medicine IACUC guidelines. For the studies reported here, both male and female mice were considered for analyses. Standard pellet mouse chow (Harlan, 2920X) was used for all experiments, and all animals were maintained on a normal 12-h light–dark cycle. Chat-cre (B6;129S6-Chattm2(cre)Lowl/J), Pomc-EGFP (C57BL/6J-Tg(Pomc-EGFP)1Low/J), Npy-hrGFP (B6.FVB-Tg(Npy-hrGFP)1Lowl/J), ChatloxP/loxP (B6.129-Chattm1Jrs/J), R26LSL-tdTomato (B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J), and Vgat-cre (Slc32a1tm2(cre)Lowl/J) mice were originally purchased and are available from Jackson Laboratories. Chat-cre+/−; R26LSL-tdTomato/+ mice were generated by crossing heterozygous male Chat-cre+/− mice with female homozygous R26LSL-tdTomato mice. ChatloxP/loxP animals were bred and maintained as homozygotes. A Vgat-cre homozygous male was crossed to female C57BL/6J mice to generate heterozygous Vgat-cre+/− animals. Chat-cre+/−, Pomc-EGFP+/− and Npy-hrGFP+/− mice used in this study were maintained as heterozygotes and bred to wild-type C57BL/6J female mice. Genotyping for ChatloxP/loxP, Pomc-EGFP, and Npy-hrGFP animals was done according to available Jackson Laboratory protocols for these strains. Genotyping for Cre was done using primers for Cre recombinase detection (forward primer: 5′-GCATTTCTGGGGATTGCTTA-3′, reverse primer: 5′-GTCATCCTTAGCGCCGTAAA-3′). Animals were deeply anaesthetized using isoflurane and were transcardially perfused with PBS followed by 10% neutral buffered formalin (NBF, Azer Scientific). Brains were dissected and post-fixed in 10% NBF overnight at 4 °C. Brains were cryoprotected in a 20% sucrose/PBS solution at 4 °C for one day, followed by a 30% sucrose/PBS solution at 4 °C for one more day. Brains were then embedded and frozen in OCT and stored at −80 °C. Brains visualized using endogenous or virally-expressing fluorescent reporters were cut using a cryostat (Leica CM1860) in coronal sections at 25–30 μm. For ChAT and β-endorphin immunohistochemistry, 40 μm free-floating sections were blocked for 1 h at room temperature in 10% horse serum blocking solution, made in PBS-TC (1× PBS, 0.5% Triton-X 100, 0.1 mM CaCl , pH 7.35). Sections were then incubated overnight at 4 °C at a 1:200 dilution of block solution containing goat anti-ChAT primary antibody (Millipore, AB144P) or rabbit anti-β-endorphin primary antibody (Phoenix Pharmaceuticals, H-022-33). Sections were then washed 4 times, 30 min each in plain PBS-TC. Sections were then incubated in secondary antibody (donkey anti-goat Alexafluor-488 or Alexafluor-555, Life Technologies) at a 1:200 dilution for 3 h at room temperature. Sections were then washed 4 times for 30 min each in PBS-TC. All sections were mounted using DAPI Fluoromount-G (Southern Biotech, 0100-20). Detection of fluorescent expression was performed using a Leica TCS SPE confocal microscope under a 10× or 20× objective. For all stereotaxic injections, mice were anesthetized using a ketamine/dormitore mixture and were maintained under anaesthesia using vaporized isoflurane with O . All injections were performed using a stereotaxic apparatus synced to Angle Two software for coordinate guidance. For DTR-mediated cell death of cholinergic neurons, female Chat-cre+/− or Chat-cre+/−; R26LSLtdTomato/+ mice (8–10 weeks old) were bilaterally injected into the horizontal limb of the diagonal band of Broca (HDB, right hemisphere, from bregma: AP = +0.14, DV = −5.80, ML = −1.29; left hemisphere, from bregma: AP = +0.14, DV = −5.74, ML = +1.17) with 500 nl per hemisphere of a Cre-dependent AAV-EF1α-FLEX-DTR-P2A-EYFP-WPRE-hGHpA, serotype DJ/8. For conditional Chat knockout experiments, ChatloxP/loxP animals (8–10 weeks old) were bilaterally injected into the HDB with 300 nl per hemisphere of AAV-EF1α-EGFP-P2A-CRE-WPRE-hGHpA for experimental animals, or AAV-EF1α-EGFP-WPRE-hGHpA for control animals (serotype DJ/8 for both AAVs). For synaptophysin tracing experiments using the EGFP variant, Chat-cre+/− mice (8–16 weeks old) were injected bilaterally into the HDB with 500 nL per hemisphere of a Cre-dependent AAV-EF1α-FLEX-Syn::EGFP-WPRE-hGHpA, serotype DJ/8. For synaptophysin tracing experiments using the mRuby2 variant, Chat-cre+/; Pomc-EGFP+/− mice (12 weeks old) were injected bilaterally into the HDB with 500 nl per hemisphere of a Cre-dependent AAV-EF1α-FLEX-Syn::mRuby2-WPRE-hGHpA, serotype DJ/8. Lastly, for in vivo ChR2 behaviour experiments, male Chat-cre+/− mice (12–14 weeks old) were bilaterally injected into the HDB with 500 nl per hemisphere of a Cre-dependent AAV-EF1α-DIO-hChR2(H134R)-EYFP-WPRE-hGHpA (Addgene, plasmid number 20298) serotype 2/9. Male wild-type animals were fasted overnight before being presented with standard pellet mouse chow (Harlan, 2920X) for 3 h the following morning (fed group), while a second group of mice was fasted overnight but not presented with chow (fasted group). Mice were then immediately euthanized and perfused with PBS and 10% NBF. Brains were fixed overnight in 10% NBF before two overnight fixations in 20% and 30% sucrose/PBS solutions. Brains were frozen in OCT cutting compound and cryosectioned at 35 μm. Sections were then blocked for 1 h at room temperature in 10% horse serum blocking solution, made in PBS-TC (1× PBS, 0.5% Triton-X 100, 0.1 mM CaCl , pH 7.35). Sections were then incubated overnight at 4 °C at a 1:200 dilution of block solution containing goat anti-ChAT primary antibody (Millipore, AB144P) and 1:500 dilution of rabbit anti-c-Fos antibody (Calbiochem, PC38). Sections were then washed 4 times for 30 min each in plain PBS-TC. Sections were then incubated in secondary antibodies (donkey anti-goat Alexafluor-488, and donkey anti-rabbit Alexafluor-546) at a 1:200 dilution each for 3 h at room temperature. Sections were then washed 4 times for 30 min each in PBS-TC. All sections were mounted using DAPI Fluoromount-G (Southern Biotech, 0100-20). Detection of fluorescent expression was performed using a Leica TCS SPE confocal microscope under a 20× objective. After allowing 10–14 days for conditional viral expression (injections and viral construct described previously), mice were intraperitoneally (i.p.) injected 3 times daily for 5 days with 800 ng (4 ng μl−1 working solution) of diphtheria toxin (Sigma, D0564) for optimal cell death of targeted cholinergic neurons. Female Chat-cre+/−; R26LSL-tdTomato/+ mice were used initially to validate DTR-mediated cell death by visualizing DBB cholinergic cell loss. For remaining experiments, female Chat-cre+/− animals were used. For controls, age- and gender-matched Chat-cre+/− mice (stereotaxically injected identically into the DBB with AAV-FLEX-DTR-P2A-EYFP) were injected with equal volume (200 μl per injection) of sterile saline. Body weights and daily food intake were measured and averaged per group for each time point presented. For Chat conditional knockout assays, ChatloxP/loxP mice were injected bilaterally into the HDB as previously described with either AAV-EF1α-EGFP-P2A-CRE-WPRE-hGHpA for conditional knockout animals or AAV-EF1α-EGFP-WPRE-hGHpA for controls. Body weights and daily food intake were measured and averaged per group for each time point presented. For cell counts after Chat conditional knockout, 3 mice from each group were euthanized and brains were sectioned at 40 μm for ChAT immunohistochemistry. 10 sections representing the anterior, central, and posterior areas of the DBB were chosen, and blinded, total cell counts based on ChAT immunoreactivity were tallied. A count from all 10 sections from a single mouse brain were totalled and averaged for each group of 3 mice. Data were normalized to control levels of expression and represented as a mean percentage ± s.e.m. Activity (reported as time active per day), O consumption, and metabolic blood assays were performed by the Baylor College of Medicine Mouse Metabolism Core before obesity phenotypes (3 days after diphtheria toxin (DT) treatment), during early stages of obesity and hyperphagia (3 weeks post-DT treatment), and at late stages of obesity and hyperphagia (3 months post-DT treatment). Activity and O consumption assays were performed using the Oxymax Comprehensive Laboratory Animal Monitoring System (CLAMS, Columbus instruments). Lean mass and body fat content was assessed using quantitative MRI. Blood panel assays for cholesterol, leptin, insulin, and glucose were also performed by the Baylor College of Medicine Mouse metabolism core. Blood was collected via the tail vein. Mice were fasted for 4 h before measuring blood glucose. Paired feeding assays were performed with individually-housed, male DT-treated (DBB-ablated) and saline-treated (non-ablated) animals. Assays for determining the contribution of food intake on maintaining obesity were conducted on animals 12-weeks post-ablation. First, daily body weight and ad libitum food intake for all animals was recorded for 7 days to establish baselines for all animals. Then 1 control mouse and 1 experimental mouse were then randomly paired. All food from experimental cages was removed and only an equivalent amount of food consumed the previous day by a mouse’s respective control partner was introduced to the cage. This restrictive period was done for 21 days. Afterwards, all experimental mice were allowed to resume to feed ad libitum once again and food intake and body weight were measured daily for 2 weeks. Change in body weight over time was normalized as a percentage of day 1 initial starting weight for each individual animal. For paired feeding conducted on animals used for Agrp and Pomc transcript analysis, assays were performed 3 days post-ablation to prevent significant weight gain from hyperphagia. A restrictive feeding period was conducted for 21 days, after which mice were euthanized on the morning after the final day, and hypothalamic tissue was harvested for RNA purification and subsequent qRT–PCR (see below). Concurrent with AAV-EF1α-DIO-hChR2(H134R)-EYFP-WPRE-hGHpA injections (as described previously), male Chat-cre+/− mice were bilaterally implanted with 200 μm silica fibre optic implants made in-house (Thor Labs, TS1249968); 230 μm ferrules (Precision Fibre Products, MM-FER2007C-2300) and situated 0.1 mm above the viral injection site. Fibre optic implants were held in place by a cap made from adhesive cement (C&B Metabond Quick! Cement System (Parkell)) for initial base, and crosslinked flash acrylic (Yates-Motloid, 44115 and 44119) for headcap. Mice were allowed at least two weeks for recovery and expression of the virus before assays were performed. For prolonged 2-day stimulation, each mouse was allowed 48 h to acclimate in a behaviour box with free access to food and water (days 1 and 2: acclimation). In addition, acclimation occurred while tethered to a dual fibre optic cord (Doric Lenses) attached to a 473 nm laser source (CrystaLaser CL-2005). After the 48-h acclimation period, a pre-measured amount of food was placed into the chamber and weighed once every 24 h for two days without stimulation (days 3 and 4: pre-stimulation). Over the next 48 h, food was weighed once each day while mice were chronically stimulated with trains of blue light (5 mW, 10 ms pulses, 20 Hz, 5 s trains, 30 s intervals) (days 5 and 6: stimulation). Finally, food was weighed once every 24 h for two final days with no blue light stimulation (days 7 and 8: post-stimulation). As a control group, non-ChR2-expressing mice were injected and implanted in the identical way used for experimental mice. Control mice were acclimated identically and were subsequently subjected to a mock stimulation for 48 h, and food intake was measured each day. For comparisons between pre-stimulation, stimulation, and post-stimulation conditions, paired Student’s t-tests were used. For comparisons between experimental conditions and the control (mock-stimulation) condition, unpaired Student’s t-tests were used. For short-term 2-h stimulation experiments, mice were given 48 h to acclimate in their behaviour chamber. After acclimation, mice were fasted overnight and subsequently presented with a pre-measured amount of food in the morning. For control conditions, mice were not stimulated and food intake was recorded every 30 min for 2 h total. For experimental conditions, mice were stimulated with trains of blue light (5 mW, 10 ms pulses, 20 Hz, 5 s trains, 30 s intervals) for 15 min before presentation of pre-measured chow, and food intake was recorded every 30 min for 2 h total in presence of continued blue light illumination. Trials were randomized and conducted one week apart on the same animals. For experiments targeted at terminal stimulation in the arcuate nucleus of the hypothalamus, male animals were bilaterally injected into the HDB with AAV-EF1α-DIO-hChR2(H134R)-EYFP-WPRE-hGHpA, and a single fibre optic was implanted into the third ventricle at the level of the arcuate (from bregma: AP = −1.70, DV = −5.75, ML = 0.00). For behavioural assays, animals were first allowed 48 h to acclimate to their behaviour cage while tethered to a fibre optic cord. After acclimation, mice were fasted overnight. In the morning, mice were presented with standard pre-measured pellet chow and food intake was recorded every 30 min for 2 h total either under conditions of light stimulation (5 mW, 10 ms pulses, 20 Hz, 5 s trains, 30 s intervals) or no stimulation. Trials were randomized and conducted one week apart on the same animals. Paired statistics were used to compare ‘stim’ and ‘no-stim’ conditions on these animals. As a control group, Cre-negative male littermates were injected with virus and implanted in the same way as experimental mice. Behavioural assays on these mice were done the same way under conditions of light illumination. Comparisons between mock-stimulated and experimental cohorts were done using unpaired statistics. For terminal stimulation experiments in the presence of mecamylamine (Tocris, catalogue number 2843), mice were fasted overnight and presented with a pre-measured amount of chow in the morning. Mecamylamine was administered by i.p. injection at 1 mg per kg 15 min before the start of a 2-h feeding in the presence or absence of blue light illumination. Control (sterile 1× PBS i.p. injections) and experimental trials were conducted 1 week apart. Brain slices containing the hypothalamic arcuate nucleus were prepared from 6–8-week-old Pomc-EGFP+/− or Npy-hrGFP+/− transgenic mice of either gender. For ChR2 stimulation and hM4d-mediated inhibition, brain slices containing the DBB were prepared from 12–16-week-old male animals expressing either ChR2::EYFP or hM4D–EGFP in the DBB, respectively. Animals were anaesthetized with isoflurane and brains were rapidly removed and transferred into sucrose-based cutting solution, containing (in mM): 250 sucrose, 25 NaHCO , 1.25 NaH PO , 2.5 KCl, 1.5 MgCl , 2 CaCl , 10 glucose, and continuously bubbled with 5% CO / 95% O . 300-μm-thick coronal brain slices were prepared using a Leica VT 1200 vibratome and placed for recovery in a 5% CO / 95% O bubbled regular ACSF solution, containing (in mM): 128 NaCl, 24 NaHCO , 1 NaH PO , 3 KCl, 1 MgCl , 1.6 CaCl , 8 glucose. After at least 1-h recovery and 20–30 min before recording, slices were transferred into a recording chamber continuously perfused at 2 ml min−1 with aforementioned ACSF at 24 °C. POMC-, NPY-, ChR2::EYFP-, and hM4D-expressing neurons were identified by transmitted light DIC and EGFP fluorescent imaging using a Slicescope Pro 6000 optical setup (Scientifica), equipped with a CoolLED pE-100 470 nm excitation light source, 49002- ET-EGFP (FITC/Cy2) emission filter (Chroma Technology), and optiMOS camera (QImaging). Electrical activity of neurons was recorded in whole-cell current clamp mode using a Multiclamp 700b amplifier and a 1440a Digidata interface (Molecular Devices). Pipette solution contained (in mM): 10 KCl, 120 K gluconate, 1 MgCl , 10 HEPES, 1 EGTA, 5 Na2-ATP, 0.01 Na-GTP, pH 7.2. To test the cholinergic effects on POMC and NPY neurons, baseline neuronal activity was prerecorded for at least 10 min to assure a stable firing rate, after which acetylcholine (Sigma-Aldrich, A6625) was added to the bath perfusion at 100 μM. For ChR2 stimulation, 12 consecutive trains of blue light were given at 30 s intervals. Each train lasted for 5 s with 10 ms light pulses delivered at 20 Hz. For recordings from hM4D-expressing cells, we recorded 90 s baseline sweeps and delivered 5 s current injections at 2 pA and 10 pA, spaced 25 s apart. This protocol was repeated again 6 min after CNO bath application. For all recordings, neuronal firing activity was analysed offline using the event detection feature of Clampfit 10.3 software (Molecular Devices). Repeated measures ANOVA with Holm–Sidak multiple comparison, and Sigma Plot 11.0 software (Systat Software) were used for statistical analyses of data, where applicable. For acute acetylcholine responses, a localized 2 s application of acetylcholine (100 mM, Sigma-Aldrich, A6625) was applied near a patched POMC-EGFP neuron (held at −70 mV) using a FemtoJet (Eppendorf). Each recording was performed using a 20-s sweep with an inter-trial interval of 1 min and repeated for 5 sweeps each for baseline, synaptic blockers (10 μM CNQX (Tocris), 20 μM APV (Tocris), 50 μM GABAzine (Tocris), and nicotinic blockers (10 μM mecamylamine (Tocris), 0.1 μM methyllycaconitine citrate (Tocris), and 10 μM dihydro-β-erythroidine hydrobromide (Tocris). R26LSL-tdTomato animals were stereotaxically injected bilaterally with 70 nl of CAV-Cre virus (purchased from the vector core at the Institut de Génétique Moléculaire de Montpellier) targeted to the arcuate nucleus (from bregma: AP = −1.70, DV = −5.80, ML =  ±0.20). Sections through the DBB were obtained and stained for ChAT using the identical ChAT IHC protocol detailed previously. All sections were mounted using DAPI Fluoromount-G (Southern Biotech, 0100-20). Detection of fluorescent expression was performed using a Leica TCS SPE confocal microscope under a 10× or 20× objective. 12-week-old, male Chat-cre+/− mice were sterotaxically injected bilaterally into the DBB (500 nl per hemisphere) with an hM4D–EGFP-expressing AAV (AAV-CBA-FLEX-hM4Di-P2A-EGFP-WPRE-sv40pA, serotype 2/9, Addgene, plasmid number 52536). After a two-week recovery, mice were fasted overnight in their home cage, and food was presented in the morning. Food intake was measured every 30 min for 2 h total, in the presence or absence of CNO. For control experiments, mice were injected i.p. with sterile saline and allowed to wait 15 min before food presentation. For experimental conditions, mice were injected i.p. with CNO (5 mg per kg) and allowed to wait 15 min before food presentation and measurement, which was recorded for 2 h in total. Trials were randomized and conducted one week apart on the same animals. Paired statistics were used to compare ‘saline’ and ‘CNO’ conditions on these animals. For Agrp and Pomc transcript analysis from the arcuate nucleus, 4 DBB-ablated mice and 4 non-ablated mice were euthanized in the morning and their brains were immediately dissected. For AChR transcript analysis, 4 wild-type male mice were taken and brains dissected and processed identically. Small sections of the ventral hypothalamus containing the arcuate nucleus were dissected out and RNA was isolated following the TRIzol (Life Technologies, 15596-018) protocol for tissue homogenization and RNA isolation. In brief, tissue was placed in 1 ml of TRIzol reagent and homogenized using a 1.5 ml pre-sterilized pestle. Homogenized samples were allowed to incubate at room temperature for 5 min. 0.2 ml of chloroform was added, and the tube was shaken vigorously by hand for 15 s. The sample was again incubated at room temperature for 2 min and centrifuged at 12,000g for 15 min at 4 °C. The upper aqueous phase was pipetted into a new tube, 0.5 ml of isopropanol was added, and the mixture was incubated at room temperature for 10 min. The tube was centrifuged at 12,000g for 10 min at 4 °C. The supernatant was removed and the RNA pellet was washed with 1 ml of 75% ethanol. The sample was vortexed and centrifuged at 7,500g for 5 min at room temperature. The pellet was air-dried for 15 min and resuspended in 40 μl RNase-free water at 60 °C. RNA was DNase-digested using the manufacturer’s protocol (Promega). DNase was inactivated via phenol-chloroform extraction. Purified RNA was quantified using a NanoDrop (Wilmington, DE), and first-strand cDNA was synthesized using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Negative controls did not contain reverse transcriptase. Transcripts were amplified using standard PCR conditions (95 °C for 120 s, 95 °C for 20 s, 60 °C for 20 s, 72 °C for 20 s, 34 cycles, 7 °C for 300 s, 4 °C until storage at −20 °C). Amplified products were run on 2% agarose gels, imaged, and quantified using ImageJ software. AChR primer sequences were as follows (forward primer first, reverse primer second, in 5′–3′orientation), CHRNA1: GTCCAATAACGCCGCTGAGG, CTAGCGATGGCTATGGCTGG; CHRNA2: GACTCTTCGGTGAAGGAAGATTG, AGAGCAGAAGATGGTTGTCCAG; CHRNA3: GCCAAAGAGATTCAAGATGATTGG, TCTGGGGCTATTGAGAAAGTGC; CHRNA4: GACTTCTCGGTGAAGGAGGAC, GGAAGATGTGGGTGACTGACG; CHRNA5: CGTCCGCGAGGTTGTTGAAG, AGCTGCTTGACTGCTCACTAAG; CHRNA6: CAAACGAGGTATAAGACGACTG, TCTTGTGGGGCTAGCTCGG; CHRNA7: CCTAAGTGGACCAGGATCATTC, ATGTAGAGCAGGTTGCCATTGC; CHRNA9: GTCCCTCTGATAGGAAAATACTAC, CTAAGGCAGCTCTCACCCAC; CHRNA10: ACTCATCGGAAAGTACTATATGGC, GACTCTAATGGCTTGGACTGTC; CHRNB1: ACCAGATGCAGGAGAGAAGATG, GAGCGATGATGCAGGTTGAGG; CHRNB2: TGACCAGAGTGTGAGGGAGG, AGCTGCAAATGAGAGACCTCAC; CHRNB3: ACTTCATCAGTCAGGTTGTTCAAG, CTAGGTGGGATTCTCTCTATGTG; CHRNB4: ATCAGAGTGTCATCGAGGACTG, CACTAGGCTGCTCATATCATCC; CHRM1: GCCAAGGTGATGCCCTTACTC, TGCCTGTCACTGTAGCCAGAG; CHRM2: AGAGCCCTGAAGTCGCAGATC, CTCCCTGGATCTGGCTTTCAG; CHRM3: GGCTTCCTGGCATTGGTGAC, GCCAGAGGTCACAGGCTAAG; CHRM4: TGACTGGTTCCCTGAGCCTG, AGTAGCCCTTGATGATGTATAAGG; CHRM5: ACTATTACCTGCTCAGCTTGGC, GTAACGATCAAAGCTAATCACCAG. AgRP products were quantified by qPCR using the following primer pair: GCGGAGGTGCTAGATCCACAGAA and AGGACTCGTGCAGCCTTACAC. POMC products were quantified by qPCR using the following primer pair: AGAACGCCATCATCAAGAAC and AAGAGGCTAGAGGTCATCAG. Actin was used as a reference control using the following primer pair: GCAAGCAGGAGTACGATGAG and TAACAGTCCGCCTAGAAGCA. For quantitative transcript analysis, all reactions were done in triplicates with no reverse transcriptase negative control samples. Samples were prepared according to the BIO-RAD iQ SYBR Green Supermix instructions. Briefly, cDNA was diluted to 1 ng μl−1 and primers were diluted to 2.5 μM stock of combined forward and reverse primers. Reactions were set up in 15 μl total volume per sample (7.5 μl SYBR Green Supermix, 5 μl cDNA, 1.5 μl forward and reverse primer mix, 1 μl water) in Applied Biosystems Advanced Studio 3 compatible 96-well plates. Plates were sealed with adhesive film and mixed thoroughly before amplification. Amplification occurred on the Applied Biosystems Advanced Studio 3 qPCR machine on its standard amplification protocol. All transcript analysis was standardized to the amplification curve of actin for each sample, and a Student’s t-test was performed to analyse differences in transcript expression among samples. With the exception of electrophysiological-based experiments (previously described), all other statistical analyses were performed using GraphPad Prism 6 software (GraphPad), accounting for appropriate distribution and variance to ensure proper statistical parameters were applied. Experimental sample sizes were chosen according to minimal accepted norms within the field. With regards to experimental randomization for cell ablation, Chat conditional knockout, and optogenetic behaviour assays, mice were randomly separated into two groups before manipulation by an independent, blinded assistant not involved in experimentation or experimental design. For quantification of Chat conditional knockout in the DBB, DBB images were acquired by an independent assistant not involved in the experimentation and cell counts were then objectively tallied by a second assistant without knowledge of the experimental groups. Statistical methods used are described in figure legends for the respective experiments.


News Article | February 21, 2017
Site: www.eurekalert.org

New Haven, Conn.-- Older men with low testosterone levels showed improved bone density and strength, as well as reduced anemia, after one year of testosterone therapy, according to a new study conducted at Yale and other sites. The therapy had no impact on cognitive function, however, and may worsen plaque in coronary arteries, said the researchers. The results of the four trials were published online Feb. 21 in two journals, JAMA and JAMA Internal Medicine. The studies, known as the TTrials, are the largest trials to examine the efficacy of testosterone treatment in men 65 and older whose testosterone levels are low due to age. At 12 study sites across the country, 790 participants were given testosterone gel or a placebo applied daily to the skin. Over a year, investigators measured the effects of testosterone on four areas: anemia, bone density and strength, cardiovascular health, and cognitive function. The findings are the second set of results from the long-term TTrials, which demonstrated the benefit of testosterone therapy on sexual function in older men with low testosterone in a report published last year. "Looking globally at testosterone therapy, the strongest evidence is for sexual function," said Thomas Gill, M.D., the Humana Foundation Professor of Medicine and a lead author. The latest studies demonstrate that if a man with low serum testosterone is going to be prescribed testosterone for diminished sexual function, he may have some additional benefits on hemoglobin levels and bone density, Gill noted. While the outcome of the cardiovascular trial raises concern, he said, a larger and longer study would be needed to determine the clinical significance of the findings. The TTrials were conducted at 12 additional medical centers, including Albert Einstein College of Medicine, Baylor College of Medicine, Brigham and Women's Hospital, Harbor-UCLA Medical Center, University of Alabama at Birmingham, Northwestern University Feinberg School of Medicine, Puget Sound Health Care System, University of California at San Diego School of Medicine, University of Florida School of Medicine, University of Minnesota School of Medicine, University of Pennsylvania, and University of Pittsburgh School of Public Health. The studies were funded primarily by the National Institute on Aging, part of the National Institutes of Health (NIH). Additional funding came from the National Heart, Lung, and Blood Institute, the National Institute of Neurological Disorders and Stroke, and the Eunice Kennedy Shriver National Institute of Child Health and Human Development, all part of NIH. Additional funding, and the study drug and placebo, were provided by AbbVie Pharmaceuticals.


News Article | December 22, 2016
Site: www.eurekalert.org

Making muscles burn more fat and less glucose can increase exercise endurance, but could simultaneously cause diabetes, says a team of scientists from Baylor College of Medicine and other institutions. Mouse muscles use glucose (carbohydrate) as fuel when the animals are awake and active and switch to fat (lipid) when they are asleep. The team discovered that disrupting this natural cycle may lead to diabetes but, surprisingly, also can enhance exercise endurance. The switch is controlled by a molecule called histone deacetylase 3, or HDAC3. This finding opens the possibility of selecting the right time to exercise for losing body fat but also raises the concern of using HDAC inhibitors as doping drugs for endurance exercise. The study appears in Nature Medicine. "How the muscle uses glucose is regulated by its internal circadian clock that anticipates the level of its activity during the day and at night," said senior author Dr. Zheng Sun, assistant professor of medicine - diabetes, endocrinology and metabolism, and of molecular and cellular biology at Baylor. "The circadian clock works by turning certain genes on and off as the 24-hour cycle progresses. HDAC3 is a key connection between the circadian clock and gene expression. Our previous work showed that HDAC3 helps the liver alternate between producing glucose and producing lipid. In this work, we studied how HDAC3 controls the use of different fuels in skeletal muscle." Skeletal muscles, the voluntary muscles, are important in the control of blood glucose in the body. They consume most of the glucose, and if they develop insulin resistance and consequently are not able to use glucose, then diabetes likely will develop. To study the role of HDAC3 in mouse skeletal muscle, Sun and colleagues genetically engineered laboratory mice to deplete HDAC3 only in the skeletal muscles. Then they compared these knocked out mice with normal mice regarding how their muscles burn fuel. When normal mice eat, their blood sugar increases and insulin is released, which stimulates muscles to take in and use glucose as fuel. "When the knocked out mice ate, their blood sugar increased and insulin was released just fine, but their muscles refused to take in and use glucose," said Sun. "Lacking HDAC3 made the mice insulin resistant and more prone to develop diabetes." Yet, when the HDAC3-knocked out mice ran on a treadmill, they showed superior endurance, "which was intriguing because diabetes is usually associated with poor muscle performance," said Sun. "Glucose is the main fuel of muscle, so if a condition limits the use of glucose, the expectation is low performance in endurance exercises. That's the surprise." The researchers then studied what fueled the HDAC3-knocked out mice's stellar performance using metabolomics approaches and found that their muscles break down more amino acids. This changed the muscles' preference from glucose to lipids and allowed them to burn lipid very efficiently. This explains the high endurance, because the body carries a much larger energy reservoir in the form of lipid than carbohydrate. The finding challenges the widely-used carbohydrate-loading (carbo-loading) strategy for improving endurance performance. "Carbo-loading didn't make evolutionary sense before the invention of agriculture," said Sun. "Switching muscles from using carbohydrates to lipids could increase exercise endurance, especially for low-intensity exercise." The study suggests that HDAC inhibitors, a class of small molecule drugs currently being tested for treating several diseases, could potentially be used to manipulate such fuel switch in muscle and therefore raises concern of doping. The team performed a number of functional genomics studies that established the link between HDAC3 and the circadian clock. "In normal mice, when the mouse is awake, the clock in the muscle anticipates a feeding cycle and uses HDAC3 to turn off many metabolic genes. This leads the muscles to use more carbohydrate," said Sun. "When the animal is about to go to sleep and anticipates a fasting cycle, the clock removes HDAC3. This leads the muscles to use more lipid." Although these studies were done in mice, the researchers speculate that human muscles most likely will follow the same cycle. The study opens the possibility of promoting body fat burning by increasing exercise activity during the periods in which muscles use lipid, which is at night for people. "Losing body fat would be easier by exercising lightly and fasting at night," said Sun. "It's not a bad idea to take a walk after dinner." Other contributors to this work include Sungguan Hong, Wenjun Zhou, Bin Fang, Wenyun Lu, Emanuele Loro, Manashree Damle, Guolian Ding, Jennifer Jager, Sisi Zhang, Yuxiang Zhang, Dan Feng, Qingwei Chu, Brian D Dill, Henrik Molina, Tejvir S Khurana, Joshua D Rabinowitz and Mitchell A Lazar. The authors are affiliated with one or more of the following institutions: Baylor College of Medicine, University of Pennsylvania, Princeton University, Shanghai Jiao Tong University and Rockefeller University. Financial support was provided by the National Institutes of Health grants DK043806 and DK099443. The study was also supported by multiple core facilities including the Penn Diabetes Center (DK19525) Functional Genomics Core and Mouse Metabolic Phenotyping Core, Rockefeller University Proteomics Center, Princeton/Penn Regional Metabolomics Core, Vanderbilt MMPC (DK59637) and the Baylor Diabetes Center (DK079638) Mouse Metabolism Core.


News Article | November 14, 2016
Site: www.eurekalert.org

ATLANTA (14 November 2016)--West Nile virus may be much more deadly than previously believed, with deaths attributable to the mosquito-borne disease occurring not just in the immediate aftermath of the infection but also years later, long after patients seem to have recovered from the initial illness, according to a new study presented today at the 2016 Meeting of the American Society of Tropical Medicine and Hygiene (ASTMH). "While we understand the current focus on Zika virus, for many people in the United States today, West Nile virus is the much more serious mosquito-borne threat and that threat may persist even for patients who appear to have survived the infection unscathed," said Kristy O. Murray, DVM, PhD, of Baylor College of Medicine and Texas Children's Hospital, who is the principal author of the study. Murray and her colleagues looked at 4,144 West Nile virus (WNV) infections that occurred in Texas between 2002 and 2012, focusing on both "acute" deaths recorded in the first 90 days after infection and also on WNV patients who died months to years later--yet far sooner than other people of similar age and overall health condition. The researchers found there were 286 people who died in the acute phase of WNV. But after examining causes of deaths and symptoms from the initial infection, Murray and her colleagues concluded that 268 people who survived infection subsequently died early (they call it "delayed mortality") due to the virus. Overall, counting both the acute and delayed group, the researchers attributed 554 deaths to WNV during the 10-year period, a 13 percent fatality rate. That's much higher than the 4 percent national fatality rate for WNV recorded between 1999 and 2015 by the U.S. Centers for Disease Control and Prevention (CDC), though those statistics accounted only for deaths that occurred during the acute phase of illness. WNV, which also can infect birds that help spread the virus further, has been detected in all of the lower 48 states since it was introduced into the United States in 1999. It belongs to the same family of viruses as Zika and yellow fever. Like Zika, most people infected with WNV never experience symptoms. Those who do typically have a fever, nausea, fatigue or a rash, though in rare cases, it can cause severe neurological complications that can lead to swelling of the brain and spinal cord. There is not a specific treatment for WNV infections nor is there a vaccine to prevent it. Murray noted that the Texas study is the largest study to date to investigate what has been seen in much smaller groups of WNV patients, which is that the disease appears capable of causing health problems years after someone is over the initial infection. "For several years, we had followed smaller groups of patients and felt that many had died prematurely," Murray said. "We saw many people who were otherwise healthy until they had West Nile virus--and then their health just went downhill." Murray said most of the delayed deaths were clustered around a large outbreak of WNV in Texas in 2012, which means they occurred just a few years after the initial infections. But Murray said other early deaths were recorded up to 10 years after the initial epidemic of West Nile. She said her research team feels confident in its conclusions because, for each patient, they had access to both information about the course of the initial infection and records maintained by the Texas state death registry that document cause of death. Murray said that the delayed deaths appeared to be more common in patients who had suffered significant neurological complications during the acute phase of their illness. Also, for patients suffering delayed deaths, Murray said kidney disease, increasingly suspected as a potential long-term complication of WNV, was statistically found to be a significant cause of death. Murray was the principal investigator of a 2012 study that followed 139 patients diagnosed with WNV and found 40 percent of them developed chronic kidney disease. Murray said kidney issues caused by WNV could also explain why it was not just elderly patients who were found to be at risk of delayed death but especially patients under 60 years old. "We had been surprised in the 2012 study to see so much chronic kidney disease develop in younger West Nile patients because it's not that common in people under 60," she said. "In much the same way that research into Zika virus is showing a more destructive virus than originally thought, we are still discovering previously unreported long-term destructive effects of West Nile," said Stephen Higgs, PhD, president of the American Society of Tropical Medicine and Hygiene. "Those of us in the tropical medicine community have long been concerned that West Nile is a significant public health problem and that U.S. federal investments are warranted in finding better ways to treat and prevent it." The American Society of Tropical Medicine and Hygiene, founded in 1903, is the largest international scientific organization of experts dedicated to reducing the worldwide burden of tropical infectious diseases and improving global health. It accomplishes this through generating and sharing scientific evidence, informing health policies and practices, fostering career development, recognizing excellence, and advocating for investment in tropical medicine/global health research. For more information, visit astmh.org.


WASHINGTON--(BUSINESS WIRE)--Emerging data from Children’s National Health System are providing hope that a new approach to cell therapy may effectively harness the cancer-killing potential of the natural immune system as a treatment for patients with blood and bone marrow cancers for whom stem cell transplantation has not worked. These patients typically have few treatment options and experience very high mortality rates. Initial results from the Phase 1 RESOLVE trial, a multi-institutional, Phase 1 dose-ranging study co-led by Kirsten Williams, M.D., and Catherine Bollard, M.D., M.B.Ch.B., Chief of the Division of Allergy and Immunology and Director of the Program for Cell Enhancement and Technologies for Immunotherapy (CETI) at Children’s National, showed that the majority (78 percent) of patients responded to multi tumor-associated antigen specific lymphocytes (TAA-L) treatment, and 44 percent of patients achieved complete remission with limited toxicity. The trial included patients diagnosed with one of four tumors who were treated with TAA-L upon relapse of disease post stem cell transplant. “These initial findings suggest that non-genetically engineered antigen-specific lymphocytes can be isolated, expanded and adoptively transferred to severely ill patients with active disease and positively impact tumor regression,” says Dr. Bollard. “We are encouraged by the promise of these data, which support similar efforts to exploit the immunotherapeutic potential of the natural T-cell repertoire.” The data, presented at the BMT Tandem meeting in Orlando, Florida, was a collaboration between investigators at Children’s National and researchers at Johns Hopkins University and Baylor College of Medicine who are testing a novel approach to treating cancer. Their approach includes introducing TAA-L – a natural T-cell subtype from the immune system – to high-risk patients with advanced hematologic or blood cancers including acute myeloid leukemia (AML)/ Myelodysplastic Syndromes (MDS), B-cell acute lymphoblastic leukemia (ALL) and Hodgkin lymphoma. The trial evaluates the safety and efficacy of both donor and patient-derived TAA-L as a novel treatment for patients with AML/MDS, B-cell ALL or Hodgkin lymphoma who are in active disease relapse pre- or post-allogeneic hematopoietic stem cell transplantation (HSCT). Patients with refractory and relapsed AML, MDS, ALL and Hodgkin lymphoma often have extremely poor clinical outcomes. For patients with these malignancies who relapse after allogeneic stem cell transplantation, the prognosis is even more dismal. Sadly, one-year mortality rates for this population approach 90 percent. The results include patients receiving adoptively transferred TAA-L manufactured cells across all dosing cohorts allowed per protocol (dose levels one through four), 10 patients in total. Preliminary observations conclude that ex vivo manufactured TAA-L, composed primarily of central effector memory T-cells, can be successfully isolated and expanded to clinically relevant numbers, cryopreserved, and safely infused to patients after relapse of disease. There were no cases of graft-versus-host disease or other autoimmune-mediated toxicity reported, and there have been no observations of Cytokine Release Syndrome or neurotoxicity associated with TAA-L treatment. The RESOLVE trial has been and/or is funded by a National Institutes of Health grant (P01CA015396), the Leukemia Lymphoma Society, Ben’s Run and Hyundai Hope on Wheels. The BMT Tandem meeting is the combined annual meetings of the Center for International Blood & Marrow Transplant Research and the American Society for Blood and Marrow Transplantation. Children’s National Health System, based in Washington, DC, has been serving the nation’s children since 1870. Children’s National is ranked in the top 20 in every specialty evaluated by U.S. News & World Report; one of only four children’s hospitals in the nation to earn this distinction. Designated a Leapfrog Group Top Hospital and a two-time recipient of Magnet® status, this pediatric academic health system offers expert care through a convenient, community-based primary care network and specialty outpatient centers. Home to the Children’s Research Institute and the Sheikh Zayed Institute for Pediatric Surgical Innovation, Children’s National is one of the nation’s top NIH-funded pediatric institutions. Children’s National is recognized for its expertise and innovation in pediatric care and as a strong voice for children through advocacy at the local, regional and national levels. For more information, visit ChildrensNational.org, or follow us on Facebook and Twitter.


News Article | November 11, 2016
Site: www.eurekalert.org

The Swiss Federal Office for the Environment (FOEN) lists more than 100 invasive species already posing threats in Switzerland, including the Asian longhorned beetle and other insects such as the box tree moth, the harlequin ladybird, the Asian tiger mosquito, and the Ambrosia and Colorado potato beetles. The Swiss Federal Institute for Forest, Snow and Landscape Research (WSL) considers Anoplophora glabripennis to be one of the most dangerous pests affecting broadleaf trees. The adult female beetles chew through the tree's bark to lay their eggs in a small hole, so as soon as the larvae hatch they have a ready source of vascular plant tissue on which to feed. As they mature, the larvae then make tunnels deep into the tree's heartwood, with each larva capable of consuming up to 1'000 cubic cm of wood in its lifetime. The emerging adults will usually produce the next generation on the same host tree, but high-density infestations will eventually kill the tree so they must disperse to find new host trees for their young. It is likely that the first invaders were unknowingly imported as larvae hidden inside wooden packaging materials. New laws requiring such packaging from China to be heat-dried or chemically treated to kill any larvae have helped to limit new invasions, and effective pest inspections and increasing public awareness are proving successful to help prevent any further spread of Asian longhorned beetles in Switzerland. The collaborative research project to sequence, annotate, and explore the Anoplophora glabripennis genome was led by Prof. Duane McKenna from the University of Memphis, with DNA sequencing and genome assembly performed at the Baylor College of Medicine directed by Prof. Stephen Richards as part of the i5K arthropod genome initiative. The team of researchers who analysed this new wealth of genetic and genomic data included experts from the SIB Swiss Institute of Bioinformatics and the University of Geneva Faculty of Medicine, Dr Panagiotis Ioannidis and Dr Robert Waterhouse from the group of Prof. Evgeny Zdobnov. The international team's efforts were made possible through funding from United States agencies including the National Human Genome Research Institute, the National Science Foundation, the National Institute of Food and Agriculture, and National Institutes of Health, as well as the German Research Foundation and the Swiss National Science Foundation. Their findings from exploring the 710 megabasepair genome and its 22'035 encoded genes are published in a comprehensive manuscript in the journal Genome Biology. Sequencing and annotating the beetle's genome enabled the researchers to perform detailed comparative analyses with other insects and examine the thousands of encoded genes for clues about how they have evolved to successfully feed on tree tissues. Prof. McKenna said "Research in my laboratory has focused on the evolution of beetle-plant interactions and phytophagy, i.e. plant-feeding, so sequencing the whole genome now allows us to identify the full set of genes that facilitate the specialised feeding of this beetle on woody plants." He further explained that "In particular, gene duplication, i.e. the generation of new gene copies in this beetle genome, and their subsequent functional divergence, have been important factors that have led to the expansion and enhancement of its metabolic gene repertoire, in some cases involving genes acquired from fungi and bacteria." As well as encoding many of these enzymes required to degrade plant tissues, the genome also revealed several expanded sets of genes that are known to be important for the detoxification of the chemicals normally produced by plants to defend themselves against attacks by such pests. "This means that the beetle is able to quickly get rid of these toxic plant defence chemicals that would normally deter most insects, and continue to feed on the woody tissues of the host trees", explained Dr Ioannidis. Dr Waterhouse added that "Using our comparative genomics tools including OrthoDB and BUSCO, we were able to classify genes into those shared across many insect species and those that are specific to beetles, especially plant-feeding beetles, to highlight genes that may be particularly important for the biological innovations that have allowed beetles to become such a successful - and in this case dangerous - group of insects." The SIB Swiss Institute of Bioinformatics is an academic not-for-profit organization. Its mission is to lead and coordinate the field of bioinformatics in Switzerland. Its data science experts join forces to advance biological and medical research and enhance health by (i) providing the national and international life science community with a state-of-the-art bioinformatics infrastructure, including resources, expertise and services; (ii) federating world-class researchers and delivering training in bioinformatics. It includes some 65 world-class research and service groups and some 800 scientists in the fields of genomics, transcriptomics, proteomics, evolution, population genetics, systems biology, structural biology, biophysics and clinical bioinformatics. http://www. Reference: McKenna et al. Genome of the Asian longhorned beetle (Anoplophora glabripennis), a globally significant invasive species, reveals key functional and evolutionary innovations at the beetle-plant interface. Genome Biology, 2016. DOI: 10.1186/s13059-016-1088-8


News Article | September 20, 2016
Site: www.biosciencetechnology.com

A team of scientists from Baylor College of Medicine and Vanderbilt University Medical Center have determined a mechanism by which human antibodies target and block noroviruses. Their study, which appears in the Proceedings of the National Academy of Sciences, opens the possibility of developing therapeutic agents against this virus that causes the death of about 200,000 children every year. "Some people infected with norovirus do not get sick," said senior author Dr. B V Venkataram Prasad, professor of virology and the Alvin Romansky Chair in biochemistry at Baylor. "We wanted to understand how these protective human antibodies work." The researchers screened and isolated protective antibodies from human blood and discovered that the most protective were of the IgA type, an antibody mostly involved in gut immunity. According to the Centers for Disease Control and Prevention, norovirus is the leading cause of foodborne illness and of acute gastroenteritis in all age groups in the U.S. The virus enters the body hidden in contaminated food, travels through the digestive system and infects the top layer of cells, the epithelial cells, on the small intestine. To enter the epithelial cells the virus attaches to complex sugar molecules, or glycans, on the surface of the cells. "The initial attachment is very important for the virus to subsequently get in," said Prasad. "It is like knocking at the door, and then the door opens and the virus can get inside the cells." The epithelial cells have a thick cover of glycans of diverse types, but norovirus seems to selectively bind to a particular group of glycans, the histo-blood group antigens, or HBGA, which also determine our blood types. Different strains of norovirus interact with different types of HBGAs. "The site on the norovirus particles that binds to HBGA is located in a region of the virus called P domain," said Prasad. "We knew that human antibodies that bind to P domain of norovirus and block HBGA binding correlate with protection, but we didn't know where these antibodies bind on the P domain and how this interaction prevents norovirus from binding to HBGA. Do the antibodies change the structure of the P domain or disrupt the HBGA binding site so it can no longer bind to the glycans? Or do the antibodies physically block the glycan binding site on P domain preventing its binding to HBGAs? We answered these questions with X-ray crystallographic analysis." Scientists use X-ray crystallography to determine the three-dimensional structure of highly purified molecules in the form of crystals. Crystals are symmetrical structures that produce symmetrical diffraction patterns when irradiated with X rays. Scientists use the symmetrical X-ray diffraction patterns to determine how molecules would look in 3-D. "The hardest, most time-consuming part of this project was to obtain good quality diffracting crystals ready for X-ray crystallographic analysis," said first author Dr. Sreejesh Shanker, a senior scientist in the Prasad lab. To answer the question of how the antibodies prevent norovirus from binding to HBGA, Shanker purified the complex of the norovirus P domain with the part of the antibody that binds to the domain, called antigen binding fragment (Fab), of a human IgA antibody. He then successfully used X-ray crystallography to determine the structure of the complex. "We found that the Fab fragment binds close to the HBGA binding site. It does not change the structure of the HBGA binding site, but physically blocks access to the site," said Shanker. These results open the possibility of developing compounds that mimic the structure of the Fab fragment and using them as a therapeutic agent to block the virus binding to cells," said Prasad. Now that the scientific community has the ability to grow noroviruses in the lab (Science, 2016), it is possible to test whether blocking binding would inhibit infection and replication of the virus inside the cells. "We see the possibility of using these blocking therapeutic agents to treat norovirus infections in transplant recipients suffering from these infections, which can be fatal," said co-senior author Dr. Mary Estes, Cullen Endowed Professor of Human and Molecular Virology and Microbiology at Baylor and emeritus founding director of the Texas Medical Center Digestive Diseases Center.


News Article | December 13, 2016
Site: www.prweb.com

Amid rising temperatures and seas, emerging tropical diseases and a rapidly growing population facing the state, The Academy of Medicine, Engineering and Science of Texas (TAMEST) will gather together some of the top minds in Texas to explore solutions for the state’s future. “Building a Sustainable Future for Texas” will examine big picture, long-term issues facing Texas and the ideas and solutions that will help guide Texas through the next century, with a focus on key issues like energy, health, water and transportation. The conference takes place January 10–12, 2017, at the Westin Riverwalk in San Antonio, Texas. “As Texas confronts both great challenge and opportunity in the coming century, TAMEST is well-positioned to gather the state’s top leaders in academia, industry and research to plan a brighter future for our state,” says Conference Program Chair Stephen Holditch, Ph.D., Texas A&M University. Featured speakers at the conference will include: Dr. Marcia McNutt, president of the National Academy of Sciences, speaking on sustainability challenges facing Texas. John Hofmeister, former president of Shell Oil, talking about the role of geo-politics in the pricing and availability of oil and natural gas. Dr. Stephen Klineberg, professor at Rice University, will present on Texas’ role as a demographic bellwether for a changing country. Higher Education—A can’t-miss conversation on the future of higher education in Texas on Wednesday, January 11, featuring chancellors and presidents of major Texas universities. Health Care—A panel conversation on sustainable health, examining how increased cooperation between the medical and energy industries has led to innovations in surgery, and its potential implications for space travel. Water—Dr. Marc Edwards of Virginia Tech, an expert on water who has uncovered high lead levels in water supplies in Flint, Michigan and other cities, on ways to build more sustainable water infrastructure. Zika and Tropical Diseases—a panel discussion led by Dr. Peter Hotez on the issue of emerging tropical diseases in Texas and the impacts of climate change on community health. At the opening reception on the evening of Tuesday, January 10th, TAMEST will recognize its new members and present the Kay Bailey Hutchison Distinguished Service Award. The award will go to ExxonMobil and its Chairman and CEO Rex Tillerson, in recognition of their steadfast support of TAMEST and research in Texas. Media are encouraged to attend the opening reception and conference. Complimentary media registration is available. Interview opportunities include: Marcia McNutt, Ph.D., president, National Academy of Sciences John Hofmeister, former president, Shell Oil Peter Hotez, Ph.D., professor, Baylor College of Medicine And more About TAMESTThe Academy of Medicine, Engineering and Science of Texas (TAMEST) was founded in 2004 to provide broader recognition of the state’s top achievers in medicine, engineering and science, and to further position Texas as a national research leader. TAMEST also aims to foster the next generation of scientists and to increase the awareness and communication among the state’s best and brightest about research priorities for the future. TAMEST’s membership represents Texas’ best researchers from both industry and academia. TAMEST is composed of more than 280 Texas-based members of The National Academies of Sciences, Engineering, and Medicine and the state’s nine Nobel Laureates.


News Article | April 24, 2016
Site: www.techtimes.com

It could be "champagne supernova" beyond the skies. If you think getting your period on Earth is complicated, it gets even more complex in space. Experts from Baylor College of Medicine and King's College London analyzed several options for female astronauts who want to prevent bleeding during their menstrual cycles while on space missions. In their review of available contraceptive devices, they found that many female astronauts could opt to delay their menstrual bleeding while on space missions. However, they also found that further research is needed to analyze the effects of several hormone treatments on the loss of bone mineral while in space. The best options could be the intrauterine devices (IUDs) or implants. These will not only benefit the women in orbit but it's also the best option in terms of cargo and general convenience. Although full amenities are provided for female crewmembers who wish to menstruate while in space, it could be challenging. Firstly, there is limited water supply for washing. Secondly, regularly changing hygiene products in microgravity can be more challenging and inconvenient than it already is down here. More importantly, the International Space Station recycles water from urine. The onboard plumbing is not designed to address the possibility of having menstrual blood in the urine. Menstrual cycles can be coaxed to coincide with the mission dates for short-term missions. However, for long-term flights, suppressing the menstrual cycle is often the preferred route. For longer missions, female astronauts often take a combined oral contraceptive (COC) pill to delay their monthly flow. For a three-year mission, an estimated 1,100 pills are needed. This means additional cargo and disposal for the mission. Subdermal implants and IUDs are examples of long-acting reversible contraceptives (LARCs). While these are considered safe options, female astronauts have yet to use them extensively. A LARC device could be placed before the mission. There is also no need to replace it during the mission. This means there is no need for extra cargo and waste disposal. "The spaceflight environment adds some extra complexity to the overall equation, and we want female crewmembers to be able to make well-informed choices for their missions," said Dr. Virginia Wotring, an assistant professor in Baylor College of Medicine's Center for Space Medicine. In the last 50 years, over 50 women have gone into orbit. With more people applying to become astronauts, there is no doubt the number of female astronauts continues to grow, and this just goes to show that analyzing the best method for menstrual cycle management in space is needed. The analysis was published in the npj Microgravity journal on April 21. © 2016 Tech Times, All rights reserved. Do not reproduce without permission.


News Article | September 23, 2016
Site: www.cemag.us

A temporary tattoo to help control a chronic disease might someday be possible, according to scientists at Baylor College of Medicine who tested antioxidant nanoparticles created at Rice University. A proof-of-principle study led by Baylor scientist Christine Beeton, published by Nature’s online, open-access journal Scientific Reports, shows that nanoparticles modified with polyethylene glycol are conveniently choosy as they are taken up by cells in the immune system. That could be a plus for patients with autoimmune diseases like multiple sclerosis, one focus of study at the Beeton lab. “Placed just under the skin, the carbon-based particles form a dark spot that fades over about one week as they are slowly released into the circulation,” Beeton says. T and B lymphocyte cells and macrophages are key components of the immune system. However, in many autoimmune diseases such as multiple sclerosis, T cells are the key players. One suspected cause is that T cells lose their ability to distinguish between invaders and healthy tissue and attack both. In tests at Baylor, nanoparticles were internalized by T cells, which inhibited their function, but ignored by macrophages. “The ability to selectively inhibit one type of cell over others in the same environment may help doctors gain more control over autoimmune diseases,” Beeton says. “The majority of current treatments are general, broad-spectrum immunosuppressants,” says Redwan Huq, lead author of the study and a graduate student in the Beeton lab. “They’re going to affect all of these cells, but patients are exposed to side effects (ranging) from infections to increased chances of developing cancer. So we get excited when we see something new that could potentially enable selectivity.” Since the macrophages and other splenic immune cells are unaffected, most of a patient’s existing immune system remains intact, he says. The soluble nanoparticles synthesized by the Rice lab of chemist James Tour have shown no signs of acute toxicity in prior rodent studies, Huq says. They combine polyethylene glycol with hydrophilic carbon clusters, hence their name, PEG-HCCs. The carbon clusters are 35 nanometers long, 3 nanometers wide and an atom thick, and bulk up to about 100 nanometers in globular form with the addition of PEG. They have proven to be efficient scavengers of reactive oxygen species called superoxide molecules, which are expressed by cells the immune system uses to kill invading microorganisms. T cells use superoxide in a signaling step to become activated. PEG-HCCs remove this superoxide from the T cells, preventing their activation without killing the cells. Beeton became aware of PEG-HCCs during a presentation by former Baylor graduate student Taeko Inoue, a co-author of the new study. “As she talked, I was thinking, ‘That has to work in models of multiple sclerosis,'” Beeton says. “I didn’t have a good scientific rationale, but I asked for a small sample of PEG-HCCs to see if they affected immune cells. “We found they affected the T lymphocytes and not the other splenic immune cells, like the macrophages. It was completely unexpected,” she says. The Baylor lab’s tests on animal models showed that small amounts of PEG-HCCs injected under the skin are slowly taken up by T lymphocytes, where they collect and inhibit the cell’s function. They also found the nanoparticles did not remain in T cells and dispersed within days after uptake by the cells. “That’s an issue because you want a drug that’s in the system long enough to be effective, but not so long that, if you have a problem, you can’t remove it,” Beeton says. “PEG-HCCs can be administered for slow release and don’t stay in the system for long. This gives us much better control over the circulating half-life.” “The more we study the abilities of these nanoparticles, the more surprised we are at how useful they could be for medical applications,” Tour says. The Rice lab has published papers with collaborators at Baylor and elsewhere on using functionalized nanoparticles to deliver cancer drugs to tumors and to quench the overproduction of superoxides after traumatic brain injuries. Beeton suggested delivering carbon nanoparticles just under the skin rather than into the bloodstream would keep them in the system longer, making them more available for uptake by T cells. And the one drawback — a temporary but visible spot on the skin that looks like a tattoo — could actually be a perk to some. “We saw it made a black mark when we injected it, and at first we thought that’s going to be a real problem if we ever take it into the clinic,” Beeton says. “But we can work around that. We can inject into an area that’s hidden, or use micropattern needles and shape it. “I can see doing this for a child who wants a tattoo and could never get her parents to go along,” she says. “This will be a good way to convince them.” The research was supported by Baylor College of Medicine, the National Multiple Sclerosis Society, National Institutes of Health, the Dan L. Duncan Cancer Center, John S. Dunn Gulf Coast Consortium for Chemical Genomics, and the U.S. Army-funded Traumatic Brain Injury Consortium.


News Article | September 23, 2016
Site: www.biosciencetechnology.com

A temporary tattoo to help control a chronic disease might someday be possible, according to scientists at Baylor College of Medicine who tested antioxidant nanoparticles created at Rice University. A proof-of-principle study led by Baylor scientist Christine Beeton published today by Nature’s online, open-access journal Scientific Reports shows that nanoparticles modified with polyethylene glycol are conveniently choosy as they are taken up by cells in the immune system. That could be a plus for patients with autoimmune diseases like multiple sclerosis, one focus of study at the Beeton lab. “Placed just under the skin, the carbon-based particles form a dark spot that fades over about one week as they are slowly released into the circulation,” Beeton said. T and B lymphocyte cells and macrophages are key components of the immune system. However, in many autoimmune diseases such as multiple sclerosis, T cells are the key players. One suspected cause is that T cells lose their ability to distinguish between invaders and healthy tissue and attack both. In tests at Baylor, nanoparticles were internalized by T cells, which inhibited their function, but ignored by macrophages. “The ability to selectively inhibit one type of cell over others in the same environment may help doctors gain more control over autoimmune diseases,” Beeton said. “The majority of current treatments are general, broad-spectrum immunosuppressants,” said Redwan Huq, lead author of the study and a graduate student in the Beeton lab. “They’re going to affect all of these cells, but patients are exposed to side effects (ranging) from infections to increased chances of developing cancer. So we get excited when we see something new that could potentially enable selectivity.” Since the macrophages and other splenic immune cells are unaffected, most of a patient’s existing immune system remains intact, he said. The soluble nanoparticles synthesized by the Rice lab of chemist James Tour have shown no signs of acute toxicity in prior rodent studies, Huq said. They combine polyethylene glycol with hydrophilic carbon clusters, hence their name, PEG-HCCs. The carbon clusters are 35 nanometers long, 3 nanometers wide and an atom thick, and bulk up to about 100 nanometers in globular form with the addition of PEG. They have proven to be efficient scavengers of reactive oxygen species called superoxide molecules, which are expressed by cells the immune system uses to kill invading microorganisms. T cells use superoxide in a signaling step to become activated. PEG-HCCs remove this superoxide from the T cells, preventing their activation without killing the cells. Beeton became aware of PEG-HCCs during a presentation by former Baylor graduate student Taeko Inoue, a co-author of the new study. “As she talked, I was thinking, ‘That has to work in models of multiple sclerosis,'” Beeton said. “I didn’t have a good scientific rationale, but I asked for a small sample of PEG-HCCs to see if they affected immune cells. “We found they affected the T lymphocytes and not the other splenic immune cells, like the macrophages. It was completely unexpected,” she said. The Baylor lab’s tests on animal models showed that small amounts of PEG-HCCs injected under the skin are slowly taken up by T lymphocytes, where they collect and inhibit the cell’s function. They also found the nanoparticles did not remain in T cells and dispersed within days after uptake by the cells. “That’s an issue because you want a drug that’s in the system long enough to be effective, but not so long that, if you have a problem, you can’t remove it,” Beeton said. “PEG-HCCs can be administered for slow release and don’t stay in the system for long. This gives us much better control over the circulating half-life.” “The more we study the abilities of these nanoparticles, the more surprised we are at how useful they could be for medical applications,” Tour said. The Rice lab has published papers with collaborators at Baylor and elsewhere on using functionalized nanoparticles to deliver cancer drugs to tumors and to quench the overproduction of superoxides after traumatic brain injuries. Beeton suggested delivering carbon nanoparticles just under the skin rather than into the bloodstream would keep them in the system longer, making them more available for uptake by T cells. And the one drawback – a temporary but visible spot on the skin that looks like a tattoo – could actually be a perk to some. “We saw it made a black mark when we injected it, and at first we thought that’s going to be a real problem if we ever take it into the clinic,” Beeton said. “But we can work around that. We can inject into an area that’s hidden, or use micropattern needles and shape it. “I can see doing this for a child who wants a tattoo and could never get her parents to go along,” she said. “This will be a good way to convince them.” The research was supported by Baylor College of Medicine, the National Multiple Sclerosis Society, National Institutes of Health, the Dan L. Duncan Cancer Center, John S. Dunn Gulf Coast Consortium for Chemical Genomics and the U.S. Army-funded Traumatic Brain Injury Consortium.


Although full amenities are available should astronauts choose to menstruate in space, the practicalities of menstruating during pre-flight training or spaceflight can be challenging. For short duration missions, menstrual cycles can to be timed according to mission dates but for longer hauls, menstrual suppression is often preferred. During long duration missions, astronauts have traditionally continuously taken the combined oral contraceptive (COC) pill to prevent menstrual flow. A three-year exploration class mission is predicted to require approximately 1,100 pills, whose packaging would add mass and disposal requirements for the flight. Long acting reversible contraceptives (LARCs) such as IUDs and subdermal (beneath-the-skin) implants are also safe and reliable methods for this purpose but as of yet, have not been extensively used by astronauts. Opting for a LARC would however remove the upmass, packaging, waste and stability issues as a device could be inserted prior to a mission and replacement would not be required in-flight. It is up to individuals to choose which method to use but LARCS appear to have a number of advantages for spaceflight, according to the paper's authors. From an operational perspective, LARCs would not be expected to interfere with the ability of the astronaut to perform her tasks. There are no reports in the scientific literature suggesting high G loading experienced during launch or landing would damage a subdermal implant or shift the position of an IUD. However, consideration may need to be given as to whether the implant could rub or catch on specialist equipment or attire such as a diving suit or extra-vehicular activity suit. The effect of hormone treatments on bone mineral density (BMD) is another issue for spaceflight, where astronauts lose bone at a much higher rate than on Earth. Previous studies have found a reduction in BMD with some contraception choices, namely the progestin only injection (DMPA), and whilst on earth these reductions are temporary, due to irreversible spaceflight related bone changes a treatment option which may impact BMD may not be advised. It is unknown whether taking the pill continuously would help protect against bone mineral loss. The authors call for further research to understand the impact of the COC in combination with microgravity, on bone mass density in women. The paper concludes that astronauts should be provided with up-to-date, evidence-based information to make informed decisions about menstrual suppression if it is desired. The uniqueness of spaceflight provides many challenges in conducting research, as the number of subjects required for clinical studies cannot be matched by the number of current active female astronauts. The authors suggest that combining pharmacological data from spaceflights with equivalent ground-based studies investigating menstrual suppression might provide the evidence required to trial LARCs during spaceflight. Dr Varsha Jain, Visiting Researcher at the Centre of Human and Aerospace Physiological Sciences (CHAPS) at King's College London and NIHR Academic Clinical Fellow in Obstetrics and Gynaecology, said: "Studies of women in the military have shown that many would like to suppress their menstrual flow during deployment, but only a proportion of them use the pill to do so; the majority of women surveyed also wanted more advice from the military to help them make the right choice. "With more women going into space, we need to ensure they also have the most up-to-date information on reliable contraception and means of menstrual suppression. It is ultimately the woman's choice to suppress, but options should be available to her should she decide to do so."? Dr Virginia Wotring, Assistant Professor at the Center for Space Medicine, Baylor College of Medicine, said: "For any woman, choice of a contraceptive requires careful consideration of benefits and risks with respect to her lifestyle and needs. The spaceflight environment adds some extra complexity to the overall equation, and we want female crewmembers to be able to make well-informed choices for their missions. Because loss of bone mineral density is known to occur on spaceflight missions, we need more data regarding health effects, including bone health, with long-term use of hormone treatments not just for contraception (as most women use them), but also for the less-common use to suppress menses." More information: Varsha Jain et al, Medically induced amenorrhea in female astronauts, npj Microgravity (2016). DOI: 10.1038/npjmgrav.2016.8


News Article | December 2, 2015
Site: www.chromatographytechniques.com

A newly discovered biological mechanism channels a mother’s available energy — in the form of fat — straight to the reproductive system during stressful times, protecting future offspring at the cost of the mother’s health. USC’s Sean Curran observed the phenomenon in the worm species C. elegans, but the cellular mechanisms associated with it also exist in humans, raising the possibility that we may share this trait as well. When an organism is exposed to external stresses such as famine, a protein that protects cells called SKN-1 is activated. In addition to stress resistance, activation of SKN-1 also drives the reallocation of lipids from the organism’s soma, or bodily cells, to its germline, or reproductive system, Curran found. Once there, the fats fuel the development of oocytes, or egg cells, making successful reproduction easier; however, the animal itself faces a higher likelihood of a shortened lifespan. (Most C. elegansare hermaphrodites — Curran is still exploring whether the phenomenon also occurs with the male portion of the worm’s reproductive system.) When the organism again obtains nutrients, the presence of omega-3 and -6 fatty acids stop the travel of fats into the reproductive cells, bringing the animal’s ability to resist environmental stressors back to normal. “SKN-1 plays essential roles in survival to stress at all stages in life; however, SKN-1 activation mutants are not long-lived. This is incredibly surprising and confusing at the same time since these animals should be stress resistant,” said Curran, an assistant professor with joint appointments at the USC Davis School of Gerontology and the USC Dornsife College of Letters, Arts and Sciences. “Our study shows that the reason constitutively active SKN-1 doesn’t confer longevity is because of the movement of lipids from the soma to the germline to promote the necessity of reproduction.” Curran is the senior author of a study on the mechanism published by Proceedings of the National Academy of Sciences. His collaborators include researchers from USC, Baylor College of Medicine and Massachusetts General Hospital. The researchers looked at stored fat molecules within the worms visually by staining cells and biochemically with gas chromatography and mass spectrometry. The animals underwent stress from starvation and calorie restriction as well as oxidative stress from hydrogen peroxide exposure. Oxidative stresses — an overload of reactive oxygen molecules that has been associated with cancer — can also trigger the activation of SKN-1. Since all organisms that require oxygen have to respond to oxidative stress, an understanding of how oxidative stress responses impact reproduction and vice versa is likely to yield more insights into how survival and reproduction balance against each other depending on resource availability, Curran said. “This is particularly important in the wild, where resource availability is highly variable, and unlike in the laboratory, animals in nature must constantly assess possible risk and future reward,” he explained. Curran is subsequently exploring the signaling mechanisms underlying this fat reallocation and the environmental triggers of the response. Since everything his team has found so far that regulates SKN-1 in worms has also been identified in humans and the balance of somatic resistance and reproduction is important for all organisms, the findings could have implications for reproductive success in older humans, he said. Support for the work was provided by the National Institutes of Health (grant T32AG000037 to first author and Molecular Biology PhD student Dana Lynn, R00AG032308 and R01 GM109028 to Curran), the American Heart Association (Curran), an Ellison New Scholar Award (Curran) and the American Federation for Aging Research (Curran).


News Article | November 30, 2016
Site: www.sciencemag.org

Peter Hotez used to worry mostly about vaccines for children in far-away places. An infectious diseases researcher at Baylor College of Medicine in Houston, Texas, Hotez is developing shots against diseases in poorer countries such as hookworm and schistosomiasis. But now, Hotez is anxious about children much closer to home. The number of schoolchildren not vaccinated against childhood diseases in Texas is growing rapidly, which means that the state may see its first measles outbreaks in the winter or spring of 2018, Hotez predicted in a recent article in . Disgraced antivaccine physician Andrew Wakefield has set up shop in the Texan capital, Austin, and a political action committee (PAC) is putting pressure on legislators facing a slew of vaccine-related bills. "Texas is now the center of the antivaxxer movement,” Hotez says. “There is a big fight coming,” adds Anna Dragsbaek of The Immunization Partnership, a nonprofit organization in Houston that advocates for vaccinations. Texas still has one of the highest vaccination rates for childhood diseases overall, 97.4%, according to the U.S. Centers for Disease Control and Prevention. But the number of children not vaccinated because of their parents' “personal beliefs”—as opposed to medical reasons—has risen from 2300 in 2003, when such exemptions were introduced, to more than 44,000 so far this year, according to numbers prepared by The Immunization Partnership based on Texas Department of State Health Services data. The actual number may be much higher because an estimated 300,000 Texan children are schooled at home, says Susan Wootton, an infectious disease pediatrician at the University of Texas in Houston; though the law requires these kids to be immunized too, parents don't need to submit proof of vaccination. Measles is an extremely contagious pathogen and often the first one to spread when vaccination rates dip below about 95%. The risk of outbreaks is even greater because unvaccinated children aren't randomly distributed. In Gaines county in western Texas, for instance, the exemption rate is already 4.8%, and at one school in Austin, it's 40%. "I would describe Texas as sitting on a ticking time bomb," Wootton says. Not everyone is so gloomy. Some counties in Washington and Colorado have higher levels of exemptions, says immunologist Diane Griffin of the Johns Hopkins Bloomberg School of Public Health in Baltimore, Maryland. “I don’t think that Texas is any worse than a number of other states, but pointing out the problem and the solution is important,” she wrote in an email. But Hotez believes the situation in the Lone Star State is more perilous. One factor is the arrival of Wakefield, widely seen as the father of the modern antivaccine movement. Wakefield published a paper in in 1998 that alleged a link between the MMR vaccine (which combines shots against measles, mumps, and rubella) and autism. Several large studies have failed to find the link, Wakefield's paper was retracted in 2010, and he was disbarred as a physician after the U.K. General Medical Council found him guilty of dishonesty and endangering children. Wakefield has appeared at screenings of his film Vaxxed, released in April, all over Texas and has testified at many city councils, Dragsbaek says. “He is definitely a major influencer.” Meanwhile, a PAC named Texans for Vaccine Choice has sprung up after state Representative Jason Villalba, a Republican lawyer from Dallas, proposed scrapping nonmedical exemptions last year. (The bill was never voted on.) “While they do not have a whole lot of money, they have a lot of people that they can deploy to interfere in primary campaigns,” Dragsbaek says. “They made Villalba's primary campaign very, very difficult.” Rebecca Hardy, director of state policies at Texans for Vaccine Choice, says the group is not trying to convince parents that vaccines are dangerous, but fighting for their right not to immunize their children. (It's also helping them apply for exemptions.) Though almost all U.S. states allow religious exemptions from vaccination, only 18 permit exemptions based on personal beliefs; with 27 million residents, Texas is the most populous one. Another hotbed of resistance to vaccines, California, stopped allowing "philosophical exemptions"—which covered religious and personal beliefs—this year, after a measles outbreak that sickened more than a hundred people. The change in legislation led some Californians opposing vaccines to move to Texas, Hotez says. The Texas legislature is now pondering several bills that would help shore up vaccination. One would make it compulsory for parents to complete an online course before refusing vaccination; another would require them to discuss their decision with a doctor. The bill with the best chances may be one that would allow parents to know the immunization rates at their child’s school. “This does not infringe on anyone’s right to have an exemption, it simply allows parents who need to protect their children to have adequate information to do so,” Dragsbaek says. But Hardy says her PAC is opposed to even this bill: “If it's truly about a parent's right to know the health status of a campus, then why are we not proposing bills that would give the rates of HIV-positive kids on campus, or hepatitis B-positive kids?" she asks. For Hotez, who has a daughter suffering from autism, it’s a personal issue. Wakefield is preying on parents' fears, he says: "It gets me enraged and it diverts resources away from understanding the real causes of autism, developing better diagnostics, or providing better resources for parents.” He worries that if antivaxxers are successful in Texas, their views may spread across the United States and abroad. Adding to his worries is the fact that President-elect Donald Trump has repeated the discredited claims of a link between autism and vaccines on Twitter and in an interview, and has met with antivaccine activists during his campaign. Heidi Larson, an anthropologist at the London School of Hygiene & Tropical Medicine who studies public trust in vaccines, says Hotez is right to sound the alarm. "I think it’s important that they bring attention to this trend and not wait for an outbreak,” Larson says. Correction, 3 December 2016, 2:00 p.m.: A previous version of this story incorrectly said that Villalba's bill had been voted down in the Texas House of Representatives. The bill was refered to committee but not voted on.


News Article | December 1, 2016
Site: www.eurekalert.org

Previous studies identified the Hippo pathway kinases LATS1/2 as a tumor suppressor, but new research led by University of California San Diego School of Medicine scientists reveals a surprising role for these enzymes in subduing cancer immunity. The findings, published in Cell on December 1, could have a clinical role in improving efficiency of immunotherapy drugs. "Before our study, no one knew that the Hippo pathway was regulating immunogenicity," said first author Toshiro Moroishi, MD, PhD, postdoctoral researcher at UC San Diego Moores Cancer Center. "LATS1/2 deletion in cancer cells improves tumor immunogenicity, leading to the destruction of cancerous cells by enhancing anti-tumor immune responses." Hippo pathway signaling regulates organ size by moderating cell growth, apoptosis and stem cell renewal, but dysregulation contributes to cancer development. In vitro studies of Hippo pathway kinases LATS1/2 showed that the loss of these enzymes promoted cell proliferation and tumor survival. In vivo research using immune-compromised mouse models also supports a tumor suppressor function of the Hippo pathway. However, when Moroishi and team deleted LATS1/2 from mouse cancer cells and examined tumor growth in models with healthy immune systems researchers found that immunogenicity -- the ability to stimulate an immune response -- improved, destroying cancer cells. Researchers caution that immune systems of mouse models are different from the human immune system so the response might be different and further studies are needed. If the outcome proves to be the same, using a LATS1/2 inhibitor alone or in combination with an immune checkpoint inhibitor may stimulate the immune system of patients that previously did not respond to immunotherapy treatments. Currently, most immunotherapy research focuses on targeting the immune system, but the new findings reveal that tumor cells may also be vulnerable to inhibitors. "Inhibiting LATS1/2 could be an attractive approach to treat cancer," said Kun-Liang Guan, PhD, Distinguished Professor of Pharmacology at Moores Cancer Center and senior author of the study. "LATS is an ideal target because there are many kinase inhibitors that have been successfully developed as cancer drugs." This study focused on breast cancer, melanoma and squamous cell carcinoma but the same could be applied to other cancers, said Moroishi. Study co-authors include: Tomoko Hayashi, Yu Fujita, Dennis A. Carson, UC San Diego; Wei-Wei Pan, UC San Diego and Jiaxing University; Matthew V. Holt, and Jun Qin, Baylor College of Medicine. Disclosure: Kun-Liang Guan is co-founder of Vivace Therapeutics and holds equity interest.


News Article | February 21, 2017
Site: www.businesswire.com

NEW YORK, HOUSTON, & GABORONE, Botswana--(BUSINESS WIRE)--His Excellency the President Lieutenant General Dr. Seretse Khama Ian Khama of the Republic of Botswana, the Honorable Minister Dorcas Makgato of the Ministry of Health and Wellness, the Bristol-Myers Squibb Foundation, Texas Children’s Cancer and Hematology Centers (TXCH) and Baylor College of Medicine International Pediatric AIDS Initiative at Texas Children’s Hospital (BIPAI) through public-private partnerships with the governments of Botswana, Uganda and Malawi, announced a $100 million initiative to create an innovative pediatric hematology-oncology treatment network in southern and east Africa. The comprehensive initiative called Global HOPE (Hematology-Oncology Pediatric Excellence) will build long-term capacity to treat and dramatically improve the prognosis of thousands of children with cancer and blood disorders in southern and eastern Africa. In the United States, 80 percent of children with cancer survive. In sub-Saharan Africa, the overwhelming majority of pediatric patients do not survive. The mortality rate is estimated to be as high as 90 percent, meaning that thousands of children die from cancer across Africa each year. This is in large part due to an inadequate healthcare infrastructure and a significant lack of expert physicians and other healthcare workers trained to treat children with cancer. The most common types of childhood cancers are blood cancers, including leukemia and lymphoma. Global HOPE will partner with local Governments and Ministries of Health to build medical capacity to diagnose and treat pediatric blood disorders and cancer in Botswana, Malawi and Uganda. The initiative will also create significant clinical, educational and research capabilities. Doctors, nurses and ancillary professionals will be recruited from around the world to provide training to local healthcare professionals and to begin treating children with blood disorders and cancer immediately. “ This project is building on a solid foundation for pediatric cancer treatment in Botswana that began with pediatric oncologists from Texas Children’s Cancer and Hematology Centers,” said His Excellency the President Lieutenant General Dr. Seretse Khama Ian Khama of the Republic of Botswana. “ The Global HOPE program will bring to Botswana the latest bio-medical technologies and the potential to work with local institutions such as the Botswana Innovation Hub and University of Botswana to quickly increase the survival of children with cancer and life-threatening blood disorders in Botswana and the region.” The Bristol-Myers Squibb Foundation is committing $50 million over five years to fund the training of healthcare providers as well as clinical infrastructure and operations. BIPAI will raise an additional $50 million for the initiative. “ We are eager to get started on this critical initiative to help children with blood disorders and cancer. Working with our partners and drawing on our expertise of building sustainable health systems in underserved countries, we will help make a significant difference in the outcomes for children while creating a blueprint for other countries to follow,” said Giovanni Caforio, M.D., chairman of the board of the Bristol-Myers Squibb Foundation and chief executive officer, Bristol-Myers Squibb Company. “ This initiative builds on 18 years of success of the Foundation’s SECURE THE FUTURE® program and will offer new hope to families impacted by pediatric blood disorders and cancer.” As public-private partnerships, the various governments will each play an important role in developing the pediatric hematology-oncology network, assisting with the training, technical assistance, logistics and resources to support Global HOPE. The Global HOPE initiative will train an estimated 4,800 healthcare professionals from Botswana, Uganda, Malawi and other African countries, including doctors and nurses specializing in pediatric hematology-oncology and social workers. The program estimates that over 5,000 children will receive care in the first five years. “ With only five pediatric oncologists currently in the countries of Botswana, Malawi and Uganda combined, there are simply not enough expert doctors to treat all the children diagnosed with blood disorders and cancer. We believe in these countries there are more than 11,000 new cases annually of pediatric cancer and 40,000 new cases of serious, life-threatening blood disorders such as sickle cell disease and hemophilia. Because of these staggering numbers, more healthcare providers with special expertise are urgently needed,” said David G. Poplack, M.D., director of Texas Children’s Cancer and Hematology Centers and Professor of Pediatric Oncology at Baylor College of Medicine. “ Global HOPE will help build capacity in the region to diagnose and care for children with blood disorders and cancer, offering the potential for transformational change in survivorship for these children.” The Global HOPE initiative will be modeled on the work of the Bristol-Myers Squibb Foundation, BIPAI and the Governments of Botswana, Uganda and Malawi, which created the largest pediatric HIV treatment network in the world, leveraging existing experience, infrastructure, and public/private partnerships created through the initiative. Since 2003, the Bristol-Myers Squibb Foundation and BIPAI have trained 52,000 healthcare professionals and currently provide care for nearly 300,000 children with HIV and their families in sub-Saharan Africa, lowering the mortality rate for these children to 1.2 percent. “ The success we’ve had in radically changing the course of pediatric HIV/AIDS in sub-Saharan Africa is due in large part to the tremendous support provided by the country governments, healthcare providers on the ground and donors who have made our work possible,” said Mark W. Kline, M.D., president and founder of BIPAI, physician-in-chief of Texas Children’s Hospital and chair of the Department of Pediatrics at Baylor College of Medicine. “ We look forward to helping patients and their families by embarking on this unchartered area of cancer care in Africa. Working with our partners, we aim to build a self-sustaining infrastructure that changes the tide of these childhood diseases in sub-Saharan Africa.” About the Republic of Botswana and the Ministry of Health and Wellness Botswana is a country with two million inhabitants in southern Africa with abundant and diverse natural resources. The official languages are English and Setswana. Since independence in 1966, Botswana has been a parliamentary republic; the chief of state and head of government is the president. Botswana’s economy is a success story in southern Africa due to the investment of the government in the education, health, clean water and telecommunications sectors to create a better standard of living for its citizens and to foster a conducive environment for free enterprise to prosper. The Ministry of Health and Wellness aims to improve the physical, mental, and social well-being of every citizen of Botswana to fully contribute to the development of Botswana through a healthy nation. The Bristol-Myers Squibb Foundation is committed to improving the health outcomes of populations disproportionately affected by serious diseases by strengthening healthcare worker capacity, integrating medical care and community-based supportive services, and addressing unmet medical need. The Foundation engages partners to develop, execute, evaluate and promote innovative programs to help patients with lung cancer and removing barriers to accessing care in the United States, HIV and comorbid diseases such as cervical and breast cancers and tuberculosis in sub-Saharan Africa, hepatitis B and C in China and India and veterans’ mental health and well-being in the U.S. Since 1999, the Bristol-Myers Squibb Foundation’s SECURE THE FUTURE® initiative has been working with partners in Africa to provide care and support for communities affected by HIV, tuberculosis, women’s cancer and most recently, lung cancer. Global HOPE will apply this same transformational model to pediatric oncology and hematology in a number of the same geographic areas. Texas Children’s Cancer and Hematology Centers (TXCH) is the largest pediatric hematology-oncology program in the U.S., treating patients from 35 states and 26 countries. TXCH performs advanced patient care, cutting edge clinical and laboratory research and has largest training program for pediatric hematology-oncology in the U.S. With a staff of renowned experts, the centers have developed a wide array of programs aimed at curing children with diagnoses ranging from the most common to the very rare. The team of 186 faculty and nearly 1,000 staff have pioneered many of the now standard treatments for pediatric cancer and blood disorders. TXCH has a long-standing commitment to improving global health. For more information, please visit txch.org. Baylor International Pediatric AIDS Initiative (BIPAI) is a non-profit organization dedicated to providing pediatric and maternal health care in resource limited settings. BIPAI medical teams offer free medical care and medical education for HIV/AIDS, tuberculosis, malaria, malnutrition, obstetrics/gynecology, hematology/oncology and more. Partnering with Texas Children’s Hospital and Baylor College of Medicine, BIPAI operates in 11 countries, caring for nearly 300,000 children and their families. Learn more at www.bipai.org.


News Article | March 10, 2016
Site: phys.org

Sequencing and comparative analysis of the genome of the Western Orchard predatory mite has revealed intriguingly-extreme genomic evolutionary dynamics through an international research effort co-led by scientists from the University of Geneva and the SIB Swiss Institute of Bioinformatics. In a study published in the journal Genome Biology and Evolution, the researchers detail the initial insights into several remarkable features of the genome of this agriculturally important mite that is widely employed to control plant pests, with thousands shipped to fruit growers every day. As a major natural enemy of several damaging agricultural pests, the predatory mite Metaseiulus occidentalis is used in many agricultural settings as an effective biological control agent. Some of its favourite prey include spider mites that feed on and destroy various fruits including strawberries, apples, peaches and grapes. "I have been studying the behaviour, ecology, and molecular biology of these mites for more than 40 years," said Prof. Marjorie Hoy lead author from the University of Florida USA, "so I was very keen to sequence the entire genome to reveal the full catalogue of genes." To explore the unique biology of this agriculturally important predator the researchers focused their studies on genes putatively involved in processes linked to paralysis and pre-oral digestion of prey species and its rather rare parahaploid sex determination system, as well as how it senses chemical cues from its surroundings and defends itself from infections. Compared with other arthropod species, the evolutionary history of this mite's genome has been particularly dynamic. For example, the team's analyses revealed remarkably more intron gains and losses than in other arthropods. "The dynamic gains and losses of introns in the genes of this mite are in stark contrast to its closest relative with a draft genome assembly, the Ixodes tick" described Dr Robert Waterhouse, lead author from the University of Geneva and the SIB Swiss Institute of Bioinformatics. They identified five copies of Dicer-2, a gene found almost exclusively in single-copy in other arthropods, suggesting a possible rewiring of RNA processing pathways. The Hox genes, which are important for determining animal body plans and are located in a cluster of neighbouring genes in almost all species examined to date, were found to be completely dispersed across the mite's genome. "This raises questions about how regulatory programmes that turn Hox genes on and off during the coordinated development of complex body plans can be achieved even when the genes are no longer physically close to each other in the genome" explained Dr Waterhouse. "These resources greatly improve the genomic sampling of chelicerates, a group of arthropods that has so far been poorly represented mainly due to challenges associated with their often very large genomes" said Prof. Stephen Richards from the Baylor College of Medicine USA, where the genome sequencing was performed. Indeed, results from the study's phylogenomic analyses question the relationships amongst some of the major chelicerate groups of mites, ticks, and spiders, further emphasising the need for improved genomic sampling in this clade. This reference genome assembly therefore provides valuable new high-quality resources for future functional genomic and taxonomic analyses of this family of predatory mites and other arachnids. Explore further: Big pest, small genome: Blueprint of spider mite may yield better pesticides More information: Marjorie A. Hoy et al. Genome sequencing of the phytoseiid predatory mite reveals completely atomised genes and super-dynamic intron evolution , Genome Biology and Evolution (2016). DOI: 10.1093/gbe/evw048


VANCOUVER, BRITISH COLUMBIA--(Marketwired - Nov. 29, 2016) - Targeted Microwave Solutions Inc. (TSX VENTURE:TMS)(OTCQX:TGTMF)(FRANKFURT:A2ACNT) ("TMS", the "Company") is pleased to announce a series of initiatives aimed at driving shareholder value, and global commercialization. To accomplish this objective, the Board has appointed Dr. James Young, currently Interim Chief Executive Officer and Chairman, to take on the role of Chief Executive Officer on a full-time basis, effective immediately. "Dr. Young is the architect and visionary behind the Company's technology. He has a distinguished career overseeing and executing research and development programs, delivering commercial deployment and capitalizing on global growth strategies. In addition, he has a deep understanding of TMS's technology and its operations," said Dr. Rajiv Modi, Director of the Board as well as Chairman and Managing Director of Cadila Pharmaceuticals Ltd., one of the largest privately held pharmaceutical companies in India. Dr. Young served as Chairman since May 2015 and has acted as interim CEO of TMS since June 2016. During Dr. Young's time as interim CEO, the Company has: To further align shareholder interests, Dr. Young has elected to forgo his salary as CEO, provided TMS finalizes a competitive stock based compensation package on market terms. The Company expect to finalize the stock based compensation package in the near term. "I am enthusiastic about my long-term role as Chief Executive Officer. My full-time focus will be on creating shareholder value by preparing the Company to take our technology to market. We will aim to add new Board members with specific industrial and capital markets experience as well as expand our organization's capabilities with key partners and contractors. In addition, I will be spearheading our global commercialization strategies, which will include the USA, Canada, China and India. We will also roll out a new investor relations strategy and increased communications. Together, we believe that these initiatives will help position TMS as a leading innovator in industrial de-hydration technology and a high growth company in attractive markets," said Dr. James Young. In addition to TMS, Dr. Young also serves as the Chairman of the Board of Directors of Novavax, Inc. and is on the Board of Directors for 3-V Biosciences, Inc., a private drug company. Dr. Young was President of R&D for MedImmune, Inc. from 1989 through 2008 following its USD$15.6 billion sale to AstraZeneca PLC in 2007. During his tenure, Dr. Young was directly involved in the development of approximately twenty clinical programs and the commercialization of numerous key drugs while managing approximately 1,500 people and controlling an annual budget in excess of USD$700 million. Prior to his tenure at MedImmune, Dr. Young was a Director in the Department of Molecular Genetics at Smith Kline and French Laboratories, now part of GlaxoSmithKline. Dr. Young has served on the Boards of Xencor, Inc., Iomai, Inc. and Arriva Pharmaceuticals, Inc. Dr. Young received his Ph.D. in Microbiology and Immunology from Baylor College of Medicine. On behalf of the Board of Directors, Targeted Microwave Solutions Inc. is a clean technology company that designs microwave reactors to dry and process coal, clay and biomass. The technology is more efficient, requires significantly lower capital expenditures and is more environmentally friendly than traditional drying technologies. TMS' reactors are designed to be fully automated, require less maintenance, occupy a much smaller footprint and dry more product in less time than conventional counterparts. The Company's R&D and commercial demonstration plant in King William, Virginia is strategically located near several major industrial clay and biofuel manufactures. The marketing and testing facility in Shanghai, China collects and analyzes material samples from nearby coal power plants and coal mines. The Company is a reporting issuer in Canada and is listed on the following stock exchanges: (TSX VENTURE:TMS)(FRANKFURT:A2ACNT)(OTCQX:TGTMF) For further information, please visit www.tmsenergy.com or review the Company's public disclosure filing on www.sedar.com. This news release contains certain statements which are, or may be deemed to be "forward-looking statements". Forward-looking statements are statements that address or discuss activities, events or developments that we expect or anticipate may occur in the future. Forward-looking statements consist of statements that are not purely historical and, in this news release, include, without limitation, statements regarding: TMS's goals at driving global commercialization and creating shareholder value; adding new Board members with industry and capital markets experience; expanding TMS's capabilities with key partners and contractors; and positioning TMS as a leading innovator in de-hydration technology. When used in this news release, words such as "estimates", "expects", "plans", "anticipates", "projects", "will", "believes", "intends", "should", "could", "may" and other similar terminology are intended to identify such forward-looking statements. Forward-looking statements reflect the then-current expectations, beliefs, assumptions, estimates and forecasts of our management. Because forward-looking statements involve known and unknown risks, uncertainties, assumptions and other factors which are difficult to predict, our actual results, performance or achievements or the actual results or performance of the industries and markets in which we operate and intend to operate may be materially different from those anticipated in our forward-looking statements. Forward-looking statements involve significant uncertainties and risks, should not be read as a guarantee of future performance or results and will not necessarily be an accurate indication of whether or not such results will be achieved. A number of factors could cause actual results to differ materially from the results discussed in our forward-looking statements, including the ability to finalize a competitive package for Dr. Young, or retaining Dr Young as CEO, identify and attracting satisfactory board members with appropriate industry and capital markets experience; identifying and attracting satisfactory partners and contractors to bring the TMS technology to market, and negotiating and executing definitive documentation on reasonable commercial terms and such other matters described in our public filings available on SEDAR at www.sedar.com. Accordingly, readers should exercise caution in relying upon our forward-looking statements and we undertake no obligation to publicly revise such statements to reflect subsequent events or circumstances, except as required by law. Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release.


News Article | February 15, 2017
Site: www.eurekalert.org

New Rochelle, NY, February 15, 2017--Antibiotic exposure before age 6 months was associated with an increased risk for obesity at 2 years of age in a study of Latino infants in a low-income urban community. Harmful effects of antibiotics on the healthy gut microbiome during this sensitive developmental period could increase obesity risk, according to an article published in Childhood Obesity, a peer-reviewed journal from Mary Ann Liebert, Inc., publishers. The article is available free on the Childhood Obesity website until March 17, 2017. In the article "Early Antibiotic Exposure and Risk of Childhood Obesity in Latinos," Annette Ville, Melvin Heyman, Rosalinda Medrano, and Janet Wojcicki, University of California San Francisco, evaluated mothers' reports of infant antibiotic exposure (type and frequency) at 6 months and 1 year of age and their descriptions of infant dietary intake. The researchers showed a statistically significant increased risk for early rapid weight gain and obesity at age 2 years among infants exposed to antibiotics during the first 6 months of life. "While recent cross-sectional and longitudinal studies have shown a relationship between early antibiotic exposure and child obesity, a clever recent secondary analysis of a randomized clinical trial detected no such relationship. Obviously more such research is needed," says Childhood Obesity Editor-in-Chief Tom Baranowski, PhD, Baylor College of Medicine, Houston, TX. "The work by Dr. Ville and colleagues expands this work to Latino families and detects quite strong odds ratios for obesity from early antibiotic use even after controlling for potential confounding variables. While this is obviously not the last word in this important area of research, it provides an important piece of the puzzle." Research reported in this publication was supported by the National Institutes on Health under Award Number DK080825. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Childhood Obesity is a bimonthly peer-reviewed journal, published in print and online, and the journal of record for all aspects of communication on the broad spectrum of issues and strategies related to weight management and obesity prevention in children and adolescents. Led by Editor-in-Chief Tom Baranowski, PhD, Baylor College of Medicine, and Editor Elsie M. Taveras, MD, MPH, Massachusetts General Hospital for Children & Harvard Medical School, the Journal provides authoritative coverage of new weight management initiatives, early intervention strategies, nutrition, clinical studies, comorbid conditions, health disparities and cultural sensitivity issues, community and public health measures, and more. Complete tables of content and a sample issue may be viewed on the Childhood Obesity website. Mary Ann Liebert, Inc., publishers is a privately held, fully integrated media company known for establishing authoritative medical and biomedical peer-reviewed journals, including Metabolic Syndrome and Related Disorders, Population Health Management, Diabetes Technology & Therapeutics (DTT), and Journal of Women's Health. Its biotechnology trade magazine, GEN (Genetic Engineering & Biotechnology News), was the first in its field and is today the industry's most widely read publication worldwide. A complete list of the firm's 80 journals, newsmagazines, and books is available on the Mary Ann Liebert, Inc., publishers website.


News Article | February 27, 2017
Site: www.chromatographytechniques.com

The genetic material of an organism encodes the instructions that guide its development. These codes are not written in stone; they can change or mutate any time during the life of the organism. Single changes in the code can occur spontaneously, as a mutation, causing developmental problems. Others, as an international team of researchers has discovered, are too numerous to be explained by random mutation processes present in the general population. When such multiple genetic changes occur before or early after conception, they may inform scientists about fundamental knowledge underlying many diseases. The study appears in Cell. "As a part of the clinical evaluation of young patients with a variety of developmental issues, we performed clinical genomic studies and analyzed the genetic material of more than 60,000 individuals. Most of the samples were analyzed at Baylor Genetics laboratories," said lead author Pengfei Liu, assistant professor of molecular and human genetics Baylor College of Medicine and assistant laboratory director of Baylor Genetics. "Of these samples, five had extreme numbers of genetic changes that could not be explained by random events alone." The researchers looked at a type of genetic change called copy number variants, which refers to the number of copies of genes in human DNA. Normally we each have two copies of each gene located on a pair of homologous chromosomes. "Copy number variants in human DNA can be compared to repeated or missing paragraphs or pages of text in a book," said senior author James R. Lupski, Cullen Professor of Molecular and Human Genetics at Baylor. "For instance, if one or two pages are duplicated in a book it could be explained by random mistakes. On the other hand, if 10 different pages are duplicated, you have to suspect that it did not happen by chance. We want to understand the basic mechanism underlying these multiple new copy number variant mutations in the human genome." The researchers call this phenomenon multiple de novo copy number variants. As the name indicates, the copy number variants are many and new (de novo). The latter means that the patients carrying the genetic changes did not inherit them from their parents because neither the mother nor the father carries the changes. In this rare phenomenon, the copy number variants are predominantly gains – duplications and triplications – rather than losses of genetic material, and are present in all the cells of the child. The last piece of evidence together with the fact that the parents do not carry the alterations suggest that the extra copies of genes may have occurred either in the sperm or the egg, the parent's germ cells, and before or very early after fertilization. "This burst of genetic changes happens only during the early stages of embryonic development and then it stops," Liu said. "Interestingly, despite having a large number of mutations, the young patients present with relatively mild neurological problems." The researchers are analyzing more patient samples looking for additional cases of multiple copy number variants to continue their investigation of what may trigger this rare phenomenon. "We hope that as more researchers around the world learn about this and confirm it, the number of cases will increase," Liu said. "This will improve our understanding of the underlying mechanism and of why and how pathogenic copy number variants arise not only in developmental disorders but in cancers." This discovery was made possible in great measure thanks to the breadth of genetic testing performed and genomic data available at Baylor Genetics laboratory. "The diagnostics lab Baylor Genetics is one of the pioneers in this new era of clinical genomics-supported medical practice and disease gene discovery research," Lupski said. "They are developing the clinical genomics necessary to foster and support the Precision Medicine Initiative of the National Institutes of Health, and generating the genomics data that further drives human genome research." Using state-of-the art technologies and highly-trained personnel, Baylor Genetics analyzes hundreds of samples daily for genetic evaluation of patients with conditions suspected to have underlying genetic factors potentially contributing to their disease. Having this wealth of information and insight into the genetic mechanisms of disease offers now the possibility of advancing medicine and basic research in ways that were not available before.


News Article | November 11, 2016
Site: www.sciencedaily.com

The Asian longhorned beetle, Anoplophora glabripennis, also known as the starry sky beetle, is native to eastern Asia but has successfully invaded North America and Europe where it infests maple, birch, willow, elm, and poplar trees. Published in the journal Genome Biology, an international team of scientists report on the sequencing, annotation, and comparative exploration of this beetle's genome in an effort to develop novel tools to combat its spread and better understand the biology of invasive wood-boring pests. The project involved scientists from more than 30 research institutions worldwide, including from the SIB Swiss Institute of Bioinformatics and the University of Geneva (UNIGE). The results begin to help unravel the complex genetic and genomic basis for the invasiveness of the Asian longhorned beetle and the evolutionary success of how beetles exploit plants. The Swiss Federal Office for the Environment (FOEN) lists more than 100 invasive species already posing threats in Switzerland, including the Asian longhorned beetle and other insects such as the box tree moth, the harlequin ladybird, the Asian tiger mosquito, and the Ambrosia and Colorado potato beetles. The Swiss Federal Institute for Forest, Snow and Landscape Research (WSL) considers Anoplophora glabripennis to be one of the most dangerous pests affecting broadleaf trees. The adult female beetles chew through the tree's bark to lay their eggs in a small hole, so as soon as the larvae hatch they have a ready source of vascular plant tissue on which to feed. As they mature, the larvae then make tunnels deep into the tree's heartwood, with each larva capable of consuming up to 1'000 cubic cm of wood in its lifetime. The emerging adults will usually produce the next generation on the same host tree, but high-density infestations will eventually kill the tree so they must disperse to find new host trees for their young. It is likely that the first invaders were unknowingly imported as larvae hidden inside wooden packaging materials. New laws requiring such packaging from China to be heat-dried or chemically treated to kill any larvae have helped to limit new invasions, and effective pest inspections and increasing public awareness are proving successful to help prevent any further spread of Asian longhorned beetles in Switzerland. The collaborative research project to sequence, annotate, and explore the Anoplophora glabripennis genome was led by Prof. Duane McKenna from the University of Memphis, with DNA sequencing and genome assembly performed at the Baylor College of Medicine directed by Prof. Stephen Richards as part of the i5K arthropod genome initiative. The team of researchers who analysed this new wealth of genetic and genomic data included experts from the SIB Swiss Institute of Bioinformatics and the University of Geneva Faculty of Medicine, Dr Panagiotis Ioannidis and Dr Robert Waterhouse from the group of Prof. Evgeny Zdobnov. The international team's efforts were made possible through funding from United States agencies including the National Human Genome Research Institute, the National Science Foundation, the National Institute of Food and Agriculture, and National Institutes of Health, as well as the German Research Foundation and the Swiss National Science Foundation. Their findings from exploring the 710 megabasepair genome and its 22'035 encoded genes are published in a comprehensive manuscript in the journal Genome Biology. Sequencing and annotating the beetle's genome enabled the researchers to perform detailed comparative analyses with other insects and examine the thousands of encoded genes for clues about how they have evolved to successfully feed on tree tissues. Prof. McKenna said "Research in my laboratory has focused on the evolution of beetle-plant interactions and phytophagy, i.e. plant-feeding, so sequencing the whole genome now allows us to identify the full set of genes that facilitate the specialised feeding of this beetle on woody plants." He further explained that "In particular, gene duplication, i.e. the generation of new gene copies in this beetle genome, and their subsequent functional divergence, have been important factors that have led to the expansion and enhancement of its metabolic gene repertoire, in some cases involving genes acquired from fungi and bacteria." As well as encoding many of these enzymes required to degrade plant tissues, the genome also revealed several expanded sets of genes that are known to be important for the detoxification of the chemicals normally produced by plants to defend themselves against attacks by such pests. "This means that the beetle is able to quickly get rid of these toxic plant defence chemicals that would normally deter most insects, and continue to feed on the woody tissues of the host trees," explained Dr Ioannidis. Dr Waterhouse added that "Using our comparative genomics tools including OrthoDB and BUSCO, we were able to classify genes into those shared across many insect species and those that are specific to beetles, especially plant-feeding beetles, to highlight genes that may be particularly important for the biological innovations that have allowed beetles to become such a successful -- and in this case dangerous -- group of insects."


News Article | November 14, 2016
Site: globenewswire.com

LEXINGTON, Mass., Nov. 14, 2016 (GLOBE NEWSWIRE) -- Curis, Inc. (NASDAQ:CRIS), a biotechnology company focused on the development and commercialization of innovative and effective drug candidates for the treatment of human cancers, today announced the appointment of Lori A. Kunkel, M.D. to its Board of Directors. Dr. Kunkel currently serves on the Board of Directors at Loxo Oncology, where she was formerly Acting Chief Medical Officer.  Prior to Loxo Oncology, Dr. Kunkel served as Chief Medical Officer at Pharmacyclics, Inc. leading integrated clinical development highlighted by the approval of IMBRUVICA®. She has also served as Chief Medical Officer at Proteolix Inc. (acquired by Onyx), Syndax, and ACT Biotech. Prior to joining the biotechnology industry in 1995, Dr. Kunkel spent ten years in academic/clinical medicine and served as a faculty member in the Division of Hematology/Oncology’s Bone Marrow Transplant Unit at University of California, Los Angeles. She trained in internal medicine at Baylor College of Medicine, hematology at USC and oncology at UCLA, earning board certifications in these specialties. “We are delighted to welcome Lori to the Board of Curis and we will benefit tremendously from her depth of experience and instincts as we develop our drug candidates and place the company on a path for approval and commercialization of our products,” said CEO Ali Fattaey.  “Lori is well known and respected in the biotechnology community and we have benefited from her role as an advisor to the company in the past.” “I am pleased to join the Curis Board and look forward to working closely with the Board and management team as we collectively advance Curis as a leading oncology company,” said Dr. Kunkel. About Curis, Inc.  Curis is a biotechnology company focused on the development and commercialization of innovative and effective drug candidates for the treatment of human cancers. The Company's clinical drug candidates include CUDC-907, which is being investigated in a Phase 2 trial in patients with Diffuse Large B Cell Lymphoma, or DLBCL, and in a separate Phase 1 trial in patients with solid tumors. As part of a broad collaboration with Aurigene, Curis has an exclusive license to CA-170, an oral small molecule PD-L1/VISTA antagonist that is currently being investigated in a Phase 1 trial in patients with solid tumors or lymphoma. Curis also has an exclusive license to oral small molecule antagonists of the PD-1 and TIM-3 pathways, including PD-L1/TIM-3 antagonist CA-327, as well as to molecules designed to inhibit the IRAK4 kinase, including CA-4948.  Curis is also party to a collaboration with Genentech, a member of the Roche Group, under which Genentech and Roche are commercializing Erivedge® for the treatment of advanced basal cell carcinoma, and are further developing Erivedge in other diseases including idiopathic pulmonary fibrosis and myelofibrosis. For more information, visit Curis's website at www.curis.com. Cautionary Statement This press release contains forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995, including without limitation statements regarding the potential advantages and benefits of small molecule checkpoint inhibitors and the Company's plans and expectations for the collaboration with Aurigene, including its plans to discover and develop multiple first-in-class oral, small molecule checkpoint inhibitors for the treatment of patients with cancer. Forward-looking statements may contain the words "believes," "expects," "anticipates," "plans," "seeks," "estimates," "assumes," "will," "may," "could" or similar expressions. These forward-looking statements are not guarantees of future performance and involve risks, uncertainties, assumptions and other important factors that may cause actual results to be materially different from those indicated by such forward-looking statements. For example, Curis may experience adverse results, delays and/or failures in its drug development programs and may not be able to successfully advance the development of its drug candidates in the time frames it projects, if at all. Curis's drug candidates may cause unexpected toxicities, fail to demonstrate sufficient safety and efficacy in clinical studies and/or may never achieve the requisite regulatory approvals needed for commercialization. Favorable results seen in preclinical studies and early clinical trials of Curis's drug candidates may not be replicated in later trials. There can be no guarantee that the collaboration agreement with Aurigene will continue for its full term, that Curis or Aurigene will each maintain the financial and other resources necessary to continue financing its portion of the research, development and commercialization costs, or that the parties will successfully discover, develop or commercialize drug candidates under the collaboration. Regulatory authorities may determine to delay or restrict Genentech's and/or Roche's ability to continue to develop or commercialize Erivedge in BCC. Erivedge may not demonstrate sufficient or any activity to merit its further development in disease indications other than BCC. Competing drugs may be developed that are superior to Erivedge. Curis faces risks relating to its wholly-owned subsidiary's royalty-collateralized loan transaction, including the risk that it may not receive sufficient levels of royalty revenue from sales of Erivedge to satisfy the debt obligation or may otherwise lose its rights to royalties and royalty-related payments as a result of a foreclosure of the loan. Curis will require substantial additional capital to fund its business and such capital may not be available on reasonable terms, or at all. Curis faces substantial competition. Curis also faces risks relating to potential adverse decisions made by the FDA and other regulatory authorities, investigational review boards, and publication review bodies. Curis may not obtain or maintain necessary patent protection and could become involved in expensive and time-consuming patent litigation and interference proceedings. Unstable market and economic conditions and unplanned expenses may adversely affect Curis's financial conditions and its ability to access the substantial additional capital needed to fund the growth of its business. Important factors that may cause or contribute to such differences include the factors set forth under the caption “Risk Factors” in our in our most recent Form 10-K and Form 10-Q and the factors that are discussed in other filings that we periodically make with the Securities and Exchange Commission (“SEC”). In addition, any forward-looking statements represent the views of Curis only as of today and should not be relied upon as representing Curis's views as of any subsequent date. Curis disclaims any intention or obligation to update any of the forward-looking statements after the date of this press release whether as a result of new information, future events or otherwise, except as may be required by law.


News Article | December 14, 2016
Site: www.nature.com

Jiri Lukas' research centre was at a crossroads four years ago. Bankrolled by the Novo Nordisk Foundation, the organization was facing a mid-term evaluation, and its funding was at risk. Lukas, executive director of the Center for Protein Research at the University of Copenhagen, wanted to apply for a grant extension, but was worried that his efforts would be wasted. It was rare at the time for foundations that award grants for biomedical research to further their support beyond one-time, limited-term funding. A colleague told Lukas that the science in his application was strong, but that the application itself didn't make the best case for the societal impact and unique nature of the centre. The colleague advised Lukas to consult with scientific-communication specialists at Elevate Scientific in Malmö, Sweden. “The rest was kind of a fairy tale,” Lukas says. With help from Elevate, the centre won the extension. When it comes to seeking either government or private funding, grant writers and editors are a useful resource for scientists in both academia and industry. Scientists call on them for a variety of reasons. Some simply don't have time to do it themselves. Others know that they aren't good writers, or lack a sufficient command of English. Some are struggling to get funding. Grant writers can help with finding the right organizations to fund a project, as well as with writing the application. They can hone and focus the message, ensure consistency between sections drafted by different authors and assure adherence to strict page limits. Grant writers and editors help with everything that isn't the science, yet can still significantly affect a proposal's chance of success. Many researchers still go it alone in preparing grant applications, but the funding landscape has changed, and scientists are now less hesitant to ask for help, says Sheila Cherry, president of Fresh Eyes Editing in Dayton, Ohio. Many funders expect applicants to seek assistance. The written guidelines from the US National Institutes of Health (NIH), for example, make that clear: “If writing is not your forte, seek help!” There should be no shame in asking for guidance, says Anders Tunlid, a microbial ecologist at Lund University in Sweden who has reviewed grants for the European Research Council. “We need to accept that this is the way we all do it,” he says. “I don't think that everyone has written their proposals themselves.” Colleagues may be willing to review an application's scientific content — but they are typically too busy to spare the hours needed for fine-tuning. “Everyone needs a little bit of help, if only to find typos,” points out David O'Keefe, senior grant writer at the Salk Institute in La Jolla, California. The Salk offers the service for free to its researchers, but external help comes at a price: basic editing services can run from US$500 to thousands of dollars, depending on the application. “It's an investment, for sure,” says Stefano Goffredo, a marine ecologist at the University of Bologna in Italy. But after spending months on a proposal, he thinks it's worth opening his wallet to get a professional polish. Without that polish, it's all too easy for reviewers to quickly discount an application, says Laura Hales, principal of the Isis Group, a scientific consulting and communications service in Cambridge, Massachusetts. She has served as a reviewer herself and can attest to the fact that first impressions count for everything. “You have,” she says, “one chance.” Independent data are essentially non-existent on how professional grant-writing services affect success rates. Companies' claims for success range from more than three times the average rate for NIH grants to six times the average rate for the European Union's Horizon 2020 grants. But the companies themselves concede that they can offer no guarantees. “Just because I know the formula doesn't mean I'm going to get every one,” says Hales. Institutions might pay for support for a junior scientist's first few grants, says Susan Marriott, president of BioScience Writers in Houston, Texas, but the support can be useful for mid- to later-stage-career researchers, too. Working with Elevate Scientific was a “humbling” experience, says Lukas, even as a senior scientist. The editors identified unclear sections, improved graphics and strengthened the logic in the proposal to communicate the message more effectively. Senior researchers in a collaboration may also use a grant editor as a project manager to ensure that all the pieces come together in a neat package by the submission deadline. It was just such a multi-investigator project that led Bruce Johnson to call in Fresh Eyes Editing. Every author tends to use their own formatting for elements such as headings and references, he notes, and editors can give the document a consistent style. “It makes it look so much more professional,” says Johnson, chief clinical research officer at the Dana Farber Cancer Institute in Boston, Massachusetts. Editors also catch inconsistencies and redundancies in the content. For example, a large document on lung cancer does not need to repeat in every author's section that it's the leading cause of cancer deaths in the United States. And one scientist might cite a statistic that 15% of people with lung cancer have a certain mutation, whereas another might write 25%. That inconsistency could cause reviewers to think that the collaborators aren't talking to one another, Johnson says, which would not inspire a sense of confidence that the team could carry out the project together. Grant helpers vary in the assistance they provide, and at different stages of the proposal process. Some get involved at the very start, strategizing about where to apply for funding. “It's not only about how you write an application,” says Ram May-Ron, managing partner with the FreeMind Group in Boston. “The search starts with identifying which funding opportunity is the best one for a particular part of a research project.” Scientists may have heard of big funding initiatives, such as Horizon 2020, but there might be other opportunities they should consider, says Eran Har-Paz, vice-president for sales at Sunrise Projects in Rosh Ha'Ayin, Israel. “We try to build a strategy, a few alternatives to submit to,” he says. “Don't put all your eggs in one basket.” At this level, grant helpers may reach out to programme officers, says May-Ron. For example, they might ask whether an agency has funded similar research recently, and whether they're at all interested in doing so again. “If you go to the right place, you're already in a better position,” he points out. This full-scale service comes at a price, of course. Har-Paz estimates that the simplest proposal might cost a few thousand euros, with the cost escalating to €20,000 (US$21,414) or more for elaborate applications. That includes not only the strategizing, but also writing the majority of the application. Some scientists already hand off much of the writing to others. Cath Ennis, a project manager and grant writer in Vancouver, Canada, might contribute an abstract, literature review, impact statement or budget, depending on the scientists' needs — but never the research plan itself. “Our role is to take all the jobs that we can from the principal investigator, so they can focus more on the research,” she says. Other grant professionals stick to editing — but that's more than just dotting i's and crossing t's. Grant editors consider content, clarity, logic and flow. Grant professionals can be found in a variety of places: some work for a company and others as freelancers whereas some institutions have in-house specialists (see 'How to become a grant writer'). “Start talking early,” advises Marriott, who is also a virologist at Baylor College of Medicine in Houston. “Even if you don't have a grant ready yet, even if you don't know what you're going to write.” It's beneficial to get on an editor's calendar as early as possible, because by the time the deadline rolls around, they could have many scientists clamouring for their attention. Later on, editors may be still able to help, but in a more limited fashion, she says. Scientists tend to look for someone with a PhD and the right technical expertise. But the match doesn't have to be exact. “I've edited grants about nuclear physics,” says Ennis, whose background is in cancer biology. “I can still catch a typo when someone's put 'proton' instead of 'photon'.” Equally important, Ennis says, is to look for editors who specialize in the kind of grant one's after — say, NIH, Horizon 2020 or foundation grants. Every programme has its own requirements, and the professional should know those inside out. With candidates in mind, the next step is to get to know them. Ask a potential editor or writer about their process, and the services they do and don't provide, advises Cherry. “It's a lot more than just, 'What's your fee and how soon can you get this done?'” she says. Timing and costs are, nonetheless, key questions. It's best to get an estimate in advance to avoid a surprise charge later. One should also ask for a confidentiality clause in the contract. Then, be prepared for plenty of back-and-forth. “Remember that it's a collaborative process,” says Cherry. “Don't be afraid to bring up concerns and make sure you're really collaborating.”


News Article | November 23, 2016
Site: www.eurekalert.org

Home-based telemental health for depression is well received by patients and delivers as good a quality of life as in-person visits, according to the results of a clinical trial in 241 depressed elderly veterans reported in the Journal of Clinical Psychiatry by investigators at the Medical University of South Carolina and the Ralph H. Johnson VA Medical Center. Depression affects 10 percent of Americans and is a leading cause of disability and mortality. And yet, only an estimated 56 percent of patients with depression seek treatment. Barriers to treatment include mobility issues, transportation costs, missed days of work, geographic isolation and fear of the associated stigma. By overcoming some of those barriers, proponents of telemental health say it could improve access to care for these patients. Leonard E. Egede, M.D., director of the MUSC Center for Health Disparities Research and a Veterans Affairs physician, led a team of MUSC and VA Medical Center investigators, along with Christopher Frueh, Ph.D., director of clinical research at The Menninger Clinic and adjunct professor from Baylor College of Medicine. "This is the largest randomized clinical trial to date examining whether differences exist in patient perceptions, satisfaction, therapeutic alliance and quality of life between telemental health and same-room care," Egede said. Male and female veterans aged 58 years and older who met the criteria for major depressive disorder, including Vietnam-era veterans, were eligible for enrollment in the trial. All participants received eight weeks of behavioral activation therapy and were randomly assigned to telemental health or in-person counseling. Behavioral activation reflects the notion that the patient's activity plays a role in how the person feels and the goal of therapy is to reduce behaviors that promote depression. Telemental health treatment sessions were delivered via in-home videoconferencing using a standard telephone line and did not require an internet connection. The 36-item Short Form Survey was used to assess quality of life and the Charleston Psychiatric Outpatient Satisfaction Scale was used to assess patient satisfaction. Scores on these scales did not differ significantly at 12-month follow-ups between veterans who received depression care via telemental heath and those who received in-person care. Egede and colleagues had previously reported primary outcome and cost analysis results from this same trial of 241 depressed elderly veterans. In a 2015 Lancet Psychiatry article, Egede showed that telemental health was not inferior to same-room delivery in patients with a major depressive disorder for eliciting a treatment response. A treatment response was defined as a 50 percent decrease in depression symptoms at a 12-month follow-up appointment versus baseline and the absence of a diagnosis of major depressive disorder at a 12-month follow-up. In an article published online on September 28 by the Journal of Affective Disorders, Egede showed that the overall inpatient costs as well as outpatient and pharmacy costs for treating depression increase over time in elderly veterans, regardless of whether the treatment is delivered in person or via telemental health. This increase in cost is likely a result of the rising number of visits. In conjunction with these earlier findings that primary outcomes and costs for telemental health are similar to those for in-person depression care, the report in the Journal of Clinical Psychiatry suggests that telemental health is a viable alternative to in-person visits because it delivers a similar quality of life and patient satisfaction. Most of the elderly veterans enrolled in this study were men. Patients with active psychosis, dementia, a substance dependence or suicidal ideation and clear intent were excluded from the trial. As such, the study's findings may not apply to those populations. Simple solutions such as home-based videoconferencing that does not require an internet connection may be an effective way to address the mental health needs of rural patients, particularly elderly ones. However, not all insurance companies currently reimburse for telemental health for depression. Evidence that telemental heath delivers similar treatment response, patient satisfaction and quality of life at a similar cost as in-person clinics suggests that it may be time for that to change, Egede said. "Taken together, these three studies demonstrate that telemental health is equivalent to in-person care for depression in terms of primary outcomes, secondary outcomes and quality of life, as well as cost," Egede said. "It is time for telemental health to take its rightful place alongside in-person counseling as a viable option for depression care, one that will remove many barriers to care."


News Article | December 14, 2016
Site: www.nature.com

Hans Rosling knew never to flee from men wielding machetes. “The risk is higher if you run than if you face them,” he says. So, in 1989, when an angry mob confronted him at the field laboratory he had set up in what is now the Democratic Republic of the Congo, Rosling tried to appear calm. “I thought, ‘I need to use the resources I have, and I am good at talking’.” Rosling, a physician and epidemiologist, pulled from his knapsack a handful of photographs of people from different parts of Africa who had been crippled by konzo, an incurable disease that was affecting many in this community, too. Through an interpreter, he explained that he believed he knew the cause, and he wanted to test local people’s blood to be sure. A few minutes into his demonstration, an old woman stepped forward and addressed the crowd in support of the research. After the more aggressive members of the mob stopped waving their machetes, she rolled up her sleeve. Most followed her lead. “You can do anything as long as you talk with people and listen to people and talk with the intelligentsia of the community,” says Rosling. He is still trying to arm influential people with facts. He has become a trusted counsellor and speaker of plain truth to United Nations leaders, billionaire executives such as Facebook’s Mark Zuckerberg and politicians including Al Gore. Even Fidel Castro called on the slim, bespectacled Swede for advice. Rosling’s video lectures on global health and economics have elevated him to viral celebrity status, and he has been listed among the 100 most influential people in the world by the magazines Time and Foreign Policy. Melinda Gates of the Bill & Melinda Gates Foundation says, “To have Hans Rosling as a teacher is one of the biggest honours in the world.” But among his fellow scientists, Rosling is less popular. His accolades do not include conventional academic milestones, such as massive grants or a stream of publications in top-tier journals. And rather than generating data, Rosling has spent the past two decades communicating data gathered by others. He relays facts that he thinks many academics have been too slow to appreciate and argues that researchers are ignorant about the state of health and wealth around the world. That’s dangerous. “Campuses are full of siloed people who do advocacy about things they don’t understand,” he says. So now, in the sunset of his career, Rosling is writing a book with his son Ola and his daughter-in-law Anna Rosling Rönnlund to dispel outdated beliefs. It has the working title Factfulness, and they hope it will inform everyone from schoolchildren to esteemed experts about how the world has changed: how the number of births per woman worldwide has dropped over the past few decades, for example, and how average life expectancy (71 years) is now closer to that of the country with the highest (Japan, 84) than the lowest (Swaziland, 49). He reasons that experts cannot solve major challenges if they do not operate on facts. “But first you need to erase preconceived ideas,” he says, “and that is the difficult thing.” Rosling’s ambitions were born from curiosity. As a young boy in Uppsala, he listened intently as his father, a coffee-factory employee, described the hardships of the East African labourers who picked the beans. Rosling and his girlfriend, Agneta Thordeman, joined student protests against South African apartheid and the US war in Vietnam. The couple studied medicine — she as a nurse and he as a doctor — and travelled through India and southeast Asia on a shoestring budget. In 1972, they were married and seven years later they moved to Mozambique with their two small children. Rosling wanted to fulfil a promise he had made many years earlier to the founder of the Mozambican Liberation Front, Eduardo Mondlane. Mondlane had explained that Mozambique’s future would be challenging after the country gained independence from Portugal, because the nation was so poor and education levels low. Rosling recalls, “He shook my hand and looked me in the eyes and said: ‘Promise you will work with us’.” Mondlane was killed by a letter bomb soon afterwards — he did not live to see independence, which came in 1975 — but Rosling kept his word. The Mozambican government assigned Rosling to a northern part of the country, where he would be the only doctor serving 300,000 people. Because of the scarcity of health care, patients were often in excruciating pain by the time he saw them. Rosling recalls performing emergency surgery to extract dead fetuses from women on the verge of death. He watched helplessly as children perished from diseases that should have been simple to prevent. “Those years became a sort of trauma,” he says. In 1981, he received a letter from an Italian nun working as a nurse at a remote health post. “Please come,” she wrote. People in the surrounding villages had been stricken with sudden paralysis of both legs. Separating from his family, Rosling embedded himself in the crisis. He was assigned to lead a survey of 500,000 people and found that populations with the highest rate of the disease survived entirely on bitter cassava, the only crop that could grow when drought struck the region. The plant turned out to contain cyanogenic glucoside, a precursor to cyanide. Typically, soaking cassava roots in water for several days removed the toxin. But with streams running dry and families starving, women who prepared cassava had skipped this step — to their detriment. Dietary amino acids can also detoxify the poison, but people had no access to meat or beans that provide them. At the end of 1981, owing to a number of circumstances including the death of their third child, Rosling and his family returned to Sweden. Rosling became a lecturer on health care in low-income countries at Uppsala University but spent time in Tanzania and the Congo region as well, studying the paralysing disease he had first observed in Mozambique. He noticed that no matter what country he was in, the towns afflicted looked similarly tragic. Skeleton-thin people hobbled down dirt paths on makeshift crutches, or crawled with their legs twisted and dangling behind them like anchors. One Congolese community called the malady konzo, derived from a word referring to an antelope tethered at its knees. This is the name that Rosling would use in 1990, when he and his colleagues formally defined the disease and laid out the evidence for what causes it (W. P. Howlett et al. Brain 113, 223–235; 1990). As Rosling travelled, he trained African graduate students who specialized in konzo, and together they found that proper cassava processing was the most realistic method of short-term prevention. However, the message often fell on deaf ears because of hunger and conflict. Rosling became convinced that the real root of konzo resided not in cassava, but in economic devastation. “Extreme poverty produces diseases. Evil forces hide there,” he says. “It is where Ebola starts. It’s where Boko Haram hides girls. It’s where konzo occurs.” The World Bank defines extreme poverty as a state in which people survive on less than US$1.90 per day. Rosling can recognize it in other ways. He has seen it in people who must walk for hours without shoes to find water or to farm eroded soil. He sees it in those who remain short because of malnourishment, whose babies are born dangerously underweight and who are trapped with no options in life. Ultimately, he says that eliminating extreme poverty is the only way to cure konzo and prevent other maladies — both social and infectious. Money, politics and culture underlie disease in many circumstances, he argues. Take an outbreak in Cuba that Rosling investigated in 1992. The Cuban embassy in Sweden had asked him to find out whether toxic cassava could have caused roughly 40,000 people to experience visual blurring and severe numbness in their legs. On his first morning in Havana, Rosling met local epidemiologists in a conference room. “Then, two men walk in with guns, and in comes Fidel Castro,” he recalls. “My first surprise was that he was so kind, like Father Christmas. He didn’t have the attitude you might expect from a dictator.” With Castro’s approval, Rosling travelled to the heart of the outbreak, in the western province of Pinar del Río. It turned out that there was no link with cassava. Rather, adults stricken with the disorder all suffered from protein deficiency. The government was rationing meat, and adults had sacrificed their portion to nourish children, pregnant women and the elderly. Reporting back to Castro, Rosling couched his conclusions carefully: “I know your neighbours want to force their economic system on you, which I don’t like, but the system needs to change because this planned economy has brought this disease to people.” After his presentation, Rosling went to the toilet. A Cuban epidemiologist approached him to thank him. He and his colleagues had come to the same conclusion several months earlier, but they were removed from the investigation for criticizing communism. Corroboration of their work from Rosling and other independent researchers supported the policy changes that stemmed the outbreak. Back in Sweden, Rosling continued to teach global health, moving to the Karolinska Institute in Stockholm in 1996. But he came to realize that neither his students nor his colleagues grasped extreme poverty. They pictured the poor as almost everyone in the ‘developing world’: an arbitrarily defined territory that includes nations as economically diverse as Sierra Leone, Argentina, China and Afghanistan. They thought it was all large family sizes and low life expectancies: only the poorest and most conflict-ridden countries served as their reference point. “They just make it about us and them; the West and the rest,” Rosling says. How could anyone hope to solve problems if they didn’t understand the different challenges faced, for example, by Congolese subsistence farmers far from paved roads and Brazilian street vendors in urban favelas? “Scientists want to do good, but the problem is that they don’t understand the world,” Rosling says. Ola, his son, offered to help explain the world with graphics, and built his father software that animated data compiled by the UN and the World Bank. Visual aids in hand, the elder Rosling began to script the provocative presentations that have made him famous. In one, a graph shows the distribution of incomes in 1975 — a camel’s back, with rich countries and poor countries forming two humps. Then he presses ‘go’ and China, India, Latin America and the Middle East drift forward over time. Africa moves ahead too, but not nearly as much as the others. Rosling says, “The camel dies and we have a dromedary world with one hump only!” He adds, “The per cent in poverty has decreased — still it’s appalling that so many remain in extreme poverty.” Rosling’s online presentations grew popular, and the investment bank Goldman Sachs invited him to speak at client events. His message seemed to support advice from the firm’s chief economist, Jim O’Neill. In 2001, O’Neill had coined the acronym BRIC for the emerging economies of Brazil, Russia, India and China, often considered part of the developing world. He warned that financial experts ignored these rising powers at their peril. “I used to tease my colleagues who thought in a traditional framework,” O’Neill says. “Why are we talking about China as the developing world? Based on the rate of economic growth, China creates another Greece every three months; another UK every two years.” Rosling welcomed the new audience. “They request my lectures because they want to know the world as it is,” he says. The private sector needs to understand the economic and political conditions of current and potential markets. “To me it was horrific to realize that business leaders had a more fact-based world view than activists and university professors.” O’Neill left Goldman Sachs in 2013, and went on to lead a committee on global antibiotic resistance. He looked to Rosling for a big-picture view. “I wish there were more people like him,” says O’Neill. “He genuinely thinks about the future of all seven-plus-billion of us, rather than so many who claim they do but actually come at it with a narrow and national perspective.” Rising wealth pleases Rosling because he wants extreme poverty to disappear. To help get there, he celebrates improvements. He calls the UN’s push to eradicate extreme poverty by 2030 an entirely reasonable goal because the proportion of people living in extreme poverty has declined by more than half in the past quarter of a century, and the strategies needed to help the remainder are known. His attitude aligns him with Steven Pinker of Harvard University in Cambridge, Massachusetts, who wrote The Better Angels of our Nature (Viking, 2011). In the book, Pinker argues that global rates of violence are much lower than they were in the past. The two met at a TED conference in 2007, when Pinker took the stage after Rosling ended his talk by swallowing a sword (whatever grabs attention). Pinker says that Rosling made him think that “the decline in violence might be a part of an even bigger story about humans gradually making progress against other scourges of the human condition”. Both have been criticized as being Pollyannaish about the global situation in the face of tragedies such as the conflict in Syria. “People think that if you emphasize how things have gone well it is the same as saying no problems remain. That’s not true,” Pinker counters. “In fact, I strongly suspect that people are more motivated to reduce problems like poverty and violence if they think there is a good chance they can succeed.” And as a cognitive scientist, Pinker admires the animations that Rosling uses. One, which depicts countries as bubbles that migrate over time according to wealth, life span or family size, allows viewers to grasp multiple variables simultaneously. “It’s a stroke of genius,” Pinker says. “He gets our puny human brain to appreciate five dimensions.” In 2005, Rosling, Ola and Anna founded the non-profit Gapminder Foundation in Stockholm to develop the ‘moving-bubble’ software, Trendalyzer, and to spread access to information and animated graphs depicting world trends. Google acquired Trendalyzer in 2007, and Gapminder has successfully pressured the World Bank to make its data free to the public. Rosling’s charm appeals to those frustrated by the persistence of myths about the world. Looming large is an idea popularized by Paul Ehrlich, an entomologist at Stanford University in California, who warned in 1968 that the world was heading towards mass starvation owing to overpopulation. Melinda Gates says that after a drink or two, people often tell her that they think the Gates Foundation may be contributing to overpopulation and environmental collapse by saving children’s lives with interventions such as vaccines. She is thrilled when Rosling smoothly uses data to show how the reverse is true: as rates of child survival have increased over time, family size has shrunk. She has joined him as a speaker at several high-level events. “I’ve watched people have this ‘aha’ moment when Hans speaks,” she says. “He breaks these myths in such a gentle way. I adore him.” The appreciation extends to the World Health Organization: director-general Margaret Chan says that Rosling provides facts for decision-makers to consider. “He makes the case that as people grow in wealth, they grow in health,” she says. And his talks help her to convince governments that data collection can help them to track whether they are getting returns on their investments in global health. The past few years have brought new challenges. In 2014, Ebola was spreading in West Africa, and Rosling’s liver was failing. A hepatitis C infection that he had mysteriously acquired in his youth was becoming lethal. He travelled to Japan to receive the newest treatment, not yet approved in Sweden. By October, he found himself fretting, from afar, over discrepancies in official reports on the number of suspected and confirmed Ebola cases. “I realized my skills were needed,” he says. As soon as the drugs cured him, Rosling flew to West Africa to join the Liberian government’s epidemiological-surveillance team. The team wanted to consolidate data, but struggled with the disparate ways in which international agencies collected information. “We were losing ourselves in details,” says Rosling. “I saw this was a war situation: all we needed to know is, are the number of cases rising, falling or levelling off?” After a few months, it became clear that the rate of new cases had diminished. Rosling was rewarded with a traditional chieftainship by the Liberian government. Now, at the age of 68, Rosling has retreated to his red wooden house in Uppsala with Agneta. He continues to work and plugs away at his “factfulness book on megamisconceptions”. Every now and again, he stirs the pot. In October, he published a piece in The Lancet identifying a misleading statistic in a widely cited report from an advocacy organization launched by the UN (H. Nordenstedt and H. Rosling Lancet 388, 1864–1865; 2016). The group claimed that 60% of maternal deaths occur in settings of conflict, displacement and natural disaster. Rosling checked the numbers and calculated that the true amount was no more than 17%. A UN spokesperson explains that part of the discrepancy derives from the fact that in the original figure, women who gave birth in nations affected by crises were included — even if their region had not been directly impacted. Rosling blames the popularity of the dramatic-sounding statistic on the desire to raise funds at a time when refugee crises garner financial support. “Global health seems to have entered into a post-fact era, where the labelling of numerators is incorrectly tweaked for advocacy purposes,” he wrote in the Lancet article with Helena Nordenstedt, a colleague at the Karolinska Institute. The majority of maternal deaths occur among the extremely poor, they added. Those remote populations are hidden even from the aid community. Rosling prods academics when he can (see ‘Test your world knowledge’). For instance, at a Nobel-laureate meeting in Lindau, Germany, in 2014, he quizzed the audience of leading scientists on the average life expectancy in the world today. Out of three choices, just over one-quarter of the crowd picked the correct answer of 70. That’s less than would be expected by chance. The quiz spurred laughter in Lindau, but scientists are generally not his audience. Rosling is rarely invited to give keynote lectures or departmental seminars because he doesn’t push a single field forward; he has not made fundamental discoveries since his konzo days. Researchers agree that he is a good communicator — but not the kind to teach scientists. “People like Hans Rosling face the criticism of being too superficial,” explains Peter Hotez, a tropical-disease scientist at Baylor College of Medicine in Houston, Texas. “It’s the dilemma of the public intellectual,” he says, describing academics who bridge several disciplines rather than excel at one. Rosling says he never cared much about his academic reputation. He was lucky to receive steady support from the former head of the Karolinska Institute, Hans Wigzell, who encouraged him to seek outside funding so that he could pursue whatever he deemed most important. After Rosling decided that that meant teaching broadly, he walked away from research entirely. He also differs from global-health experts who have stepped outside academia to change policies. He hasn’t worked to expand access to HIV medication, for example. He has not — like Hotez — put neglected tropical diseases on the world health agenda. And konzo still exists. But Rosling has had success; it’s just that the impact becomes harder to measure the broader his goals become. Now that he has decided that the public at large must buy into ending extreme poverty and creating a sustainable world, he has dedicated the last chapter of his career to education. With the right facts, he hopes, people will make the right decisions — he just needs to face down the misconceptions. Who is better suited to the task than a man able to stave off machetes with the power of a few pictures and his words?


News Article | November 2, 2016
Site: www.sciencenews.org

After a year caring for patients at the heart of Brazil’s Zika epidemic, pediatric neurologist Vanessa van der Linden has seen some of the worst cases. She was one of the first researchers to link Zika virus to microcephaly, a now well-known birth defect marked by a small, misshapen head and, sometimes, a forehead that slopes backward. Babies with the defect can have other symptoms, too: Van der Linden has seen 24-hour crying bouts, spasms, extreme irritability and difficulty swallowing. But microcephaly is just the tip of the Zika iceberg, she said September 22 at a workshop hosted by the National Institutes of Health in North Bethesda, Md. That’s something public health officials have been warning about for months. Now, scientists have begun to describe a head-to-toe assortment of health problems linked to Zika virus infection in utero; they’re calling it congenital Zika syndrome. Still, the full scope of the problem, including the threat of more subtle neurologic disorders such as learning disabilities or developmental delays, remains murky, says Peter Hotez, a pediatrician and microbiologist at Baylor College of Medicine in Houston. “That’s the big unknown: There’s probably a spectrum of illness,” similar to autism, he says. And it could take years for scientists to sort it all out. It’s a problem that Brazil is facing now, and one that Puerto Rico has just begun grappling with. As of September 23, the U.S. territory had reported 22,358 confirmed cases of Zika infection. Of these cases, 1,871 are pregnant women. Carmen Zorrilla, an obstetrician-gynecologist at the University of Puerto Rico’s Maternal-Infant Studies Center who has examined some of these women and their babies, emphasizes the importance of following up on all babies exposed to Zika in the womb — even those without apparent birth defects. “Even if they are born normal,” she said, “it doesn’t mean they’ll be OK.” At the workshop, Zorrilla described the case of one of the first Puerto Rican babies born to a mother diagnosed with Zika. The baby didn’t have microcephaly, but she did have another unusual problem: She couldn’t open her eyes. A bad case of conjunctivitis (pinkeye) left her needing help opening her eyelids every morning — even 27 days after birth. Zorrilla can’t say for sure whether the problem was related to Zika, but “it really concerned me,” she said. “This is the first baby I’ve seen with conjunctivitis that lasted for so long.” The case may be another clue that Zika’s assaults on the body are widespread. And Zorrilla can expect to see more cases soon. Ultrasound examinations of 228 women in Puerto Rico with confirmed Zika infection have spotted brain abnormalities in 13 fetuses, including one with microcephaly. Another observation could hint at problems yet to come: Most of the Zika-exposed fetuses tended to have slightly smaller heads than average, although “still within the normal limits,” Zorrilla said. But measurements of leg bones and stomach size indicate that the rest of the body is growing normally. Implications remain unclear, but the findings — preliminary results from Alberto de la Vega, also an obstetrician-gynecologist at the University of Puerto Rico — are the latest in a litany of anomalies linked to Zika. Long-term problems aren’t unusual in babies infected with a different kind of virus that causes microcephaly. Like Zika, cytomegalovirus can infect babies in the womb. Most CMV-infected babies don’t have any obvious symptoms, but asymptomatic kids may have problems as they grow, including intellectual disabilities, hearing loss or cerebral palsy, researchers suggested in the October Brain and Development. Beyond microcephaly, scientists have recently described other symptoms linked to Zika infection. In some babies, for example, Zika seems to damage hearing. Of 70 Zika-exposed infants born with microcephaly, 10 percent had some hearing loss, researchers noted in a Sept. 2 report published by the U.S. Centers for Disease Control and Prevention. Zika can leave a mark on the eyes, too. More than a third of 29 babies with microcephaly had some sort of eye oddity, including mottled pigmenting and withered tissue, researchers reported in May in JAMA Ophthalmology. Van der Linden has also observed a link between Zika and a deformity called arthrogryposis, where a child’s joints can be stuck in contorted positions — even in babies without microcephaly. The condition might stem from problems with infected babies’ motor neurons, the nerve cells that relay messages from the brain to the muscles, van der Linden and colleagues suggested August 9 in BMJ. She has even seen babies born with normal head circumferences who later develop microcephaly or other brain defects. One mother, she says, came in five months after giving birth because she thought her baby wasn’t developing normally. Like children with congenital Zika syndrome, the baby’s head scans revealed “the same pattern of brain damage,” van der Linden says. This pattern includes a malformed cerebral cortex, the wrinkled outer layer of the brain, and calcifications, strange lumps of calcium deposited within the tissue. Scientists still don’t know exactly how Zika damages the brain, but they have some ideas. One recent report found that the virus can infiltrate and kill both neuroepithelial stem cells, which give rise to all sorts of brain cells, and radial glial cells, which can generate newborn neurons and help guide them to their proper place in the brain. Zika also hinders these cells’ ability to split into new cells, Yale University neuroscientist Marco Onorati and colleagues reported September 6 in Cell Reports. Stem cells at work in the fetal brain eventually give rise to structures responsible for thought and memory and learning, raising concerns of a cascade of problems down the road. “This is a virus that blocks the development of the fetal brain,” Hotez says. “That’s about the worst thing you can possibly imagine.” And fetuses might not be the only ones at risk, he points out. “Kids in the first years of life also have growing, developing brains,” he says. “What if they get infected with Zika?” It’s not an easy question to answer. But another disease could offer clues. Malaria, for example, can cause severe neurological problems. In children, a condition called cerebral malaria may be linked to mental health disorders such as attention-deficit/hyperactivity disorder, antisocial behavior and depression, researchers reported in March in Malaria Journal. Researchers will also need to watch out for long-term troubles in Zika-exposed babies born with no obvious symptoms, says the CDC’s Sonja Rasmussen. “We don’t want to make families too scared,” she says. “But we do recognize the possibility of later-on seizures or developmental delay.” Since most people don’t show signs of Zika infection, pinpointing the total number of pregnant women (and babies) exposed to the virus may be impossible. In the Americas, at least, the number is probably enormous. Tens of thousands of children may eventually suffer some sort of neurologic or psychiatric illness triggered by Zika, Hotez predicted in a paper published in JAMA Pediatrics in August. Van der Linden can’t say whether the babies she has seen have learning disabilities or psychiatric illnesses, or other more subtle cognitive problems — most of her patients are between 9 months and 1 year old. But she plans to follow these patients, and the babies who appeared normal at birth, for years. “We need time to better understand the disease,” she says. Hotez agrees: “It’s going to take a generation of pediatric neurologists and infectious disease experts to figure this out.” Editor’s note: This story was updated October 6, 2016, to correct the incidence of hearing loss in a study of children born with microcephaly.


Dunleavy K.,U.S. National Cancer Institute | Bollard C.M.,Baylor College of Medicine
Blood | Year: 2013

In this issue of Blood, Liapis et al investigate the characteristics of the tumor microenvironment as well as the role of viral components in AIDS-related diffuse large B-cell lymphoma (AR-DLBCL) and compare these findings with sporadic cases of DLBCL. Copyright 2011 by The American Society of Hematology; all rights reserved.


Rustgi A.K.,University of Pennsylvania | El-Serag H.B.,Baylor College of Medicine
New England Journal of Medicine | Year: 2014

Esophageal adenocarcinoma has become the predominant type of esophageal cancer in North America and Europe, and gastroesophageal reflux disease (GERD) and obesity are the main risk factors. Barrett's esophagus, the recognized precursor lesion, can be detected by means of endoscopic screening, which is followed by treatment of precancerous lesions and monitoring for the development of neoplastic progression. Esophageal squamous-cell carcinoma remains the predominant esophageal cancer in Asia, Africa, and South America and among African Americans in North America. Alcohol and tobacco use are the main risk factors, and esophageal squamous dysplasia is the precursor lesion. The 5-year survival rate for patients with esophageal cancer, although generally poor, has improved during the past decade, and long-term survival is increasingly possible for patients with early or locally advanced disease. This review discusses the epidemiologic aspects and pathogenesis of these two esophageal cancers, as well as prevention and therapy, focusing on recent advances. Copyright © 2014 Massachusetts Medical Society. All rights reserved.


Bishop N.B.,New York Medical College | Stankiewicz P.,Baylor College of Medicine | Steinhorn R.H.,Northwestern University
American Journal of Respiratory and Critical Care Medicine | Year: 2011

Alveolar capillary dysplasia with misalignment of the pulmonary veins (ACD/MPV) is a rare, fatal developmental lung disorder of neonates and infants. This review aims to address recent findings in the etiology and genetics of ACD/MPV and to raise awareness of this poorlyknowndisease, whichmayalso present as milder, unclassified forms. Successively discussed are what is known about the epidemiology, pathogenesis, pathophysiology, diagnostic indicators and approaches, genetic testing, treatment, and cases of delayed onset. The review concludes with suggestions for future directions to answer the many unknowns about this disorder.


Ducat L.,Mental Health Issues of Diabetes Foundation | Rubenstein A.,University of Pennsylvania | Philipson L.H.,University of Chicago | Anderson B.J.,Baylor College of Medicine
Diabetes Care | Year: 2015

Individuals with type 1 diabetes are at increased risk for depression, anxiety disorder, and eating disorder diagnoses. People with type 1 diabetes are also at risk for subclinical levels of diabetes distress and anxiety. These mental/behavioral health comorbidities of diabetes are associated with poor adherence to treatment and poor glycemic control, thus increasing the risk for serious shortand long-term physical complications, which can result in blindness, amputations, stroke, cognitive decline, decreased quality of life, as well as premature death. Whenmental health comorbidities of diabetes are not diagnosed and treated, the financial cost to society and health care systems is catastrophic, and the human suffering that results is profound. This review summarizes state-of-the-art presentations and working group scholarly reports from the Mental Health Issues of Diabetes Conference (7-8 October 2013, Philadelphia, PA), which included stakeholders from the National Institutes of Health, people living with type 1 diabetes and their families, diabetes consumer advocacy groups, the insurance industry, as well as psychologists, psychiatrists, endocrinologists, and nurse practitioners who are all nationally and internationally recognized experts in type 1 diabetes research and care. At this landmark conference current evidence for the incidence and the consequences ofmental health problems in type 1 diabetes was presented, supporting the integration of mental health screening and mental health care into routine diabetes medical care. Future research directions were recommended to establish the efficacy and cost-effectiveness of paradigms of diabetes care in which physical and mental health care are both priorities. © 2015 by the American Diabetes Association.


Wang L.,Baylor College of Medicine | Wang S.,Nanjing Southeast University | Li W.,Baylor College of Medicine
Bioinformatics | Year: 2012

Motivation: RNA-seq has been extensively used for transcriptome study. Quality control (QC) is critical to ensure that RNA-seq data are of high quality and suitable for subsequent analyses. However, QC is a time-consuming and complex task, due to the massive size and versatile nature of RNA-seq data. Therefore, a convenient and comprehensive QC tool to assess RNA-seq quality is sorely needed.Results: We developed the RSeQC package to comprehensively evaluate different aspects of RNA-seq experiments, such as sequence quality, GC bias, polymerase chain reaction bias, nucleotide composition bias, sequencing depth, strand specificity, coverage uniformity and read distribution over the genome structure. RSeQC takes both SAM and BAM files as input, which can be produced by most RNA-seq mapping tools as well as BED files, which are widely used for gene models. Most modules in RSeQC take advantage of R scripts for visualization, and they are notably efficient in dealing with large BAM/SAM files containing hundreds of millions of alignments. © The Author (2012). Published by Oxford University Press. All rights reserved.


Challen G.A.,Baylor College of Medicine | Challen G.A.,Monash University | Boles N.C.,Baylor College of Medicine | Chambers S.M.,Baylor College of Medicine | Goodell M.A.,Baylor College of Medicine
Cell Stem Cell | Year: 2010

The traditional view of hematopoiesis has been that all the cells of the peripheral blood are the progeny of a unitary homogeneous pool of hematopoietic stem cells (HSCs). Recent evidence suggests that the hematopoietic system is actually maintained by a consortium of HSC subtypes with distinct functional characteristics. We show here that myeloid-biased HSCs (My-HSCs) and lymphoid-biased HSCs (Ly-HSCs) can be purified according to their capacity for Hoechst dye efflux in combination with canonical HSC markers. These phenotypes are stable under natural (aging) or artificial (serial transplantation) stress and are exacerbated in the presence of competing HSCs. My- and Ly-HSCs respond differently to TGF-β1, presenting a possible mechanism for differential regulation of HSC subtype activation. This study demonstrates definitive isolation of lineage-biased HSC subtypes and contributes to the fundamental change in view that the hematopoietic system is maintained by a continuum of HSC subtypes, rather than a functionally uniform pool. PaperFlick: {An electronic component is presented}. © 2010 Elsevier Inc. All rights reserved.


Guttmacher A.E.,National Institute of Child Health and Human Development | McGuire A.L.,Baylor College of Medicine |