BAM

Weilen unter den Rinnen, Germany
Weilen unter den Rinnen, Germany
SEARCH FILTERS
Time filter
Source Type

News Article | May 10, 2017
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. The fresh-frozen tissue and blood samples analysed in the current study were obtained from Australian melanoma biospecimen banks, including the Melanoma Institute Australia (n = 160), Australasian Biospecimen Network-Oncology Cell Line Bank QIMR-Berghofer Institute of Medical Research (n = 15; all lines authenticated by DNA profiling and tested for mycoplasma contamination), Ludwig Institute for Cancer Research (n = 4) and Peter MacCallum Cancer Centre/Victorian (n = 4) biospecimen banks. All tissues and bloods form part of prospective collection of fresh-frozen samples accrued with written informed patient consent and institutional review board approval. Fresh surgical specimens were macro-dissected and tumour tissues were procured (with as little contaminating normal tissue as possible) and snap frozen in liquid nitrogen within 1 h of surgery. All samples were pathologically assessed before inclusion into the study, with samples requiring greater than 80% tumour content and less than 30% necrosis to be included. All samples were independently reviewed by melanoma pathologists (R.A.S., R.E.V.) to confirm the presence of melanoma and qualification of the above criteria. Samples requiring tumour enrichment underwent macrodissection or frozen tissue coring (Cryoxtract, Woburn, Massachusetts, USA) using a marked haematoxylin and eosin slide as a reference. The histopathology of all mucosal and acral samples was reviewed by R.A.S. to confirm the diagnosis. Acral melanomas were classified as occurring within acral skin of the palm of the hand, sole of the foot and under nail beds. The lack of hair follicles, thickened stratum corneum and clinical site was confirmed in all cases. Mucosal melanomas were defined as occurring in the mucosal membranes lining oral, respiratory, gastrointestinal and urogenital tracts. The haematoxylin and eosin slides of the primary melanomas were reviewed for all mucosal and acral samples, and any tumour that arose in the junction of the acral/mucosal and cutaneous skin was excluded. Occult/unknown primary melanomas were considered cutaneous, since their genome landscape is indistinguishable from that of melanomas arising in the skin40. Tumour DNA was extracted using DNeasy Blood and Tissue Kits (69506, Qiagen), according to the manufacturer’s instructions. Blood DNA was extracted from whole blood using Flexigene DNA Kits (51206, Qiagen). All samples were quantified using the NanoDrop (ND1000, Thermoscientific) and Qubit dsDNA HS Assay (Q32851, Life Technologies), and DNA size and quality were tested using gel electrophoresis. Samples with a concentration of less than 50 ng μl−1, or absence of a high molecular mass band in electrophoresis gels, were excluded from further analyses. WGS was performed on Illumina Hiseq 2000 instruments (Illumina, San Diego, California, USA) at three Australian sequencing facilities (Australian Genomic Research Facility, Ramaciotti Centre for Genomics, John Curtin School of Medical Research) and Macrogen (Geumcheon-gu, Seoul, South Korea). All facilities performed library construction using TruSeq DNA Sample Preparation kits (Illumina) according to the manufacturer’s instructions. The subsequent 100 base pair (bp) pair-end libraries were sequenced using Truseq SBS V3-HS kits to average depth 85× (range 43–219×) in the tumour sample and 64× (range 30–214×) in the matched normal. Sequence data were aligned to the GRCh37 assembly using multi-threaded BWA 0.6.2-mt, resulting in sorted lane level files in sequence alignment/mapping format which were compressed and converted to binary file (BAM) created by samtools 0.1.19. Sample-level merged BAMs, one each for matched germline and tumour samples, were produced by in-house tools and duplicate reads marked with Picard MarkDuplicates 1.97 (http://picard.sourceforge.net). Quality assessment and coverage estimation was performed by qProfiler and qCoverage (http://sourceforge.net/projects/adamajava). To test for the presence of sample or data swaps, all sequence data were assessed by qSignature for concordance at approximately 1.4 million polymorphic genomic positions including the genotyping array data where available. Somatic mutations and germline variants were detected using a dual calling strategy using qSNP41 and GATK42, and indels of 1–50 bp in length were called with Pindel43. All mutations were submitted to the International Cancer Genome Consortium44 Data Coordination Centre. Mutations were annotated with gene consequence using Ensembl gene annotation with SnpEff. Somatic genes that were significantly mutated were identified using two approaches: MutSigCV and OncodriveFML 1.1 (ref. 22) using a threshold of q < 0.1. Significant non-coding elements were detected using OncodriveFML 1.1 (ref. 22). Somatic copy number and ploidy were determined using the TITAN tool45. Structural variants were identified using the qSV tool and chromosomes containing highly significant non-random distributions of breakpoints were identified as previously described46. Chromosomes identified to have clustering of breakpoints were inspected against criteria for chromothripsis47 and the BFB cumulative rearrangement model48. Chromosomes with high numbers of translocations were identified with a minimum threshold of ten translocation breakpoints per chromosome following manual review. Mutational signatures were predicted in each sample using a published framework1. Essentially, the substitution mutations across the whole genome in all cases were analysed in context of the flanking nucleotides (96 possible trinucleotide combinations). Identified signatures were compared with other validated signatures and the frequency of each signature per megabase was determined. Statistical significance of recurrent non-coding mutations was estimated using a permutation test. A null distribution of recurrence was estimated by randomly shuffling all mutations within each sample and recording the number of recurrent mutations within the regions of interest. To take into account not only the varying mutation burden but also the different mutation signatures, we restricted the random shuffling such that the mutation in the middle of a trinucleotide, ABC, was only shuffled to the same trinucleotide. Promoters and UTRs likely to play a role in tumorigenesis were identified with OncodriveFML22, a framework able to detect signals of positive selection in both the coding and the non-coding regions of the genome by measuring the bias towards the accumulation of functional mutations. The functional impact of mutations in gene promoters was assessed using the CADD (Combined Annotation Dependent Depletion)49, TFBS creation and TFBS disruption scores. The CADD scores measure the deleteriousness of mutations, and are calculated by integrating multiple annotations into a single metric by contrasting variants that survived natural selection with simulated mutations. The scores for TFBS creation (motif gain) and disruption (motif break) were computed by following the steps described in ref. 50. The score value indicates the difference between position weight matrix matching scores of the germline and mutant alleles. The 5′ UTRs were analysed using the TFBS disruption scores while 3′ UTRs were analysed using the CADD scores. The statistical significance of promoters and UTRs was derived by comparing the average functional impact score of the mutations in the element with the functional impact scores obtained by permuting 100,000-fold the observed mutations, maintaining their trinucleotide context. In addition, since the rate of somatic mutations in melanoma is highly increased at active TFBS23, OncodriveFML was adapted (version 1.1) to perform a strictly local permutation in windows of 51 bp (25 nucleotides at each side of the mutation). This variation in the background model of OncodriveFML allowed us to better estimate whether the mutations observed in tumours disrupted or created TFBS more than expected by chance. The statistical significance of promoters and UTRs mutated in at least two samples was adjusted with the Benjamini–Hochberg correction for multiple testing. We also used miRanda version 3.3a to predict whether the recurrent 3′ UTR mutations alter (disrupt or create) microRNA (miRNA) binding sites. The 50-base sequence surrounding each 3′ UTR was used as input to miRanda. miRNAs that were predicted to hit either the wild-type or mutant sequence (but not both) were considered potential targets and further filtered as follows. We required a hit to perfectly align against the seed region of the miRNA (nucleotides 2–8), that the mutation lay within the seed and that the predicted binding energy was higher (lower ΔG) in the non-hit than in the hit. To estimate telomere length, we counted telomere motifs in the whole gene data using the quantitative-PCR-validated qMotif tool (https://sourceforge.net/p/adamajava/wiki/qMotif) implemented in JAVA using the Picard library (version 1.110). qMotif is driven by a single plain-text configuration file in the ‘Windows INI-file’ style and the input is a WGS BAM file that has been duplicate-marked and coordinate-sorted. Essentially, qMotif uses a two-stage matching system where the first stage is a quick-but-strict string match and the second stage is a slower but more flexible regular expression match; only reads that pass stage 1 go on to the much slower match in stage 2. For telomere quantification, a string representing three concurrent repeats of the canonical telomere motif (TTAGGGTTAGGGTTAGGG) was used as the stage 1 match, and a simple pattern match for stage 2 which captured any read with two or more concurrent occurrences of the telomeric repeat with variation allowed in the first three bases. The relative tumour telomere length was then estimated by comparing the tumour read counts with the matched normal sample. Telomere length was validated by quantitative PCR51. Direct PCR amplification and Sanger sequencing were performed using the primers hTERT_F ACGAACGTGGCCAGCGGCAG and hTERT_R CTGGCGTCCCTGCACCCTGG, which amplify a 474 bp region of the TERT promoter52. PCR was done in a 13 μl volume containing 1 μl of 20 ng μl−1 gDNA, 1.25 μl of 10× MgCl , 2.5 μl betaine, 1.25 μl deoxynucleotides (2.5 mM), 1 μl of 10 μM primers and 0.25 μl of PFU Turbo (600250, Agilent). PCR reactions were performed under the following conditions: 95 °C for 5 min, followed by four cycles of 95 °C for 30 s, annealing at 66 °C for 1 min and polymerization at 72 °C for 1 min. This was followed by 4 more cycles with a lowered annealing temperature of 64 °C for 1 min, followed by 28 cycles with annealing temperatures of 62 °C. Subsequent PCR products were sequenced on an AbiPrism 3130xl Genetic Analyzer (Applied Biosystems) and data analysed using Sequence Scanner Software 2 (Applied Biosystems) with reference to the sequences from the NCBI gene database, TERT (chr5:1295071–1295521). Illumina TruSeq Custom Amplicon V1.5 was used to validate 20 recurrent non-coding point mutations in the promoter (n = 11), 3′ UTR (n = 3) and 5′ UTR (n = 6) regions of genes with frequent non-coding mutations in 164 of the 183 samples. Illumina DesignStudio (Illumina, San Diego, California, USA) was used to design 250 bp sequences of the target regions. Sequencing libraries were prepared using the TruSeq Custom Amplicon Library Preparation Guide and the TruSeq Custom Amplicon Index Kit, and sequenced on a MiSeq Illumina sequencer V2 (Illumina). Sequences were aligned to the reference genome (GRCh37/hg19) using BWA 0.6.2-mt. A pileup approach was used to determine the base count at each position of interest. A mutation was considered verified if the mutant allele frequency was >10%. Exome capture was performed on 1 μg of DNA extracted from tumour and normal blood using an Illumina TruSeq Exome Library Prep Kit. Libraries were sequenced (paired-end sequencing) on an Illumina HiSeq2000 platform with a minimum coverage of 61× (normal) and 59× (tumour). Exome sequence data were produced for 53 patients in the cohort and used to validate coding mutations detected by WGS. Total RNA was extracted from fresh-frozen tissue using a mirVana miRNA Isolation Kit (Applied Biosystems, AM1560). RNA quality and presence of a small RNA fraction were measured using the Agilent 2100 RNA 6000 Nano and small RNA kits. RNA sequencing was performed using 1 μg of total RNA, which was converted into messenger RNA libraries using an Illumina mRNA TruSeq kit. RNA sequencing was performed using 2 × 75 bp paired-end reads on an Illumina Hiseq2000. Small RNA sequencing was performed using 1 μg of total RNA, which was converted into a small RNA libraries, size selection range 145–160 bp (RNA of 18–33 nucleotides) using Illumina’s TruSeq Small RNA Library Preparation Kit and sequenced on an Illumina Hiseq2000 using 50 bp single-read sequencing with 1% control spiked in. RNA sequence reads were aligned to transcripts corresponding to ensemble 70 annotations using RSEM53. RSEM data were normalized using TMM (weighted trimmed mean of M-values) as implemented in the R package ‘edgeR’. For downstream analyses, normalized RSEM data were converted to counts per million. Genes with at least 5 counts per million in at least two samples were considered expressed. Total numbers of SNV/indel and structural variants were compared according to primary melanoma body site, categorized into abdomen, acral hand, acral foot, back, lower arm, lower leg, mucosal, neck, shoulder, thorax, upper arm, upper leg, and face and scalp. Any samples with an unknown primary site or occult classification were excluded from analysis. Heat maps were produced in Spotfire-Tibco (version 6.0, http://spotfire.tibco.com) on the basis of the combined total number of SNV and indels, or by structural variants. A two-colour heat map (red high, blue low) was produced and colours were overlaid onto an adapted SVG human body diagram that was created using Adobe Illustrator CS6. The frequency of clinically actionable mutations was assessed by annotating genomic variants using the IntOGen Cancer Drivers Actionability database (2014), which identifies mutations that may confer sensitivity to therapeutic agents54. The database was used to assign an activating or loss-of-function role to mutated genes. Loss of heterozygosity, silent mutations, deletions to activating genes or amplifications to loss-of-function genes were not included in the analysis. Additionally, visual inspection using the Integrative Genome Viewer (IGV, Broad) was used to identify only high-confidence structural rearrangement breakpoints with clustered supporting reads with both discordant read pair and soft clipping evidence. Structural variants with a high incidence of random non-clustered background signal surrounding the breakpoints along with low numbers of supporting non-duplicate reads were excluded from analysis for this figure (Extended Data Fig. 10). The proportion of tumours with a mutation to a particular actionable gene was calculated and classified on the basis of mutation type into (1) SNV/indel, (2) SNV/indel and structural variant, (3) structural variant or (4) copy number variation only. A hand-curated list of commonly mutated tumour suppressor genes and oncogenes was created and analysed for the frequency of mutation (Fig. 4a). Mutations were defined as SNV/indel, structural variant, copy number amplifications and copy number deletions. Loss of heterozygosity, silent mutations, RNA mutations, deletions to oncogenes or amplifications to tumour suppressor genes were not included in the figure. Structural variant breakpoints were subjected to manual inspection using the Integrative Genome Viewer (IGV, Broad) and only events confirmed as somatic and predicted to alter transcription processing were considered further. We then overlaid the alterations from Fig. 4a onto pathways defined by Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) gene sets from MSigDB version 5.0. A pathway was considered altered in a given sample if at least one gene in the pathway contained an SNV/indel or structural variant. The pathways were then stratified according to cutaneous or non-cutaneous subtypes. A mutation file with sample identities and their mutated pathways was entered for analysis into the OncoPrinter tool (http://cbioportal.org). MAPK and PI3K pathway status was also assessed by multiplex-immunofluorescent staining for phosphorylated ERK and AKT (106/183). All immunohistochemical staining was performed on a Dako Autostainer Plus (Dako, Glostrup, Denmark) using a Dako Envision Flex detection kit (K8000, Dako) and OPAL 7-colour IHC Kit for visualization (NEL797B001KT, PerkinElmer). Consecutive staining rounds included p-AKT (1:100, NCL-L-Akt-Phos, Leica), p-ERK (1:1,600, CS4370, Cell Signalling) and SOX10 (1:800, ACI 3099A, Biocare). Multispectral quantitative image analysis was performed on a Vectra 3 slide scanner (PerkinElmer, USA). The captured multispectral images were analysed using the quantitative InForm image analysis software (PerkinElmer, USA). All somatic variants for this study have been deposited in the International Cancer Genome Consortium Data Coordination Centre and are publicly available at https://dcc.icgc.org. The BAM files have been deposited in the European Genome-phenome Archive (https://www.ebi.ac.uk/ega/) with accession number EGAS00001001552. Tools used in this publication that were developed in-house are available from the SourceForge public code repository under the AdamaJava project (http://sourceforge.net/projects/adamajava/). Source data are provided or are available from the corresponding author upon reasonable request.


OAKLAND, California, BOSTON e COPENHAGEN, Danimarca--(BUSINESS WIRE)--Fabric Genomics, una società di portata globale operante nel ramo della genomica computazionale impegnata nell'offerta di strumenti per l'analisi di dati e la reportistica clinica, ha annunciato in data odierna di aver instaurato una collaborazione con la società specializzata nella gestione di dati ITTM S.A. (Information Technology for Translational Medicine) per l'offerta di capacità di hosting di dati genomici ai clienti nell'UE. L'abbinamento tra gli ineguagliati strumenti di analisi di Fabric Genomics e le soluzioni di hosting e gestione di infrastrutture sicure e comprovate di ITTM permetterà di offrire le migliori tecnologie genomiche e le migliori soluzioni per tutelare la privacy dei pazienti destinate a laboratori clinici, case farmaceutiche e progetti genomici. Gli strumenti di analisi di Fabric Genomics sono già usati da clienti nell'UE, come il progetto 100.000 genomi (100,000 Genomes Project) di Genomics England, un rivoluzionario programma nazionale di sequenziamento di genomi incentrato sulle malattie rare e oncologiche. La nostra piattaforma Opal Clinical ha generato più di 500 relazioni cliniche per il progetto 100.000 genomi, con l'obiettivo di migliorare le terapie attraverso la medicina genomica. Fabric Genomics si sta espandendo nell'UE forte della sua reputazione quale prestigioso fornitore su cui fanno affidamento clienti del calibro di LabCorp, uno dei maggiori laboratori di riferimento negli Stati Uniti, l'Istituto per la medicina genomica Rady Children, uno dei più importanti centri di genomica clinica pediatrica guidato dal Dottor Stephan Kingsmore, e il Centro medico dell'Università Vanderbilt, un centro clinico facente parte della Rete per le malattie non diagnosticate (Undiagnosed Disease Network, UDN) degli Istituti Nazionali della Sanità (National Institutes of Health) “ITTM è un partner strategico importante ai fini della diffusione dell'uso dei nostri strumenti di analisi per il sequenziamento di prossima generazione (next-generation sequencing, NGS) nell'UE. Siamo rimasti molto colpiti dall'attenzione rivolta da ITTM alla tutela della sicurezza e della privacy dei pazienti, nonché dalla sua leadership nel ramo dell'archiviazione dei dati genomici” ha dichiarato Mathias Klozenbuecher, Vicepresidente del reparto Sviluppo degli affari presso Fabric Genomics. “La nostra piattaforma Opal Clinical per l'interpretazione NGS di pannelli, esomi e genomi per il rilevamento di malattie ereditarie e oncologiche è ampiamente usata in tutto il mondo e si sta affermando sempre più come lo standard di riferimento per l'interpretazione presso laboratori clinici, istituiti di ricerca, ospedali e programmi nazionali di genomica.” “Ci siamo rivolti a Fabric Genomics come collaboratore chiave per l'NGS per il mercato dell'UE in considerazione delle sue competenze quanto ad analisi genomiche rapide e accurate” ha affermato il Professor Andreas Kremer, cofondatore e Amministratore delegato di ITTM. “Stiamo assistendo a un uso crescente delle analisi NGS in Europa, il che rende necessaria l'interpretazione dei dati genomici dei pazienti in un ambiente sicuro. Un numero sempre più folto di operatori sanitari esegue il sequenziamento dei dati dei pazienti per il rilevamento di malattie rare e oncologiche e tali dati devono essere interpretati rapidamente e correttamente. La normativa vigente in alcuni Paesi dell'UE vieta il trasferimento transfrontaliero di dati personali. Siamo quindi estremamente lieti di poter offrire dei servizi di hosting ottimale ai clienti che non sono dotati di un server proprio.” La piattaforma di Fabric Genomics è una soluzione per l’analisi di dati genomici end-to-end e scalabile che consente di eseguire analisi secondarie e terziarie e redigere relazioni cliniche. I nostri strumenti per analisi secondarie ineguagliati nel settore elaborano i dati genomici con un'elevata efficienza computazionale, tempi rapidi di generazione dei risultati, una precisione eccezionale e un'uniformità del 100%. Opal Clinical, il nostro strumento per analisi terziarie per l'interpretazione, la classificazione e l'annotazione, impiega algoritmi brevettati VAAST e Phevor per agevolare l'identificazione di mutazioni casuali in casi altamente complessi come nelle odissee diagnostiche per pazienti pediatrici e progetti di sequenziamento nazionali. Fabric Genomics™ è una società specializzata in genomica computazionale operante su scala globale impegnata nell'offerta di soluzioni end-to-end per l'analisi, la gestione e la classificazione di dati genomici, l'annotazione e la stesura di relazioni per laboratori clinici, laboratori ospedalieri, programmi di sequenziamento nazionali e imprese del settore delle scienze naturali. Le capacità analitiche di Fabric Genomics spaziano dall'analisi di dati grezzi alla fornitura rapida di informazioni approfondite e complete relative a esomi, interi genomi e pannelli ad alta resa. Il nostro software è in grado di elaborare file FASTQ, BAM o VCF, fornendo allineamento, richiamo delle varianti, classificazione delle varianti basata su linee guida, interpretazione delle varianti e generazione di relazioni cliniche per il rilevamento di malattie ereditarie e oncologiche. La nostra rivoluzionaria tecnologia Biograph permette il rilevamento accurato di varianti strutturali ed esibisce capacità di estrapolazione di dati a livello di popolazioni. Fabric Genomics, la cui sede generale è ubicata in California, è stata fondata da scienziati e pionieri dei settori bioinformatico, della genomica su larga scala e della diagnostica molecolare. Accelerando l'accesso a informazioni approfondite sulle cause delle malattie genetiche, Fabric Genomics sta spianando la strada nel settore della medicina di precisione. Seguiteci su Twitter, LinkedIn e Facebook. ITTM S.A. è un'impresa spin-off del Centro del Lussemburgo per la biomedicina dei sistemi (Luxembourg Centre for Systems Biomedicine, LCSB) dell'Università del Lussemburgo. Essa fornisce soluzioni e servizi per la gestione di nozioni e l'integrazione di dati in tutte le aree della ricerca nel ramo della biomedicina. Essa si adopera ai fini dell'offerta di dati d'alta qualità nel contesto corretto, soprattutto per quanto concerne le sperimentazioni cliniche e gli studi di medicina translazionale, in cui i dati eterogenei devono essere gestiti, collegati e integrati. ITTM S.A. offre delle soluzioni d'avanguardia per l'estrapolazione testuale e l'analisi e la visualizzazione di dati clinici e multidisciplinari. Per ulteriori informazioni su ITTM visitare www.ittm-solutions.com.


Oakland, Kalifornien und BOSTON und KOPENHAGEN, Dänemark--(BUSINESS WIRE)--Fabric Genomics, ein weltweit tätiges Unternehmen für Computergenomik, das Tools für Datenanalysen und klinische Berichte anbietet, hat heute eine Partnerschaft mit dem Datenverwaltungsunternehmen ITTM S.A. (Information Technology for Translational Medicine, Informationstechnologie für die Translationsmedizin) bekanntgegeben. Gemeinsam will man sichere Möglichkeiten zum Webhosting von Genomdaten für Kunden in der EU anbieten. Durch die Verbindung der führenden Analysetools von Fabric Genomics mit den bewährten, sicheren Lösungen von ITTM für Hosting und Infrastruktur schaffen wir erstklassige Lösungen für Genomtechnologie und Datenschutz für Patienten in klinischen Labors, bei Pharmafirmen und Genomprojekten. Die Analysetools von Fabric Genomics werden bereits von Kunden in der EU genutzt. Das 100.000 Genomes Project von Genomics England etwa ist ein bahnbrechendes Projekt für landesweite Genomsequenzierung mit Schwerpunkt auf seltenen Erkrankungen und Krebs. Unsere klinische Plattform Opal hat mehr als 500 klinische Berichte für das 100.000 Genomes Project geliefert, mit dem Ziel der Verbesserung therapeutischer Behandlungen durch die Genommedizin. Fabric Genomics expandiert in der EU; die Erfolgsbilanz des Unternehmens umfasst hier Kunden wie LabCorp, eines der größten Referenzlabore in den USA, das Rady Children’s Institute for Genomic Medicine, das unter der Leitung von Dr. Stephan Kingsmore eines der herausragendsten klinischen Genomzentren für die Pädiatrie ist, sowie das Vanderbilt University Medical Center, ein klinischer Standort für das UDN (Undiagnosed Disease Network, Netzwerk für nicht diagnostizierte Krankheiten) des National Institute of Health. „Wir haben uns aufgrund der Expertise des Unternehmens mit schnellen und präzisen Genomanalysen für Fabric Genomics als einen unserer zentralen NGS-Partner für den EU-Markt entschieden”, sagte Andreas Kremer, Ph.D., Mitgründer und General Manager von ITTM. „NGS-Tests verbreiten sich in Europa zusehends, und es gibt einen Bedarf für die Interpretation von Genomdaten der Patienten in einem sicheren Umfeld. Immer mehr Kliniker sequenzieren Patientendaten für seltene Erkrankungen und Krebs, und es besteht Bedarf für schnelle und präzise Interpretationen dieser Daten. In einigen EU-Ländern verbieten Vorschriften den Transfer persönlicher Daten über Grenzen hinweg. Wir freuen uns also sehr, dass wir die optimalen Hosting-Dienste für diejenigen Kunden liefern können, die keine eigenen Server haben.” Fabric Genomics™ ist ein weltweit tätiges Unternehmen für Computergenomik, das Komplettlösungen für Analysen, Kommentare, Kuratierung, Klassifizierung und Berichte für Genomdaten für klinische Labore, Krankenhauslabore und landesweite Sequenzierungsprogramme sowie Unternehmen im Bereich der Biowissenschaften anbietet. Die Analysemöglichkeiten von Fabric Genomics beginnen mit der Analyse von Rohdaten und umfassen die Bereitstellung schneller, umfassender Einblicke für Panels mit hohem Datendurchsatz, Exome und ganze Genome. Unsere Software kann FASTQ-, BAM- oder VCF-Dateien verarbeiten und liefert Abstimmung, Variantenbestimmung, richtliniengestützte Variantenklassifizierung, Varianteninterpretation und klinische Berichte für Erbkrankheiten und Onkologie. Unsere bahnbrechende Biograph-Technologie ermöglicht die präzise Erkennung struktureller Varianten und bietet Möglichkeiten zum Daten-Mining im Maßstab ganzer Bevölkerungen. Fabric Genomics wurde von Wissenschaftlern und Branchenpionieren aus den Bereichen Bioinformatik, Genomik im großen Maßstab und Molekulardiagnostik gegründet und hat seinen Hauptsitz in Kalifornien. Durch die Beschleunigung des Zugangs zu Einblicken im Zusammenhang mit den Ursachen genetisch bedingter Erkrankungen steht Fabric Genomics in der Präzisions-Gesundheitsversorgung an der Spitze. Folgen Sie uns auf Twitter, LinkedIn und Facebook.


OAKLAND, Californië en BOSTON en KOPENHAGEN, Denemarken--(BUSINESS WIRE)--Fabric Genomics, een wereldwijd rekenkundig genomicabedrijf dat data-analyse en klinische rapportagetools aanbiedt, heeft vandaag aangekondigd dat het gaat samenwerken met het datamanagementbedrijf ITTM S.A. (Information Technology for Translational Medicine) voor het leveren van veilige genomische data hostingmogelijkheden voor Europese klanten. Door het combineren van de toonaangevende analysetools van Fabric Genomics met de bewezen veilige hosting- en infrastructuuroplossingen van ITTM, kunnen we nu de beste genomische technologie en patiëntprivacyoplossingen in haar klasse leveren aan klinische laboratoria, farmaceutische bedrijven en genoomprojecten. De analysetools van Fabric Genomics worden nu al door Europese klanten gebruikt, zoals bij het Genomics England's 100,000 Genomes Project, een baanbrekend genomisch landspecifiek sequencingprogramma dat zich richt op zeldzame ziekten en kanker. Ons Opal Clinical platform heeft inmiddels meer dan 500 klinische rapporten afgeleverd voor het 100,000 Genome Project, met als doel het verbeteren van therapeutische behandelingen middels genomische geneesmiddelen. Fabric Genomics breidt uit in de EU met een bewezen track record van klanten, zoals LabCorp, een van de grootste referentielaboratoria in de VS, Rady Children's Institute for Genomic Medicine, een van de prominentste pediatrische klinische genomische centra dat door Dr. Stephan Kingsmore wordt geleid, en Vanderbilt University Medical Center, een klinische vestiging voor de National Institutes of Health's UDN (Undiagnosed Disease Network). "ITTM is een belangrijke strategische partner bij het uitbreiden van onze NGS-analysetools in de EU. Wij zijn onder de indruk van ITTM's toewijding aan de veiligheid en de patiëntprivacy, maar ook van hun leiderschap wat betreft de opslag van genomische gegevens," zegt Mathias Klozenbuecher, vicepresident bedrijfsontwikkeling bij Fabric Genomics. "Ons Our Opal Clinical platform voor NGS-interpretatie van panelen, exomen en genomen voor erfelijke ziekten en oncologie, wordt wereldwijd gebruikt en blijft de gouden standaard wat betreft interpretatie voor klinische laboratoria, onderzoeksinstellingen, ziekenhuizen en landgenoomprogramma's." "We hebben voor Fabric Genomics gekozen als belangrijke NGS-partner voor de Europese markt vanwege hun expertise op het gebied van snelle en accurate genomische analyse," zegt Andreas Kremer, Ph.D., mede-oprichter en algemeen manager bij ITTM. "NGS-testing groeit in Europa, en er is behoefte aan de interpretatie van genomische patiëntgegevens in een veilige omgeving. Steeds meer artsen sequencen patiëntgegevens op zeldzame ziekten en kanker, en deze data moet snel en accuraat worden geïnterpreteerd. In sommige Europese landen mogen persoonlijke gegevens volgens de wet niet de landsgrenzen over. Daarom zijn wij erg blij dat we optimale hosting kunnen aanbieding aan die klanten die geen eigen servers hebben." Fabric Genomics™ is een wereldwijd rekenkundig genomicabedrijf dat end-to-end genomische data-analyse, annotatie, curatie, classificatie en rapportageoplossingen aanbiedt aan klinische laboratoria, ziekenhuislaboratoria, landspecifieke sequencingprogramma's en bedrijven in de levenswetenschappen. De analytische mogelijkheden van Fabric Genomics beginnen met ruwe gegevensanalyse en omvatten de levering van snelle, omvangrijke inzichten voor hoge doorvoer panelen, exomen en hele genomen. Onze software is compatibel met FASTQ-, BAM- of VCF-bestanden en biedt afstemming, variant oproep, richtlijngedreven classificatie van varianten, variant interpretatie en klinische rapportage voor erfelijke ziekten en oncologie. Met onze baanbrekende Biograph-technologie wordt accurate detectie van structurele varianten mogelijk en biedt data-mining mogelijkheden op bevolkingsschaal. Fabric Genomics is opgericht door wetenschappers en pioniers in bioinformatica, large-scale genomica en moleculaire diagnostiek en heeft haar hoofdkantoor in Californië. Door toegang tot inzichten te verbeteren, gerelateerd aan de oorzaak van genetische ziekten, leidt Fabric Genomics op het gebied van nauwgezette gezondheidszorg. Volg ons op Twitter, LinkedIn en Facebook. ITTM S.A. is een spin-off onderneming van het Luxembourg Centre for Systems Biomedicine (LCSB) van de Universiteit van Luxemburg. Zij bieden data-integratie en kennismanagementoplossingen en diensten voor alle bio-medische gebieden. Het richt zich op het leveren van kwaliteitsgegevens in de juiste context, met name op het gebied van translationeel medisch onderzoek en klinische onderzoeken, waar heterogene data moeten worden samengesteld, gekoppeld en geïntegreerd. ITTM S.A. biedt toonaangevende klinische en multi-omics data-analyse, visualisatie en tekst-mining oplossingen. Ga voor meer informatie over ITTM naar www.ittm-solutions.com. Deze bekendmaking is officieel geldend in de originele brontaal. Vertalingen zijn slechts als leeshulp bedoeld en moeten worden vergeleken met de tekst in de brontaal, die als enige rechtsgeldig is.


OAKLAND, Calif. & BOSTON & COPENHAGEN, Denmark--(BUSINESS WIRE)--Fabric Genomics, a global computational genomics company offering data analysis and clinical reporting tools, announced today that it has partnered with data management company ITTM S.A. (Information Technology for Translational Medicine) to provide secure genomic data hosting capabilities for EU customers. By combining Fabric Genomics’ leading analysis tools with ITTM’s proven secure hosting and infrastructure solutions, we bring best-in-class genomic technology and patient privacy solutions to clinical labs, pharmaceutical companies, and genome projects. Fabric Genomics’ analysis tools are already used by EU customers, such as Genomics England’s 100,000 Genomes Project, a groundbreaking genomic country sequencing program that focuses on rare diseases and cancer. Our Opal Clinical platform has delivered more than 500 clinical reports for the 100,000 Genome Project, with a goal of improving therapeutic treatments through genomic medicine. Fabric Genomics is expanding in the EU with a proven track record of customers such as LabCorp, one of the biggest reference labs in the US, Rady Children’s Institute for Genomic Medicine, one of the most prominent pediatric clinical genomic centers led by Dr. Stephan Kingsmore, and Vanderbilt University Medical Center, a clinical site for the National Institutes of Health’s UDN (Undiagnosed Disease Network.) “ITTM is an important strategic partner to help us expand our NGS analysis tools in the EU. We are impressed by ITTM’s commitment to security and patient privacy, as well as their leadership in genomics data storage,” said Mathias Klozenbuecher, VP of Business Development for Fabric Genomics. “Our Opal Clinical platform for NGS interpretation of panels, exomes and genomes for hereditary diseases and oncology is widely used around the world and continues to become the gold standard of interpretation for clinical labs, research institutions, hospitals, and country genome programs.” “We selected Fabric Genomics as a key NGS collaborator for the EU market because of their expertise in rapid and accurate genomic analysis,” said Andreas Kremer, Ph.D., co-founder and General Manager of ITTM. “NGS testing is growing in Europe, and there is a need for the interpretation of genomic patient data in a secure environment. More and more clinicians are sequencing patient data for rare diseases and cancer, and there is a need to quickly and accurately interpret this data. In some EU countries, regulations prohibit the transfer of personal data across borders, so we are thrilled to provide optimal hosting services to those customers who do not have their own servers.” Reinhard Schneider, Head of the Bioinformatics Core Facility at the University of Luxembourg’s LCSB said, “Offering Fabric Genomics’ services through the ITTM platform brings world-class clinical NGS data interpretation services to the EU.” Fabric Genomics’ platform is a scalable end-to-end genomic data analysis solution, offering secondary analysis, tertiary analysis, and clinical reporting. Our industry-leading secondary analysis tools process genomic data with high computing efficiency, fast turnaround times, exceptional accuracy, and 100% consistency. Opal Clinical, our tertiary analysis tool for interpretation, classification, and annotation, utilizes proprietary VAAST and Phevor algorithms to help identify casual mutation(s) in high complexity cases such as pediatric diagnostic odysseys and country sequencing projects. Fabric Genomics™ is a global computational genomics company offering end-to-end genomic data analysis, annotation, curation, classification, and reporting solutions to clinical labs, hospital labs, country sequencing programs, and life science companies. Fabric Genomics’ analytic capabilities begin with raw data analysis and include the delivery of rapid, comprehensive insights for high throughput panels, exomes, and whole genomes. Our software can process FASTQ, BAM or VCF files, providing alignment, variant calling, guideline-driven variant classification, variant interpretation, and clinical reporting for hereditary diseases and oncology. Our breakthrough Biograph technology enables accurate detection of structural variants and provides population-scale data mining capabilities. Fabric Genomics was founded by scientists and industry pioneers in bioinformatics, large-scale genomics and molecular diagnostics and is headquartered in California. By accelerating access to insights related to the cause of genetic diseases, Fabric Genomics is leading the way in precision healthcare. Follow us on Twitter, LinkedIn and Facebook. ITTM S.A. is a spin-off company of the Luxembourg Centre for Systems Biomedicine (LCSB) of the University of Luxembourg. They provide data integration and knowledge management solutions and services to all bio-medical research areas. It focuses on providing quality data in the right context especially on translational medicine studies and clinical trials, in which heterogeneous data need to be curated, linked and integrated. ITTM S.A. offers cutting-edge clinical and multi-omics data analysis, visualization and text-mining solutions. For more information about ITTM, please visit www.ittm-solutions.com.


News Article | June 15, 2017
Site: www.prweb.com

(E3) Electronic Entertainment Expo Exhibitor, Mi-Chael Winter Reddick, also known as 'Kaley', to her family and close friends, is a quirky and ambitious 17 year old full-time college sophomore and co-CEO of Esports Amateur Competitors' League (the EACL). Mi-Chael has already accomplished what many of us could only dream of in graduating from high school at the tender age of 15 years old, when she then started her first year as a full-time college student. She is now entering her junior year of college as an honor student with an outstanding 4.0 G.P.A. and is majoring in Applied Mathematics with future endeavors in the realm of Quantitative Finance. This dynamic 17 year old makes her company's world debut on one of the grandest stages...E3 in the beautiful downtown Los Angeles on June 13, 2017 thru June 15, 2017. Mi-Chael is one of only 250 exhibitors at this years E3 event. Be on the lookout for this brilliant young phenom as she has quite an exciting future ahead of her! June 14, 2017 –Orange County, CA- Esports Amateur Competitors’ League (EACL), an upstart online video gaming platform, announces a 1 million dollar guaranteed cash prize for amateur gamers to compete on its platform. The cash prize will give gamers the opportunity to monetize their love of gaming while helping thousands of non-profits to raise funds. The newly announced 1 million dollar cash prize secured through EACL’s strategic partnership with BAM will help 10,000 non-profits on the gaming platform to raise much needed revenue for causes and allow gamers to compete for cash prizes. The gaming platform has the capacity to support the fundraising efforts of up to 50,000 non-profits. All non-profits joining the platform are provided resources to market and manage their online tournaments at no-cost. The strategic partnership with BAM also includes the purchase of 2000 EACL Dealerships for social entrepreneurs who are looking to start a profitable business in esports. “Our goal is to utilize our unique gaming platform to help non-profits all over the world,” -Mi-chael Reddick, Co-CEO of EACL. The platform is a disruptor in the online esports world for social entrepreneurs and non-profits who seek to affect change in various fields including health, environment, education, sustainability, reach and impact in communities on a global scale. The aim is to create the world’s largest community of online gamers who can impact social change and assist non-profits in the process to raise funds through their passion of playing online games. In connecting both the gamers and non-profits, a difference can be made in the world by utilizing EACL’s unique amateur tournament gaming platform. EACL is currently participating at the Electronic Entertainment Expo (E3) which will run through June 15th at the Los Angeles Convention Center and EACL will announce its guaranteed 1 million dollar cash prize to gamers while at the event. An eSports fundraising platform, EACL hosts amateur tournaments for online gamers while helping non-profits use its platform to raise funds for various causes. To learn more about us register at http://www.theeacl.com. Founded by Don Goode, BAM provides financial wellness solutions for consumers and entrepreneurs by giving people access to a turn-key business in eSports. Learn more about BAM by visiting http://www.bam.cash.


Recently, Halpin joined a group of female executives and financial professionals to discuss the issue at Financial Advisor Magazine's 2017 Invest in Women conference and the National Association of Personal Financial Advisors (NAPFA)'s spring conference. Representing some of the industry's most established firms, including Dimensional Fund Advisors and THE BAM ALLIANCE, panelists shared perspectives and potential solutions for attracting and retaining women advisors. "Women are a growth opportunity — bridging the gap and bringing them into the fold is smart business," notes Halpin. "And they are growing into an economic powerhouse, which provides an opportunity for firms to expand this market segment." And she would know — nearly 50 percent of Hewins' advisors are women, many of whom hold positions on its leadership team. Acknowledging both the industry's gender disparity, as well as the largely underserved market of female investors, Hewins has purposely created a culture that provides women advisors with opportunities to grow professionally. The firm has also extended inclusivity to its female client base through its Invest in Yourself campaign. The program helps clients foster financial independence by offering education tailored specifically to the challenges women face. "As a firm, we strive to empower all of our clients to lead their best financial lives," says Halpin. "We're excited to continue collaborating with our industry peers to continue this vital conversation." Hewins Financial | Wipfli Hewins is a national, CPA-based financial advisor that provides integrated financial planning and investment management services to individuals, families, small businesses and retirement plans. Learn More To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/hewins-financial--wipfli-hewins-gretchen-halpin-joins-leading-advisory-firms-to-discuss-strategies-for-bridging-the-industrys-gender-gap-300461760.html


OAKLAND, Californie et BOSTON et COPENHAGUE, Danemark--(BUSINESS WIRE)--Fabric Genomics, une société internationale de génomique informatisé offrant des outils d'analyse de données et de rapports cliniques, a annoncé aujourd'hui un partenariat avec la société de gestion de données ITTM S.A. (Information Technology for Translational Medicine) en vue d’offrir aux clients de l’UE des capacités d'hébergement de données génomiques sécurisées. En combinant les meilleurs outils d'analyse de Fabric Genomics avec les solutions d'hébergement et d'infrastructure éprouvées et sécurisées d'ITTM, nous proposons des solutions de premier ordre de technologie génomique et de confidentialité des patients aux laboratoires cliniques, aux sociétés pharmaceutiques et aux projets génomiques. Les outils d'analyse de Fabric Genomics sont déjà utilisés par les clients de l'UE, tels que le projet 100 000 génomes de Genomics England, un programme national révolutionnaire de séquençage génomique qui met l'accent sur les maladies rares et le cancer. Notre plateforme Opal Clinical a élaboré, pour le projet 100 000 génomes, plus de 500 rapports cliniques afin d'améliorer les traitements thérapeutiques grâce à la médecine génomique. Fabric Genomics se développe dans l'UE comme le prouve l’évidente expansion de sa clientèle dont font partie LabCorp, l’un des plus importants laboratoires de référence aux États-Unis ; l’Institut de médecine génomique Rady Children, l'un des plus importants centres cliniques de génomique pédiatrique que dirige le Dr Stephan Kingsmore ; et le Vanderbilt University Medical Center, qui sert de site clinique au réseau des maladies non diagnostiquées (Undiagnosed Disease Network, UDN) des Instituts nationaux de santé. « ITTM est un important partenaire stratégique qui va nous aider à développer dans l'UE nos outils d'analyse de nouvelle génération (NGS). Nous apprécions énormément l’engagement d'ITTM en matière de sécurité et de confidentialité des patients, ainsi que leur leadership dans le stockage des données génomiques », a déclaré Mathias Klozenbuecher, vice-président du développement commercial chez Fabric Genomics. « Notre plateforme Opal Clinical est mondialement utilisée en oncologie et face aux maladies héréditaires pour l’interprétation NGS des panels, des exomes et des génomes. Opal continue à devenir la référence absolue en matière d’interprétation pour les laboratoires cliniques, les institutions de recherche, les hôpitaux et les programmes génomiques nationaux ». « Nous avons choisi Fabric Genomics comme un collaborateur NGS clé pour le marché de l'UE en raison de leur expertise dans l'analyse génomique rapide et précise », a ajouté Andreas Kremer, Ph.D., cofondateur et directeur général d'ITTM. « Les tests NGS sont en expansion en Europe où il devient nécessaire d'interpréter les données génomiques des patients dans un environnement sécurisé. De plus en plus de cliniciens séquencent les données des patients atteints de maladies rares et de cancers. Il y a donc un réel besoin d'interpréter ces données de manière rapide et précise. Dans certains pays de l'UE, les règlementations interdisent le transfert transfrontalier des données personnelles, et nous sommes ravis de fournir des services optimaux d'hébergement aux clients qui n'ont pas leurs propres serveurs ». La plateforme de Fabric Genomics est une solution évolutive de bout en bout d'analyse des données génomiques, offrant analyse secondaire, analyse tertiaire et rapports cliniques. Nos outils d'analyse secondaire sont à la pointe du secteur, et traitent les données génomiques avec une efficacité informatique élevée, des délais d'exécution rapides, une précision exceptionnelle et une cohérence à 100 %. Opal Clinical, notre outil d'analyse tertiaire pour l'interprétation, la classification et l'annotation, utilise les algorithmes exclusifs VAAST et Phevor pour identifier les mutations occasionnelles dans des cas aussi hautement complexes que les laborieux diagnostics pédiatriques et les projets de séquençage nationaux. Fabric Genomics™ est une société mondiale de génomique informatisée offrant des solutions de bout en bout d'analyse, d'annotation, de conservation, de classification et de reporting des données génomiques aux laboratoires cliniques et hospitaliers, ainsi qu’aux programmes de séquençage nationaux et aux sociétés des sciences de la vie. Les capacités analytiques de Fabric Genomics commencent par l'analyse des données brutes et comprennent la fourniture d’informations rapides et exhaustives favorisant le séquençage à haut débit des panels, des exomes et des génomes complets. Notre logiciel peut traiter les fichiers FASTQ, BAM ou VCF, en fournissant l'alignement, l'appel des variants, la classification des variants pilotée par les lignes directrices, l'interprétation des variants et les rapports cliniques pour les maladies héréditaires et l'oncologie. Notre technologie révolutionnaire Biograph permet de détecter avec précision les variants structurels et offre des capacités d'exploration de données à l'échelle de la population. Fabric Genomics a été créée par des scientifiques et des pionniers des secteurs de la bioinformation, de la génomique à grande échelle et du diagnostic moléculaire. La société est basée en Californie. En accélérant l'accès aux éclaircissements sur les causes des maladies génétiques, Fabric Genomics ouvre la voie à des soins de santé de précision. Retrouvez-nous sur Twitter, LinkedIn et Facebook. ITTM S.A. est une entreprise créée par essaimage issue du Luxembourg Centre for Systems Biomedicine (LCSB) de l'Université de Luxembourg. La société fournit des solutions et services de gestion des connaissances et d'intégration de données à tous les domaines de la recherche biomédicale. Elle se concentre sur l’offre de données de qualité dans le bon contexte, en particulier en matière d’études de médecine translationnelle et d’essais cliniques, dans lesquels des données hétérogènes doivent être organisées, liées et intégrées. ITTM S.A. propose des solutions de pointe pour l’analyse, la visualisation et l'exploration des données cliniques et multi-omiques. Pour plus d'informations sur ITTM, veuillez consulter le site www.ittm-solutions.com.

Loading BAM collaborators
Loading BAM collaborators