Barcelona Biomedical Research Park

Barcelona, Spain

Barcelona Biomedical Research Park

Barcelona, Spain

Time filter

Source Type

Lee A.-K.,Electronics and Telecommunications Research Institute | Hong S.-E.,Electronics and Telecommunications Research Institute | Kwon J.-H.,Electronics and Telecommunications Research Institute | Choi H.-D.,Electronics and Telecommunications Research Institute | Cardis E.,Barcelona Biomedical Research Park
Physics in Medicine and Biology | Year: 2017

Mobile phones differ in terms of their operating frequency, outer shape, and form and location of the antennae, all of which affect the spatial distributions of their electromagnetic field and the level of electromagnetic absorption in the human head or brain. For this paper, the specific absorption rate (SAR) was calculated for four anatomical head models at different ages using 11 numerical phone models of different shapes and antenna configurations. The 11 models represent phone types accounting for around 86% of the approximately 1400 commercial phone models released into the Korean market since 2002. Seven of the phone models selected have an internal dual-band antenna, and the remaining four possess an external antenna. Each model was intended to generate an average absorption level equivalent to that of the same type of commercial phone model operating at the maximum available output power. The 1 g peak spatial SAR and ipsilateral and contralateral brain-averaged SARs were reported for all 11 phone models. The effects of the phone type, phone position, operating frequency, and age of head models on the brain SAR were comprehensively determined. © 2017 Institute of Physics and Engineering in Medicine.


News Article | January 6, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. The investigators were not blinded to allocation during experiments and outcome assessment. Male mice (C57BL/6 (wild-type, WT), LC3–GFP, the offspring of intercrossing Atg7f/f with Pax7Cre and Pax7CreER lines) were used at different ages. GFP–LC3 mice were provided by G. Mariño. Mice with the Atg7 gene deletion in satellite cells, as an inducible or constitutive deletion , were generated by breeding Atg7fl/fl mice (previously described in ref. 46) with the Pax7Cre and Pax7CreER lines (provided by C. Keller and M. Capecchi, respectively). All animal experiments were approved by the ethics committee of the (Barcelona Biomedical Research Park (PRBB) and by the Catalan Government and used sex-, age- and weight-matched littermate animals. When needed, Cre activity was induced by intraperitoneal injection (one injection per day for 4 days) with 5 mg per 25 g body weight of tamoxifen (Sigma; 10 mg ml−1 in corn oil). Mice were anaesthetized with ketamine and xylazine (80:10 mg kg−1, intraperitoneally). Regeneration of skeletal muscle was induced by intramuscular injection of cardiotoxin (CTX, Latoxan; 10−5 M) in the tibialis anterior muscle of the mice as described47. At the indicated times after injury, mice were euthanized and muscles were dissected, frozen in isopentane cooled with liquid nitrogen, and stored at −80 °C until analysis. For GFP immunostaining of samples, muscles were prefixed for 2 h in 2% paraformaldehyde at 4 °C, and were embedded in 15% sucrose overnight at 4 °C and then frozen in isopentane cooled with liquid nitrogen. Muscles were mechanically disaggregated and incubated in Ham’s F10 media containing 0.8% collagenase D (Roche) and 0.125% trypsin and EDTA at 37 °C with agitation, for 25 min and the supernatant was then filtered. The digestion procedure was repeated four times and the supernatants were collected. Cells were incubated in lysis buffer (BD Pharm Lyse) for 10 min on ice, re-suspended in PBS with 2.5% goat serum and counted. PE-Cy7-conjugated anti-CD31 (Biolegend 102418), anti-CD11b (Biolegend 101215/16) and anti-Sca-1 (Biolegend 108113/14) antibodies were used to exclude the Lin (−) negative population and Alexa647-conjugated anti-CD34 (BD Pharmigen 560230) and PE-conjugated anti-α7-integrin (Ablab AB10STMW215) were used for double-positive staining of quiescent satellite cells. Cells were sorted using a FACS Aria II (BD). Isolated satellite cells were used either for RNA extraction or were cultured in Ham’s F10 supplemented with 30% FBS and bFGF (0.025 μg ml−1) (growth medium) for proliferation assays or plated on glass slides (Thermo Scientific 177402) for immunostaining analysis. FACS isolated satellite cells (see above) were stained with different dyes for flow cytometry analysis. Staining for mitochondria, lysosomes and ROS was performed by incubating cells at 37 °C with 1 μM tetramethylrhodamine, methyl ester TMRM (T-668), 100 nM MitoTracker Green FM (M7514), 100 nM MitoTracker Red CMXRos (M7512), 500 nM LysoTracker Green DND-26 (L7526) and 5 μM CellROX Green reagent (C10444), following the manufacturer’s protocols (Invitrogen) and directly analysed without fixing. Cell analysis was performed in FACS LSR Fortesa (Becton Dickinson). For MFI determination, we used the flow cytometry analysis software Flowlogic. MFI refers to the fluorescence intensity of each event (on average) of the selected cell population, in the chosen fluorescence channel. FACS-sorted satellite cells were collected in lysis buffer and RNA extraction was performed using RNeasy Micro kit (Qiagen). The cDNA was used for transcriptome analysis by Agilent SurePrint G3 Mouse GE 8 × 60 K high density microarray slides, performed at the microarray Unit of CRG (Barcelona, Spain). Microarray analysis was performed with 3 animals each. Data was normalized using cyclic loess, and differentially expressed genes were identified using AFM 4.0 (ref. 48) for all pairwise comparisons. Raw data was taken from the Feature Extraction output files and was corrected for background noise using the normexp method. To assure comparability across samples quantile normalization was used. Differential expression analysis was carried out on non-control probes with an empirical Bayes approach on linear models (limma). Results were corrected for multiple testing according to the false discovery rate (FDR) method. Statistical analysis was performed with the Bioconductor project ( http://www.bioconductor.org/) in the R statistical environment. Venn diagrams were generated using BioVenn49. Autophagy of aged C57BL/6 and GFP–LC3 mice was induced as follows, one group of mice was injected i.p. with 4 mg per kg body weight of rapamycin (LC Laboratories) or vehicle (DMSO) every other day for 2 weeks; a second group was injected i.p. with 30 mg per kg body weight of Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid, Sigma) or vehicle (DMSO) daily for 2 weeks; and the third group of mice was treated with 3 mM spermidine (S2626 Sigma) in drinking water for 2 weeks. Satellite cell transplants were performed as in ref. 8, following an adapted protocol50. Quiescent FACS-isolated satellite cells were collected, re-suspended in 20% FBS Ham’s F10 medium and injected into muscles of recipient mice previously injured with cardiotoxin the day before. The recipient mice were SCID mice. For each mouse, 10,000 cells were injected. At 4 days (for proliferation, senescence analyses) or 1 month (muscle regeneration) after cell injections, engrafted muscles were collected and processed for muscle histology. Results are expressed as relative number of GFP+ per muscle section, with respect to the control data for young cells, which was set at 100% . Experiments for in vitro rescue of defective autophagy in satellite cells were performed in 20% FBS containing Ham’s F10 medium (growth medium), and with the addition of either rapamycin (100 ng ml−1, LC Laboratories), Trolox (100 μM , Sigma), spermidine (5 μM, Sigma) or vehicle (DMSO) for 48 h. Mitochondrial, lysosomal, and ROS analyses or ChIP experiments were performed immediately after treatments, whereas proliferation assays (BrdU staining) and senescence analysis (SA-β-gal assay and determination of RNA and protein expression of senescence markers), were performed 96 h after treatments. For the satellite cell treatments for in vivo engraftment in injured muscles, fresh FACS-isolated satellite cells from resting muscle of young and geriatric mice were treated for 48 h with rapamycin (100 ng ml−1, LC Laboratories), Trolox (100 μM, Sigma) or vehicle (DMSO) before engraftment into pre-injured muscles of recipient mice. For each mouse, 10,000 cells were injected. At 4 days after cell injections, engrafted muscles were collected and processed for muscle histology. Bafilomycin (10 nM Sigma B1793) was used to block autophagy for 4 h at 37 °C and to analyse autophagosome accumulation by FACS, immunostaining and western blotting. CCCP (carbonyl cyanide 3-chlorophenylhydrazone, 10 μM Sigma C2759), which abolishes the link between the respiratory chain and the phosphorylation system in intact mitochondria, causes mitochondria uncoupling and was used to treat satellite cells in vitro for 1 h to induce the selective autophagy of CCCP-damaged mitochondria (mitophagy). Freshly isolated cells were transfected with mRFP–GFP–LC3 (ref. 23) plasmid using Lipofectamine 3000 (Invitrogene), and treated for 48 h with Trolox (25 μl ml−1, Sigma) or vehicle (DMSO) and analysed on glass slides (Thermo Scientific 177402). Cells were fixed with 4% paraformaldehyde in PBS for 10 min and the nuclei were stained with DAPI (Invitrogen). After washing, glass slides were mounted with Mowiol. Measuring autophagy flux through this method is based on the concept of lysosomal quenching of GFP. GFP is a stably folded protein and relatively resistant to lysosomal proteases. However, the low pH inside the lysosome quenches the fluorescent signal of GFP, which makes it difficult to trace the delivery of GFP–LC3 to lysosomes. In contrast, RFP exhibits more stable fluorescence in acidic compartments, and mRFP–LC3 can be readily detected in autolysosomes. By exploiting the difference in the nature of these two fluorescent proteins (that is, lysosomal quenching of GFP fluorescence versus lysosomal stability of RFP fluorescence), autophagic flux can be morphologically traced with an mRFP–GFP–LC3 tandem construct23. With this tandem construct, autophagosomes and autolysosomes are labelled with yellow (mRFP and GFP) and red (mRFP only) signals, respectively. Satellite cells were labelled with BrdU (1.5 μg ml−1; Sigma) for 1 h. BrdU-labelled cells were detected by immunostaining using rat anti-BrdU antibody (Oxford Biotechnology; 1:500) and a specific secondary biotinylated goat anti-rat antibody (Jackson Inmunoresearch; 1:250). Antibody binding was visualized using Vectastain Elite ABC reagent (Vector Laboratories) and DAB. BrdU-positive cells were quantified as the percentage of the total number of cells analysed. SA-β-gal activity was detected in satellite cells using the senescence β-galactosidase staining kit (Cell signaling), according to the manufacturer’s instructions. SA-β-gal+ cells were quantified as percentage of the total number of cells analysed. Freshly isolated satellite cells were ex vivo infected with distinct lentivirus for 12 h. Medium was replaced and cells were transplanted into injured muscle of recipient mice for in vivo analysis, or subjected to in vitro assays. LV-Atg7, used for Atg7 overexpression in satellite cells, was provided by Eliezer Masliah’s laboratory51. LV-sh-p16INK4a, used to silence INK4a, and LV-sh-scramble (used as control), were previously described in ref. 8. Extensor digitorum longus (EDL) muscles from geriatric wild-type mice were infected with lentivirus (LV-Atg7 or LV-GFP, as well as LV-sh-p16INK4a or LV-sh-scramble) and grafted immediately onto the tibialis anterior muscle of young wild-type recipient mice, and regeneration (formation of new myofibres derived from EDL-associated satellite cells) in the transplanted EDL muscles was analysed after 6 or 8 days. Fibre size of eMHC+ myofibre was analysed using the Fiji program. Total RNA was isolated from either FACS-isolated satellite cells of mouse muscle tissue or human myoblasts obtained from human muscle biopsies, using Tripure reagent (Roche Diagnostic Corporation) or RNeasy Micro kit (Qiagen), and analysed by RT–qPCR. For qPCR experiments, DNase digestion of 10 mg of RNA was performed using 2 U DNase (Turbo DNA-free, Ambion). Complementary DNA (cDNA) was synthesized from total RNA using the First-Strand cDNA Synthesis kit (Amersham Biosciences). Real-time PCR reactions were performed on a LightCycler 480 System using Light Cycler 480 SYBR Green I Master reaction mix (Roche Diagnostic Corporation) and specific primers. Thermocycling conditions were as follows: initial step of 10 min at 95 °C, then 50 cycles of 15 s denaturation at 94 °C, 10 s annealing at 60 °C and 15 s extension at 72 °C. Reactions were run in triplicate, and automatically detected threshold cycle values were compared between samples. Transcript of the ribosomal protein L7 housekeeping gene was used as endogenous control, with each unknown sample normalized to L7 content. The following primers were used, INK4a, forward: CATCTGGAGCAGCATGGAGTC, reverse: GGGTACGACCGAAAGAGTTCG; p21CIP1, (also known as Cdkn1a) forward: CCAGGCCAA GATGGTGTCTT, reverse: TGAGAAAGGATCAGCCATTGC; MyoD (also known as Myod1), forward: GCCGCCTGAGCAAAGTGAATG, reverse: CAGCGGTCCAGGTGCGTAGAAG; Mgn (Myog), forward, GGTGTGTAAGAGGAAGTCTGTG, reverse: TAGGCGCTCAATGTACTGGAT; Ki67 (Mki67), forward, ACCGTGGAGTAGTTTATCTGGG, reverse, TGTTTCCAGTCCGCTT-ACTTCT; p15INK4b (also known as Cdkn2b), forward, TCTTGCATCTCCACCAGCTG, reverse, CTCCAGGTTTCCCATTTAGC; Atg7, forward, TCTGGGAAGCCATAAAGTCAGG, reverse, GCGAAGGTCAGGAGCAGAA. For electron microscopy images, tibialis anterior muscles from 3- and 24-month-old wild-type mice were fixed with 2% paraformaldehyde and 2.5% glutaraldehyde in phosphate buffer (0.1 M, pH 7.4). Samples were processed by the CCit Microscopy Facility at the University of Barcelona. Images were acquired using a Jeol 1010 microscope, working at 80 kV and equipped with a CCD Megaview III camera. Identification of satellite cells in skeletal muscle by electron microscopy was based on cell size, content of heterochromatin and position with respect to basal lamina. Preparation of mouse and human satellite cell lysates and western blotting was performed as described previously in ref. 52. Antibodies used were: anti-p62/SQSTM1 antibody produced in rabbit (Sigma P0067), rabbit anti-LC3 (Novus Biologicals NB100-2331), phospho-S6 ribosomal protein (Ser240/244) XP rabbit monoclonal antibody (Cell Signaling 5364), rabbit anti-p16 (Santa Cruz Biotechnology sc-1207), rabbit anti-parkin (Abcam ab15954), S6 ribosomal protein (54D2) mouse (Cell Signaling 2317), γH2AX Ser 139 (Cell Signaling 2577S), rabbit anti-53BP1 (Abcam ab21083) and Tubulin (Sigma T-6199). Briefly, freshly isolated satellite cells were cultured with Trolox or vehicle (DMSO) for 48 h and crosslinked with 1% formaldehyde for 15 min at room temperature. For each ChIP, 300,000 cells were lysed in 130 μl of lysis buffer B (Low Cell ChIP Kit, Diagenode) and chromatin was sonicated for 10 min in a M220 Focused-ultrasonicator, Covaris (Duty cycle 5%, Peak incident power 75 W and 200 cycles per burst). Sonicated chromatin was then diluted and subjected to immunoprecipitation with 3 μl of antibody against ubquitinated histone (Ubiquityl-Histone) H2A (Lys119) (D27C4) (Cell Signaling, 8240) or 3 μl of IgG. Bound fraction and input were analysed by qPCR using specific primer sets for the INK4a locus. INK4a_RD forward, GGTCTCCCCTAGCAGGATTC, reverse GCCTGTCATTAAACAGGGTGA; INK4a_exon1 forward, CCGGAGCCACCCATTAAACTA, reverse CAAGACTTCTCAAAAATAAGACACTGAAA; INK4a_exon2 forward, CCCAACACCCACTTGAGGAA, reverse, CAGAGGTCACAGGCATCGAA. Tibialis anterior and extensor digitorum longus (EDL) muscles were frozen in isopentane cooled with liquid nitrogen, and stored at −80 °C until analysis. Then 10-μm sections were collected from muscles and were either stained with haematoxylin and eosin or immunostained. Labelling of cryosections with mouse monoclonal primary antibodies was performed using the peroxidase or fluorescein M.O.M. kit staining (Vector Laboratories) according to the manufacturer’s instructions. Double immunostaining was performed by sequential addition of each primary and secondary antibody using appropriate positive and negative controls. Sections were air dried, fixed on 2–4% paraformaldehyde, washed on PBS and incubated with primary antibodies according to manufacturer’s instructions after blocking for 1 h at room temperature with a high-protein-containing solution in PBS (Vector Laboratories). The slides were then washed with PBS and incubated with the appropriate secondary antibodies and labelling dyes. For immunofluorescence, secondary antibodies were coupled to Alexa-488, Alexa-568 or Alexa-647 fluorochromes, and nuclei were stained with DAPI (Invitrogen). After washing, tissue sections were mounted with Mowiol. Immunohistochemistry on muscle cryosections or isolated satellite cells was performed with the following antibodies: GFP (Invitrogen A6455 and Aves labs GFP-1020), anti-eMHC (F1.652), anti-Pax7 (DSHB), p16 (Santa Cruz sc-1207), γH2AX Ser139 (2577S), rabbit polyclonal anti-MyoD (Santa Cruz Biotechnology sc-760), anti-myogenin (DSHB F5D), poly-ubiquitinylated proteins, multi-ubiquitin chains, mouse monoclonal antibody (Enzo life sciences PW8805), anti-p62/SQSTM1 antibody produced in rabbit (Sigma P0067), mouse monoclonal antibody to LC3 (NanoTools 5F10), LAMP-1 (Santa Cruz Biotechnology sc-19992), phospho-S6 ribosomal protein (Ser240/244) XP rabbit monoclonal antibody (Cell Signaling 5364), anti-CD56 (BD Pharmingen 556325), anti-TOM20 (ab56783). Muscle biopsies from 8 adults and 10 geriatric (28 ± 7 and 83 ± 7 years old, respectively) human subjects were obtained via the Tissue Banks for Research from Vall d’Hebron and Sant Joan de Deu Hospitals and especially via the EU/FP7 Myoage Consortium. Muscle biopsies were taken from the vastus lateralis muscle under local anaesthesia (2% lidocaine). A portion of the muscle tissue was directly frozen in melting isopentane and stored at −80 °C until analysis. Human primary myoblasts from 5 young/adult (25 ± 4 years old) and 5 geriatric (75 ± 4 years old) subjects were obtained from the EU/FP7 Myoage Consortium or purchased from Cook Myosite and cultured following the provided instructions. Digital images were acquired using: (1) an upright microscope DMR6000B (Leica) equipped with a DFC300FX camera for immunohistochemical colour pictures and a Hamamatsu ORCA-ER camera for immunofluorescence pictures; (2) confocal images of muscle sections or isolated satellite cells were taken using either a Zeiss LSM-780 confocal system with a Plan-Apochromat 63 × /1.4 NA oil objective or a Leica SPE confocal laser scanning microscope system with HCX PL Fluotar 10 × /0.30 NA, 20 × /0.50 NA and 40 × /0.75 NA objectives. The different fluorophores (3 to 4) were excited using the 405, 488, 568 and 633 nmexcitation lines. Acquisition was performed using Zeiss LSM software Zen Black or Leica Application or LAS AF software (Leica). Images were composed and edited in Photoshop CS5 (Adobe), in which background was reduced using brightness and contrast adjustments applied to the whole image. To assess myofibre size, individual fibres were manually outlined and their cross-sectional area (CSA) was determined with the public domain image analysis software Fiji. Fluorescence intensity of selected proteins for each cell was quantified using Fiji software and the average of relative fluorescence was expressed as MFI. The number and percentage of cellular area occupied by GFP–LC3 puncta were determined on digital images with Fiji and the cell image analysis software CellProfiler53. Co-localization of RFP–LC3 and GFP–LC3 puncta was determined on the maximum projection of three z-sections using a Fiji automated macro pipeline calculating single and double-positive autophagosomes. Co-localization of p62 and ubiquitin was determined on digital images Fiji, according to ref. 54, with respect to the total cellular area. The Pearson’s coefficient (r) was used to analyse the correlation of the intensity values of green and red pixels in dual-channel images. This coefficient measures the strength of the linear relationship between the intensities in two images calculated by linear regression and ranges from 1 to ×1, with 1 standing for complete positive correlation and ×1 for a negative correlation, with zero standing for no correlation51. Video reconstructions of autophagosomes were generated in Imaris software using full confocal z-stacks (around 20) of each cell. The z-stacks were previously imported to Fiji software for background adjustments and then deconvolved using the blind-deconvolution wizard in Huygens software. For mouse experiments, no specific blinding method was used, but mice in each sample group were selected randomly. The sample size (n) of each experimental group is described in each corresponding figure legend, and all experiments were repeated at least with three biological replicates. GraphPad Prism software was used for all statistical analyses. Quantitative data displayed as histograms are expressed as means ± standard error of the mean (represented as error bars). Results from each group were averaged and used to calculate descriptive statistics. Mann–Whitney U-test (independent samples, two-sided) was used for pairwise comparisons among groups at each time point. Statistical significance was set at a P < 0.05.


Garcia-Fernandez R.A.,Complutense University of Madrid | Garcia-Palencia P.,Complutense University of Madrid | Sanchez M.A.,Complutense University of Madrid | Gil-Gomez G.,Barcelona Biomedical Research Park | And 4 more authors.
Laboratory Investigation | Year: 2011

The cell cycle inhibitors p21 Waf1/Cip1 and p27 Kip1 are frequently downregulated in many human cancers, and correlate with a worse prognosis. We show here that combined deficiency in p21 and p27 proteins in mice is linked to more aggressive spontaneous tumorigenesis, resulting in a decreased lifespan. The most common tumors developed in p21p27 double-null mice were endocrine, with a higher incidence of pituitary adenomas, pheochromocytomas and thyroid adenomas. The combined absence of p21 and p27 proteins delays the incidence of radiation-induced thymic lymphomas with a higher apoptotic rate, measured by active caspase-3 and cleaved PARP-1 immunoexpresion. These results provide experimental evidence for a cooperation of both cyclin-dependent kinase inhibitors in tumorigenesis in mice. © 2007 USCAP, Inc All rights reserved.


PubMed | Barcelona Biomedical Research Park and Complutense University of Madrid
Type: | Journal: Veterinary pathology | Year: 2016

Following the performance of a superovulation protocol, multiple nodules were observed bilaterally in the uterine horns of 31 of 276 (11.2%) C57BL/6 J female mice aged 8.5 0.6 (mean and standard error of mean) weeks. These lesions prevented embryo collection, and the uterine decidual reaction was suspected. Samples of pathological uteri (n = 20) and the normal genital tracts of donors treated with a similar superovulation protocol (control group, n = 10) were collected. Immunohistochemistry was performed to evaluate pancytokeratin, desmin, vimentin, progesterone receptor (PR), estrogen receptor (ER), Ki-67, cyclin D3 and c-Myc expression, as well as quantitative polymerase chain reaction to assess cyclin D3, Hoxa-10 and heparin-binding epidermal growth factor-like growth factor (HB-EGF) mRNA expression. The uterine decidual reaction presented a high degree of structural organization and specifically affected the antimesometrial region of the endometrium. The abnormal decidual cells were large polygonal cells that were frequently polyploid or binucleated and strongly positive for desmin. Immunohistochemistry showed higher Ki-67 proliferation index and higher expression of PR and cyclin D3 in decidual cells in the antimesometrial aspect of the endometrium, compared to nondecidualized endometrial stromal cells in the mesometrial aspect of affected uteri, and compared to endometrial stromal cells in healthy uteri. High expression of cyclin D3 and Hoxa-10 mRNA was also observed in uteri affected by the decidual reaction. These results suggest that PR overexpression in endometrial stromal cells, likely due to high progesterone levels, triggers cyclin D3 and Hoxa-10 overexpression, which may be involved in the pathological mechanisms of the mouse uterine decidual reaction.


Farres J.,Hospital del Mar Medical Research Institute | Martin-Caballero J.,Barcelona Biomedical Research Park | Martinez C.,Research Center Biomedica En Red Of Enfermedades Hepaticas gestivas | Lozano J.J.,Research Center Biomedica En Red Of Enfermedades Hepaticas gestivas | And 10 more authors.
Blood | Year: 2013

Hematopoietic stem cells self-renew for life to guarantee the continuous supply of all blood cell lineages. Here we show that Poly(ADP-ribose) polymerase-2 (Parp-2) plays an essential role in hematopoietic stem/progenitor cells (HSPC) survival under steady-state conditions and in response to stress. Increased levels of cell death were observed in HSPC from untreated Parp-2 -/- mice, but this deficit was compensated by increased rates of self-renewal, associated with impaired reconstitution of hematopoiesis upon serial bone marrow transplantation. Cell death after γ-irradiation correlated with an impaired capacity to repair DNA damage in the absence of Parp-2. Upon exposure to sublethal doses of γ-irradiation, Parp-2 -/- mice exhibited bone marrow failure that correlated with reduced long-term repopulation potential of irradiated Parp-2-/- HSPC under competitive conditions. In line with a protective role of Parp-2 against irradiation-induced apoptosis, loss of p53 or the pro-apoptotic BH3-only protein Puma restored survival of irradiated Parp-2-/- mice, whereas loss of Noxa had no such effect. Our results show that Parp-2 plays essential roles in the surveillance of genome integrity of HSPC by orchestrating DNA repair and restraining p53-induced and Puma-mediated apoptosis. The data may affect the design of drugs targeting Parp proteins and the improvement of radiotherapy-based therapeutic strategies. © 2013 by The American Society of Hematology.


Fellermann H.,Northumbria University | Fellermann H.,Barcelona Biomedical Research Park | Krasnogor N.,Northumbria University | Krasnogor N.,European Center for Living Technology
Lecture Notes in Computer Science (including subseries Lecture Notes in Artificial Intelligence and Lecture Notes in Bioinformatics) | Year: 2014

Biological systems employ compartmentalisation in order to orchestrate a multitude of biochemical processes by simultaneously enabling "data hiding" and modularisation. In this paper, we present recent research projects that embrace compartmentalisation as an organisational programmatic principle in synthetic biological and biomimetic systems. In these systems, artificial vesicles and synthetic minimal cells are envisioned as nanoscale reactors for programmable biochemical synthesis and as chassis for molecular information processing. We present P systems, brane calculi, and the recently developed chemtainer calculus as formal frameworks providing data hiding and modularisation and thus enabling the representation of highly complicated hierarchically organised compartmentalised reaction systems. We demonstrate how compartmentalisation can greatly reduce the complexity required to implement computational functionality, and how addressable compartments permit the scaling-up of programmable chemical synthesis. © 2014 Springer International Publishing.


Castranova D.,U.S. National Institutes of Health | Lawton A.,University of Queensland | Lawrence C.,Childrens Hospital Boston | Baumann D.P.,Stowers Institute for Medical Research | And 9 more authors.
Zebrafish | Year: 2011

Despite the growing popularity of the zebrafish model system, the optimal husbandry conditions for this animal are not well defined. The aim of this study was to examine the effect of stocking density on reproductive performance in zebrafish. In this study, undertaken by eight different zebrafish facilities, clutches of at least 200 wild-type zebrafish embryos from a single pairwise mating were produced at each participating institution and subsequently reared according to "in-house protocols" until they were 14 weeks old. Fish were then randomly assigned into treatment groups with balanced sex ratios and densities of 3, 6, or 12 fish/L. After a 1-month acclimation period, fish were spawned in pair crosses every 2 weeks for 3 months, for a total of six spawning dates. The number of viable and nonviable embryos produced in each clutch were counted at 1 day postfertilization. Although there was a great deal of variability in clutch size and percent spawning success among laboratories, there were no significant differences in average clutch size, spawning success, or percent viable among the treatment densities. These data suggest that using stocking densities as high as 12 fish/L does not have a negative impact on performance, when measured by reproductive performance. © Copyright 2011, Mary Ann Liebert, Inc. 2011.


Cooper J.,University of Oxford | Cervenansky F.,CREATIS LRMN | De Fabritiis G.,Barcelona Biomedical Research Park | Fenner J.,University of Sheffield | And 10 more authors.
Philosophical Transactions of the Royal Society A: Mathematical, Physical and Engineering Sciences | Year: 2010

The Virtual Physiological Human (VPH) is a major European e-Science initiative intended to support the development of patient-specific computer models and their application in personalized and predictive healthcare. The VPH Network of Excellence (VPH-NoE) project is tasked with facilitating interaction between the various VPH projects and addressing issues of common concern. A key deliverable is the 'VPH TOOLKIT'-a collection of tools, methodologies and services to support and enable VPH research, integrating and extending existing work across Europe towards greater interoperability and sustainability. Owing to the diverse nature of the field, a single monolithic 'toolkit' is incapable of addressing the needs of the VPH. Rather, the VPH TOOLKIT should be considered more as a 'toolbox' of relevant technologies, interacting around a common set of standards. The latter apply to the information used by tools, including any data and the VPH models themselves, and also to the naming and categorizing of entities and concepts involved. Furthermore, the technologies and methodologies available need to be widely disseminated, and relevant tools and services easily found by researchers. The VPH-NoE has thus created an online resource for the VPH community to meet this need. It consists of a database of tools, methods and services for VPH research, with a Web front-end. This has facilities for searching the database, for adding or updating entries, and for providing user feedback on entries. Anyone is welcome to contribute. This journal is © 2010 The Royal Society.


Gutierrez-Gallego R.,IMIM Hospital Del Mar | Gutierrez-Gallego R.,University Pompeu Fabra | Gutierrez-Gallego R.,Barcelona Biomedical Research Park | Llop E.,IMIM Hospital Del Mar | And 7 more authors.
Analytical and Bioanalytical Chemistry | Year: 2011

Doping analysis relies on the determination of prohibited substances that should not be present in the body of an athlete or that should be below a threshold value. In the case of xenobiotics their mere presence is sufficient to establish a doping offence. However, in the case of human biotics the analytical method faces the difficulty of distinguishing between endogenous and exogenous origin. For this purpose ingenious strategies have been implemented, often aided by state-of-the-art technological advancements such as mass spectrometry in all its possible forms. For larger molecules, i.e. protein hormones, the innate structural complexity, the heterogeneous nature, and the extremely low levels in biological fluids have rendered the analytical procedures heavily dependent of immunological approaches. Although approaches these confer specificity and sensitivity to the applications, most rely on the use of two, or even three, antibody incubations with the consequent increment in assay variability. Moreover, the requirement for different antibodies that separately recognise different epitopes in screening and confirmation assays further contributes to differences encountered in either measurement. The development of analytical techniques to measure interactions directly, such as atomic force microscopy, quartz crystal microbalance or surface plasmon resonance, have greatly contributed to the accurate evaluation of molecular interactions in all fields of biology, and expectations are that this will only increase. Here, an overview is provided of surface plasmon resonance, and its particular value in application to the field of doping analysis. [Figure not available: see fulltext.] © 2011 Springer-Verlag.


PubMed | Barcelona Biomedical Research Park
Type: Journal Article | Journal: Mutation research | Year: 2012

Ionizing radiation is a known human carcinogen that can induce a variety of biological effects depending on the physical nature, duration, doses and dose-rates of exposure. However, the magnitude of health risks at low doses and dose-rates (below 100mSv and/or 0.1mSvmin(-1)) remains controversial due to a lack of direct human evidence. It is anticipated that significant insights will emerge from the integration of epidemiological and biological research, made possible by molecular epidemiology studies incorporating biomarkers and bioassays. A number of these have been used to investigate exposure, effects and susceptibility to ionizing radiation, albeit often at higher doses and dose rates, with each reflecting time-limited cellular or physiological alterations. This review summarises the multidisciplinary work undertaken in the framework of the European project DoReMi (Low Dose Research towards Multidisciplinary Integration) to identify the most appropriate biomarkers for use in population studies. In addition to logistical and ethical considerations for conducting large-scale epidemiological studies, we discuss the relevance of their use for assessing the effects of low dose ionizing radiation exposure at the cellular and physiological level. We also propose a temporal classification of biomarkers that may be relevant for molecular epidemiology studies which need to take into account the time elapsed since exposure. Finally, the integration of biology with epidemiology requires careful planning and enhanced discussions between the epidemiology, biology and dosimetry communities in order to determine the most important questions to be addressed in light of pragmatic considerations including the appropriate population to be investigated (occupationally, environmentally or medically exposed), and study design. The consideration of the logistics of biological sample collection, processing and storing and the choice of biomarker or bioassay, as well as awareness of potential confounding factors, are also essential.

Loading Barcelona Biomedical Research Park collaborators
Loading Barcelona Biomedical Research Park collaborators