BAM
Weilen unter den Rinnen, Germany
BAM
Weilen unter den Rinnen, Germany

Time filter

Source Type

News Article | May 11, 2017
Site: www.marketwired.com

BROOKFIELD, NEWS--(Marketwired - May 11, 2017) - Brookfield Asset Management Inc. (NYSE:BAM)(TSX:BAM.A)(EURONEXT AMSTERDAM:BAMA) a leading global alternative asset manager, today announced financial results for the quarter ended March 31, 2017. Bruce Flatt, CEO of Brookfield, stated, "Our scale and global reach have enabled us to deploy $17 billion of capital into attractive investments over the last twelve months, and we continue to see opportunities to put capital to work in high quality businesses across our real asset strategies. With our flagship funds moving closer to being fully invested, we are preparing for our next major round of fundraising in response to strong investor demand." During the first quarter we achieved "same-store" growth across most of our operations, and benefited from a positive contribution from recent acquisitions. This was offset in net income by fair value changes in the quarter arising from the impact of lower stock market prices on market-valued investments. The aggregate value of our $57 billion real estate portfolio was largely unchanged. The per share number is after the allocation of net income to non-controlling interests and preferred share dividends. Funds from operations ("FFO") grew 3% on a comparative basis as 2016 included catch up and transaction fees of $49 million. FFO benefited from an increase in base fees on the higher level of fee bearing capital and growth in incentive distributions. FFO includes realized disposition gains of $214 million, which were consistent quarter over quarter. Annualized fees increased to $1.2 billion, up 24% from the prior year, while target carried interest increased by 43% to $860 million. The growth results from a 14% increase over the last twelve months in fee bearing capital, which now stands at $113 billion. We benefited from strong capital inflows to our private funds, including the closing of three flagship funds in 2016 and new product offerings, as well as growth in the market capitalization and unitholder distributions of our listed issuers. The Board declared a quarterly dividend of US$0.14 per share (representing US$0.56 per annum), payable on June 30, 2017 to shareholders of record as at the close of business on May 31, 2017. The Board also declared all of the regular monthly and quarterly dividends on its preferred shares. We announced or completed acquisitions that deployed $17 billion of capital over the last twelve months, including $3 billion in the current quarter. We completed the acquisition of a U.S. manufactured housing portfolio, added to our portfolio of student housing assets in the U.K., acquired a portfolio of U.S. office properties and a preferred equity investment in a public, non-traded hospitality REIT. We also completed two investments in our new open-ended core-plus fund - an office building in downtown San Francisco and a portfolio of logistics assets. Our renewable power business announced the acquisition of a 51% controlling interest in TerraForm Power, and 100% of TerraForm Global. These businesses collectively own and operate a 3,600 megawatt global wind and solar portfolio. This transaction marks our first major investment in solar and establishes a platform for further growth in the sector. In April, our infrastructure group closed the purchase of a 90% interest in a natural gas pipeline business in Brazil for $5 billion. This is a fully contracted and highly cash generative business that will significantly expand our utilities operations in a sector and geography that we know well. In our private equity business, we recently closed the acquisition of an 85% interest in a leading road fuels provider in the U.K. and our previously announced 70% stake in Brazil's largest private water distribution, collection and treatment business. We also announced an agreement to acquire one of the largest gas station networks in Canada from a major national retailer. Our flagship funds are significantly invested, positioning us well for future fundraising. Our second flagship real estate opportunity fund, BSREP II, is now approximately 80% committed or invested. This enables us to launch a successor fund in the second quarter. Our flagship funds in infrastructure (BIF III) and private equity (BCP IV) closed in 2016 with a solid pipeline of investment opportunities and are now over 45% and 55% invested or committed, respectively. We expect to begin fundraising for our next infrastructure and private equity flagship funds in 2018. We continue to maintain high levels of liquidity in order to pursue further transactions. We finished the quarter with core liquidity of $9 billion and dry powder in our private funds of $20 billion. In addition, we continue to recycle capital as a key source of liquidity, particularly within our real estate group which has raised $3 billion over the last twelve months through property sales. We recently sold our 51% interest in 245 Park Avenue, a New York office tower, for equity proceeds of $650 million. We are broadening our product offering to provide additional options for our investors. In addition to our traditional funds, we have been deploying capital in several new entities across asset classes and geographies. We continue to raise capital and invest it for our open-ended private real estate fund. Another particular area of focus has been credit strategies: we have built dedicated private credit programs within each business group, including an infrastructure debt fund where we will provide loans against high quality core infrastructure assets, a real estate debt fund in North America, and a credit fund in our private equity operations. We have now received the necessary approvals to complete the previously announced distribution of all of the common shares of Trisura Group Ltd. ("Trisura Group") to holders of Brookfield's Class A and B Limited Voting Shares (the "Shares"). Trisura Group is an international specialty insurance provider operating in the surety, risk solutions, corporate insurance and reinsurance niche segments of the market. On June 22, 2017, shareholders of record as of June 1, 2017 will receive one Trisura Group common share for every 170 Shares of Brookfield (see below for further information about the trading of Trisura Group and Brookfield). The dividend is currently estimated to be valued at approximately US$0.11 per Brookfield Share, or approximately US$110 million in the aggregate. Trisura Group has received conditional approval to list its common shares on the Toronto Stock Exchange (the "TSX") under the symbol "TSU". Shareholders will receive a cash payment in lieu of any fractional interests in the Trisura Group common shares. Brookfield will use the volume-weighted average trading price of the Trisura Group common shares for the five trading days immediately following the spin-off to determine the value of the Trisura Group common shares for the purpose of calculating the cash payable in lieu of any fractional interests. Only holders of Brookfield Shares as of close of business on June 1, 2017 will be entitled to receive the distribution of the common shares of Trisura Group. Holders of "BAM" or "BAM.A" who sell their shares before June 1, 2017, and whose sales of such securities settle before the close of business on the New York Stock Exchange ("NYSE") or the Toronto Stock Exchange ("TSX") on such date, will not be entitled to receive the distribution of the common shares of Trisura Group. Similarly, investors who purchase shares before June 1, 2017, and whose purchases of such securities settle after the close of business in New York (if listed on the NYSE) or Toronto (if listed on the TSX) on such date, will not be entitled to receive the distribution of the common shares of Trisura Group. Brookfield expects common shares of Trisura Group to begin trading on a "when-issued" basis on the TSX on May 30, 2017. Trisura Group is expected to begin "regular-way" trading on the TSX on June 22, 2017 under the symbol "TSU". This news release and accompanying financial statements are based on International Financial Reporting Standards ("IFRS"), as issued by the International Accounting Standards Board ("IASB"), unless otherwise noted and make reference to Funds From Operations ("FFO"). We define FFO as net income attributable to shareholders prior to fair value changes, depreciation and amortization, and deferred income taxes, and include realized disposition gains that are not recorded in net income as determined under IFRS. FFO also includes the company's share of equity accounted investments' FFO on a fully diluted basis. FFO consists of the following components: We use FFO to assess our operating results and the value of Brookfield's business and believe that many shareholders and analysts also find this measure of value to them. We note that FFO, its components, and its per share equivalent are non-IFRS measures which do not have any standard meaning prescribed by IFRS and therefore may not be comparable to similar measures presented by other companies. We provide additional information on the determination of FFO and reconciliation between FFO and net income attributable to Brookfield shareholders in our quarterly Supplemental Information and filings available at www.brookfield.com. The Letter to Shareholders and the company's Supplemental Information for the three months ended March 31, 2017 contain further information on the company's strategy, operations and financial results. Shareholders are encouraged to read these documents, which are available on the company's website. The attached statements are based primarily on information that has been extracted from our interim financial statements for the three months ended March 31, 2017, which have been prepared using IFRS, as issued by the IASB. The amounts have not been audited by Brookfield's external auditor. Brookfield's Board of Directors reviewed and approved this document, including the summary unaudited consolidated financial statements prior to its release. Information on our dividends can be found on our website under Stock & Distributions/Distribution History. Investors, analysts and other interested parties can access Brookfield Asset Management's 2017 First Quarter Results as well as the Shareholders' Letter and Supplemental Information on Brookfield's website under the Reports & Filings section at www.brookfield.com. The conference call can be accessed via webcast on May 11, 2017 at 11:00 a.m. Eastern Time at www.brookfield.com or via teleconference at 1-800-319-4610 toll free in North America. For overseas calls please dial 1-604-638-5340, at approximately 10:50 a.m. Eastern Time. A recording of the teleconference can be accessed at 1-800-319-6413 or 1-604-638-9010 (Password 1254#). Brookfield Asset Management Inc. is a leading global alternative asset manager with approximately $250 billion in assets under management. The company has more than a 100-year history of owning and operating assets with a focus on real estate, renewable power, infrastructure and private equity. Brookfield offers a range of public and private investment products and services, and is co-listed on the New York, Toronto and Euronext stock exchanges under the symbol BAM, BAM.A and BAMA, respectively. For more information, please visit our website at www.brookfield.com. Please note that Brookfield's previous audited annual and unaudited quarterly reports have been filed on EDGAR and SEDAR and can also be found in the investor section of its website at www.brookfield.com. Hard copies of the annual and quarterly reports can be obtained free of charge upon request. Note: This news release contains "forward-looking information" within the meaning of Canadian provincial securities laws and "forward-looking statements" within the meaning of Section 27A of the U.S. Securities Act of 1933, as amended, Section 21E of the U.S. Securities Exchange Act of 1934, as amended, "safe harbor" provisions of the United States Private Securities Litigation Reform Act of 1995 and in any applicable Canadian securities regulations. Forward-looking statements include statements that are predictive in nature, depend upon or refer to future events or conditions, include statements regarding the operations, business, financial condition, expected financial results, performance, prospects, opportunities, priorities, targets, goals, ongoing objectives, strategies and outlook of Brookfield and its subsidiaries, as well as the outlook for North American and international economies for the current fiscal year and subsequent periods, and include words such as "expects," "anticipates," "plans," "believes," "estimates," "seeks," "intends," "targets," "projects," "forecasts" or negative versions thereof and other similar expressions, or future or conditional verbs such as "may," "will," "should," "would" and "could." Although we believe that our anticipated future results, performance or achievements expressed or implied by the forward-looking statements and information are based upon reasonable assumptions and expectations, the reader should not place undue reliance on forward-looking statements and information because they involve known and unknown risks, uncertainties and other factors, many of which are beyond our control, which may cause the actual results, performance or achievements of Brookfield to differ materially from anticipated future results, performance or achievement expressed or implied by such forward-looking statements and information. Factors that could cause actual results to differ materially from those contemplated or implied by forward-looking statements include, but are not limited to: the impact or unanticipated impact of general economic, political and market factors in the countries in which we do business; the behavior of financial markets, including fluctuations in interest and foreign exchange rates; global equity and capital markets and the availability of equity and debt financing and refinancing within these markets; strategic actions including dispositions; the ability to complete and effectively integrate acquisitions into existing operations and the ability to attain expected benefits; changes in accounting policies and methods used to report financial condition (including uncertainties associated with critical accounting assumptions and estimates); the ability to appropriately manage human capital; the effect of applying future accounting changes; business competition; operational and reputational risks; technological change; changes in government regulation and legislation within the countries in which we operate; governmental investigations; litigation; changes in tax laws; ability to collect amounts owed; catastrophic events, such as earthquakes and hurricanes; the possible impact of international conflicts and other developments including terrorist acts and cyber terrorism; and other risks and factors detailed from time to time in our documents filed with the securities regulators in Canada and the United States. We caution that the foregoing list of important factors that may affect future results is not exhaustive. When relying on our forward-looking statements, investors and others should carefully consider the foregoing factors and other uncertainties and potential events. Except as required by law, Brookfield undertakes no obligation to publicly update or revise any forward-looking statements or information, whether written or oral, that may be as a result of new information, future events or otherwise. This release does not constitute an offer of any Brookfield fund.


NEW YORK--(BUSINESS WIRE)--TodayTix, the international ticketing platform on a mission to redefine the way people see theater, today announced it has surpassed $100 million in sales and has unveiled its new visual identity. Extending on its mission to connect the next generation of culture lovers to theater, TodayTix’s refreshed brand and mobile apps make discovering and attending extraordinary performances even more accessible - and now include the ability to plan theater-going adventures up to 30 days ahead of time. Since launching in 2013, the arts-meets-technology startup has upended the $50 billion yearly global theater industry initially by launching the first and only free mobile apps for iOS and Android and subsequently launching the industry’s first mobile lotteries on Broadway and in the West End - offering steep discounts to the most anticipated shows. In this timeframe, TodayTix has also expanded rapidly to 10 regions across the U.S. and U.K. and bolstered its partnerships to over 450 leading theater institutions around the globe. “Reaching over $100 million in sales is an incredible milestone that underscores the growing demand for seamless access to theater,” said Merritt Baer, CEO and Co-Founder of TodayTix. “We’re thrilled to have helped nearly three million customers access the best shows in their cities, and look forward to further connecting with culture enthusiasts through our fresh visual identity.” “Bonded by a deep appreciation of the arts, we set out to reintroduce theater to our fellow millennials. Our new visual identity, developed by some of the minds behind our generation's beloved brands including Shake Shack, Sweetgreen, Warby Parker and Saturdays NYC, continues to push the envelope of creative expression,” said Brian Fenty, Co-Founder of TodayTix. “Whether you're interested in fashion, photography, movement or literature, culture lovers of all ages and interests now have even better access to what they love most - great shows at great prices.” This momentum comes on the heels of TodayTix launching its successful “Broadway Backstory” podcast in partnership with Theater People’s Patrick Hinds, which surpassed over 100,000 downloads in just three months. For new brand imagery, logos and mobile app screenshots, download TodayTix’s press kit here: https://www.todaytix.com/content/press/PressKit.zip TodayTix is an international ticketing platform on a mission to redefine the way people see theater. Through effortless access to the best shows, insightful guidance to the world of theater, and thoughtful service at each moment along the way, TodayTix enables people to discover the best that their city has to offer. As the first and only free mobile app for iOS and Android connecting the next generation of culture lovers to theater, TodayTix is disrupting an established industry that is ripe for innovation. Operating in the world’s most iconic theater markets, TodayTix secures the best discounted and full price tickets available for the hottest shows in New York City, London’s West End, the San Francisco Bay Area, Los Angeles, Seattle, Philadelphia, Connecticut, Boston, Washington DC and Chicago. Since launching TodayTix in New York City in December 2013 by life-long friends and Broadway producers Merritt Baer and Brian Fenty, the company has quickly amassed partnerships with more than 450 theater institutions globally. These include but are not limited to: The Public Theater, MSG Entertainment, Roundabout Theatre Company, Cirque du Soleil, Blue Man Group, Manhattan Theatre Club, The Metropolitan Opera, BAM, Nimax, Really Useful Theatres, Kenneth Branagh Theatre Company, Royal Court, Goodman Theatre, Lyric Opera, SHN, American Conservatory Theater, Geffen Playhouse, Center Theatre Group, The Wallis Annenberg Center for the Performing Arts, LA Opera, Arena Stage, Woolly Mammoth Theatre Company, Huntington Theatre Company, A.R.T., Goodspeed Musicals, Hartford Stage, Opera Philadelphia, and Wilma Theater. To learn more, please visit www.todaytix.com, tune into the TodayTix “Broadway Backstory” podcast, or download TodayTix for iOS or Android.


News Article | May 10, 2017
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. The fresh-frozen tissue and blood samples analysed in the current study were obtained from Australian melanoma biospecimen banks, including the Melanoma Institute Australia (n = 160), Australasian Biospecimen Network-Oncology Cell Line Bank QIMR-Berghofer Institute of Medical Research (n = 15; all lines authenticated by DNA profiling and tested for mycoplasma contamination), Ludwig Institute for Cancer Research (n = 4) and Peter MacCallum Cancer Centre/Victorian (n = 4) biospecimen banks. All tissues and bloods form part of prospective collection of fresh-frozen samples accrued with written informed patient consent and institutional review board approval. Fresh surgical specimens were macro-dissected and tumour tissues were procured (with as little contaminating normal tissue as possible) and snap frozen in liquid nitrogen within 1 h of surgery. All samples were pathologically assessed before inclusion into the study, with samples requiring greater than 80% tumour content and less than 30% necrosis to be included. All samples were independently reviewed by melanoma pathologists (R.A.S., R.E.V.) to confirm the presence of melanoma and qualification of the above criteria. Samples requiring tumour enrichment underwent macrodissection or frozen tissue coring (Cryoxtract, Woburn, Massachusetts, USA) using a marked haematoxylin and eosin slide as a reference. The histopathology of all mucosal and acral samples was reviewed by R.A.S. to confirm the diagnosis. Acral melanomas were classified as occurring within acral skin of the palm of the hand, sole of the foot and under nail beds. The lack of hair follicles, thickened stratum corneum and clinical site was confirmed in all cases. Mucosal melanomas were defined as occurring in the mucosal membranes lining oral, respiratory, gastrointestinal and urogenital tracts. The haematoxylin and eosin slides of the primary melanomas were reviewed for all mucosal and acral samples, and any tumour that arose in the junction of the acral/mucosal and cutaneous skin was excluded. Occult/unknown primary melanomas were considered cutaneous, since their genome landscape is indistinguishable from that of melanomas arising in the skin40. Tumour DNA was extracted using DNeasy Blood and Tissue Kits (69506, Qiagen), according to the manufacturer’s instructions. Blood DNA was extracted from whole blood using Flexigene DNA Kits (51206, Qiagen). All samples were quantified using the NanoDrop (ND1000, Thermoscientific) and Qubit dsDNA HS Assay (Q32851, Life Technologies), and DNA size and quality were tested using gel electrophoresis. Samples with a concentration of less than 50 ng μl−1, or absence of a high molecular mass band in electrophoresis gels, were excluded from further analyses. WGS was performed on Illumina Hiseq 2000 instruments (Illumina, San Diego, California, USA) at three Australian sequencing facilities (Australian Genomic Research Facility, Ramaciotti Centre for Genomics, John Curtin School of Medical Research) and Macrogen (Geumcheon-gu, Seoul, South Korea). All facilities performed library construction using TruSeq DNA Sample Preparation kits (Illumina) according to the manufacturer’s instructions. The subsequent 100 base pair (bp) pair-end libraries were sequenced using Truseq SBS V3-HS kits to average depth 85× (range 43–219×) in the tumour sample and 64× (range 30–214×) in the matched normal. Sequence data were aligned to the GRCh37 assembly using multi-threaded BWA 0.6.2-mt, resulting in sorted lane level files in sequence alignment/mapping format which were compressed and converted to binary file (BAM) created by samtools 0.1.19. Sample-level merged BAMs, one each for matched germline and tumour samples, were produced by in-house tools and duplicate reads marked with Picard MarkDuplicates 1.97 (http://picard.sourceforge.net). Quality assessment and coverage estimation was performed by qProfiler and qCoverage (http://sourceforge.net/projects/adamajava). To test for the presence of sample or data swaps, all sequence data were assessed by qSignature for concordance at approximately 1.4 million polymorphic genomic positions including the genotyping array data where available. Somatic mutations and germline variants were detected using a dual calling strategy using qSNP41 and GATK42, and indels of 1–50 bp in length were called with Pindel43. All mutations were submitted to the International Cancer Genome Consortium44 Data Coordination Centre. Mutations were annotated with gene consequence using Ensembl gene annotation with SnpEff. Somatic genes that were significantly mutated were identified using two approaches: MutSigCV and OncodriveFML 1.1 (ref. 22) using a threshold of q < 0.1. Significant non-coding elements were detected using OncodriveFML 1.1 (ref. 22). Somatic copy number and ploidy were determined using the TITAN tool45. Structural variants were identified using the qSV tool and chromosomes containing highly significant non-random distributions of breakpoints were identified as previously described46. Chromosomes identified to have clustering of breakpoints were inspected against criteria for chromothripsis47 and the BFB cumulative rearrangement model48. Chromosomes with high numbers of translocations were identified with a minimum threshold of ten translocation breakpoints per chromosome following manual review. Mutational signatures were predicted in each sample using a published framework1. Essentially, the substitution mutations across the whole genome in all cases were analysed in context of the flanking nucleotides (96 possible trinucleotide combinations). Identified signatures were compared with other validated signatures and the frequency of each signature per megabase was determined. Statistical significance of recurrent non-coding mutations was estimated using a permutation test. A null distribution of recurrence was estimated by randomly shuffling all mutations within each sample and recording the number of recurrent mutations within the regions of interest. To take into account not only the varying mutation burden but also the different mutation signatures, we restricted the random shuffling such that the mutation in the middle of a trinucleotide, ABC, was only shuffled to the same trinucleotide. Promoters and UTRs likely to play a role in tumorigenesis were identified with OncodriveFML22, a framework able to detect signals of positive selection in both the coding and the non-coding regions of the genome by measuring the bias towards the accumulation of functional mutations. The functional impact of mutations in gene promoters was assessed using the CADD (Combined Annotation Dependent Depletion)49, TFBS creation and TFBS disruption scores. The CADD scores measure the deleteriousness of mutations, and are calculated by integrating multiple annotations into a single metric by contrasting variants that survived natural selection with simulated mutations. The scores for TFBS creation (motif gain) and disruption (motif break) were computed by following the steps described in ref. 50. The score value indicates the difference between position weight matrix matching scores of the germline and mutant alleles. The 5′ UTRs were analysed using the TFBS disruption scores while 3′ UTRs were analysed using the CADD scores. The statistical significance of promoters and UTRs was derived by comparing the average functional impact score of the mutations in the element with the functional impact scores obtained by permuting 100,000-fold the observed mutations, maintaining their trinucleotide context. In addition, since the rate of somatic mutations in melanoma is highly increased at active TFBS23, OncodriveFML was adapted (version 1.1) to perform a strictly local permutation in windows of 51 bp (25 nucleotides at each side of the mutation). This variation in the background model of OncodriveFML allowed us to better estimate whether the mutations observed in tumours disrupted or created TFBS more than expected by chance. The statistical significance of promoters and UTRs mutated in at least two samples was adjusted with the Benjamini–Hochberg correction for multiple testing. We also used miRanda version 3.3a to predict whether the recurrent 3′ UTR mutations alter (disrupt or create) microRNA (miRNA) binding sites. The 50-base sequence surrounding each 3′ UTR was used as input to miRanda. miRNAs that were predicted to hit either the wild-type or mutant sequence (but not both) were considered potential targets and further filtered as follows. We required a hit to perfectly align against the seed region of the miRNA (nucleotides 2–8), that the mutation lay within the seed and that the predicted binding energy was higher (lower ΔG) in the non-hit than in the hit. To estimate telomere length, we counted telomere motifs in the whole gene data using the quantitative-PCR-validated qMotif tool (https://sourceforge.net/p/adamajava/wiki/qMotif) implemented in JAVA using the Picard library (version 1.110). qMotif is driven by a single plain-text configuration file in the ‘Windows INI-file’ style and the input is a WGS BAM file that has been duplicate-marked and coordinate-sorted. Essentially, qMotif uses a two-stage matching system where the first stage is a quick-but-strict string match and the second stage is a slower but more flexible regular expression match; only reads that pass stage 1 go on to the much slower match in stage 2. For telomere quantification, a string representing three concurrent repeats of the canonical telomere motif (TTAGGGTTAGGGTTAGGG) was used as the stage 1 match, and a simple pattern match for stage 2 which captured any read with two or more concurrent occurrences of the telomeric repeat with variation allowed in the first three bases. The relative tumour telomere length was then estimated by comparing the tumour read counts with the matched normal sample. Telomere length was validated by quantitative PCR51. Direct PCR amplification and Sanger sequencing were performed using the primers hTERT_F ACGAACGTGGCCAGCGGCAG and hTERT_R CTGGCGTCCCTGCACCCTGG, which amplify a 474 bp region of the TERT promoter52. PCR was done in a 13 μl volume containing 1 μl of 20 ng μl−1 gDNA, 1.25 μl of 10× MgCl , 2.5 μl betaine, 1.25 μl deoxynucleotides (2.5 mM), 1 μl of 10 μM primers and 0.25 μl of PFU Turbo (600250, Agilent). PCR reactions were performed under the following conditions: 95 °C for 5 min, followed by four cycles of 95 °C for 30 s, annealing at 66 °C for 1 min and polymerization at 72 °C for 1 min. This was followed by 4 more cycles with a lowered annealing temperature of 64 °C for 1 min, followed by 28 cycles with annealing temperatures of 62 °C. Subsequent PCR products were sequenced on an AbiPrism 3130xl Genetic Analyzer (Applied Biosystems) and data analysed using Sequence Scanner Software 2 (Applied Biosystems) with reference to the sequences from the NCBI gene database, TERT (chr5:1295071–1295521). Illumina TruSeq Custom Amplicon V1.5 was used to validate 20 recurrent non-coding point mutations in the promoter (n = 11), 3′ UTR (n = 3) and 5′ UTR (n = 6) regions of genes with frequent non-coding mutations in 164 of the 183 samples. Illumina DesignStudio (Illumina, San Diego, California, USA) was used to design 250 bp sequences of the target regions. Sequencing libraries were prepared using the TruSeq Custom Amplicon Library Preparation Guide and the TruSeq Custom Amplicon Index Kit, and sequenced on a MiSeq Illumina sequencer V2 (Illumina). Sequences were aligned to the reference genome (GRCh37/hg19) using BWA 0.6.2-mt. A pileup approach was used to determine the base count at each position of interest. A mutation was considered verified if the mutant allele frequency was >10%. Exome capture was performed on 1 μg of DNA extracted from tumour and normal blood using an Illumina TruSeq Exome Library Prep Kit. Libraries were sequenced (paired-end sequencing) on an Illumina HiSeq2000 platform with a minimum coverage of 61× (normal) and 59× (tumour). Exome sequence data were produced for 53 patients in the cohort and used to validate coding mutations detected by WGS. Total RNA was extracted from fresh-frozen tissue using a mirVana miRNA Isolation Kit (Applied Biosystems, AM1560). RNA quality and presence of a small RNA fraction were measured using the Agilent 2100 RNA 6000 Nano and small RNA kits. RNA sequencing was performed using 1 μg of total RNA, which was converted into messenger RNA libraries using an Illumina mRNA TruSeq kit. RNA sequencing was performed using 2 × 75 bp paired-end reads on an Illumina Hiseq2000. Small RNA sequencing was performed using 1 μg of total RNA, which was converted into a small RNA libraries, size selection range 145–160 bp (RNA of 18–33 nucleotides) using Illumina’s TruSeq Small RNA Library Preparation Kit and sequenced on an Illumina Hiseq2000 using 50 bp single-read sequencing with 1% control spiked in. RNA sequence reads were aligned to transcripts corresponding to ensemble 70 annotations using RSEM53. RSEM data were normalized using TMM (weighted trimmed mean of M-values) as implemented in the R package ‘edgeR’. For downstream analyses, normalized RSEM data were converted to counts per million. Genes with at least 5 counts per million in at least two samples were considered expressed. Total numbers of SNV/indel and structural variants were compared according to primary melanoma body site, categorized into abdomen, acral hand, acral foot, back, lower arm, lower leg, mucosal, neck, shoulder, thorax, upper arm, upper leg, and face and scalp. Any samples with an unknown primary site or occult classification were excluded from analysis. Heat maps were produced in Spotfire-Tibco (version 6.0, http://spotfire.tibco.com) on the basis of the combined total number of SNV and indels, or by structural variants. A two-colour heat map (red high, blue low) was produced and colours were overlaid onto an adapted SVG human body diagram that was created using Adobe Illustrator CS6. The frequency of clinically actionable mutations was assessed by annotating genomic variants using the IntOGen Cancer Drivers Actionability database (2014), which identifies mutations that may confer sensitivity to therapeutic agents54. The database was used to assign an activating or loss-of-function role to mutated genes. Loss of heterozygosity, silent mutations, deletions to activating genes or amplifications to loss-of-function genes were not included in the analysis. Additionally, visual inspection using the Integrative Genome Viewer (IGV, Broad) was used to identify only high-confidence structural rearrangement breakpoints with clustered supporting reads with both discordant read pair and soft clipping evidence. Structural variants with a high incidence of random non-clustered background signal surrounding the breakpoints along with low numbers of supporting non-duplicate reads were excluded from analysis for this figure (Extended Data Fig. 10). The proportion of tumours with a mutation to a particular actionable gene was calculated and classified on the basis of mutation type into (1) SNV/indel, (2) SNV/indel and structural variant, (3) structural variant or (4) copy number variation only. A hand-curated list of commonly mutated tumour suppressor genes and oncogenes was created and analysed for the frequency of mutation (Fig. 4a). Mutations were defined as SNV/indel, structural variant, copy number amplifications and copy number deletions. Loss of heterozygosity, silent mutations, RNA mutations, deletions to oncogenes or amplifications to tumour suppressor genes were not included in the figure. Structural variant breakpoints were subjected to manual inspection using the Integrative Genome Viewer (IGV, Broad) and only events confirmed as somatic and predicted to alter transcription processing were considered further. We then overlaid the alterations from Fig. 4a onto pathways defined by Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) gene sets from MSigDB version 5.0. A pathway was considered altered in a given sample if at least one gene in the pathway contained an SNV/indel or structural variant. The pathways were then stratified according to cutaneous or non-cutaneous subtypes. A mutation file with sample identities and their mutated pathways was entered for analysis into the OncoPrinter tool (http://cbioportal.org). MAPK and PI3K pathway status was also assessed by multiplex-immunofluorescent staining for phosphorylated ERK and AKT (106/183). All immunohistochemical staining was performed on a Dako Autostainer Plus (Dako, Glostrup, Denmark) using a Dako Envision Flex detection kit (K8000, Dako) and OPAL 7-colour IHC Kit for visualization (NEL797B001KT, PerkinElmer). Consecutive staining rounds included p-AKT (1:100, NCL-L-Akt-Phos, Leica), p-ERK (1:1,600, CS4370, Cell Signalling) and SOX10 (1:800, ACI 3099A, Biocare). Multispectral quantitative image analysis was performed on a Vectra 3 slide scanner (PerkinElmer, USA). The captured multispectral images were analysed using the quantitative InForm image analysis software (PerkinElmer, USA). All somatic variants for this study have been deposited in the International Cancer Genome Consortium Data Coordination Centre and are publicly available at https://dcc.icgc.org. The BAM files have been deposited in the European Genome-phenome Archive (https://www.ebi.ac.uk/ega/) with accession number EGAS00001001552. Tools used in this publication that were developed in-house are available from the SourceForge public code repository under the AdamaJava project (http://sourceforge.net/projects/adamajava/). Source data are provided or are available from the corresponding author upon reasonable request.


LONDON, UK / ACCESSWIRE / May 22, 2017 / Active Wall St. blog coverage looks at the headline from Brookfield Asset Management Inc. (NYSE: BAM) as the Company announced on May 19, 2017, that it has received approval from the Toronto Stock Exchange (TSX) for its proposed normal course issuer bid to purchase up to 82,965,721 Class A Limited Voting Shares, representing 10% of the public float of Brookfield's outstanding Class A shares. Brookfield will pay the market price at the time of acquisition for any Class A shares purchased. Register with us now for your free membership and blog access at: One of Brookfield Asset Management's competitors within the Real Estate Development space, The Howard Hughes Corp. (NYSE: HHC), announced on May 03, 2017, its operating results for Q1 ended March 31, 2017. AWS will be initiating a research report on Howard Hughes in the coming days. Today, AWS is promoting its blog coverage on BAM; touching on HHC. Get all of our free blog coverage and more by clicking on the link below: Under terms of the announcement, purchases under the bid will be made through the facilities of the TSX, the NYSE, and any alternative Canadian trading system. The period of the normal course issuer bid will extend from May 24, 2017, to May 23, 2018, or an earlier date, subject to the case when Brookfield completes its purchases. All Class A shares acquired by Brookfield under the bid will be canceled and/or purchased by a non-independent trustee pursuant to a long-term incentive plan. The number of Class A shares issued and outstanding were about 988.52 million, of which 829.66 million shares represented the public float as of May 09, 2017. In accordance with the rules of the TSX, the maximum daily purchase on the TSX under this bid will be 247,466 Class A shares, which is 25% of 989,865 shares which was the average daily trading volume of Class A shares on the TSX for the six months, ended April 30, 2017. Under its prior normal course issuer bid that started on May 24, 2016, and stands to be expired on May 23, 2017, Brookfield purchased 2.71 million Class A shares through open market purchases on the NYSE. The weighted average price that Brookfield paid per Class A share acquired under this bid was $34.72. Brookfield will enter into an automatic purchase plan on, or around June 26, 2017, in relation to the normal course issuer bid. The automatic purchase plan will allow for the purchase of Class A shares, subject to certain trading parameters. Outside of these periods, Class A shares will be repurchased in accordance with management's discretion and in compliance with the applicable law. Brookfield is renewing its normal course issuer bid as it believes that, from time to time, the market price of its Class A shares may not fully reflect the underlying value of the business, assets and its future business prospects. The Company believes that, under such circumstances, the outstanding Class A shares represent an active investment opportunity for Brookfield. Additionally, a portion of its excess cash generated on an annual basis can be invested for an attractive risk adjusted return through the issuer bid. Brookfield recently reported its Q1 FY17 results on May 11, 2017. Under the announcement, the Company reported an EPS of $0.08 for the period. The Company had a return on equity of 2.63% and a net margin of 6.76%. Prior to the announcement on May 05, 2017, Brookfield announced a monthly distribution of $0.0817 per share payable on May 25, 2017, to stockholders of record on May 18, 2017. Based on the closing price of $13.53 on May 04, 2017, the Fund's annualized distribution rate was 7.25%. The annualized distribution rate was 6% higher than the preceding month (April 2017) distribution rate of 7.31%, reported on April 07, 2017. At the close of trading session on Friday, May 19, 2017, Brookfield Asset Management's share price finished trading session at $37.50, advancing 1.96%. A total volume of 809.42 thousand shares exchanged hands. The stock has rallied 14.27% and 15.54% in the last six months and past twelve months, respectively. Furthermore, since the start of the year, shares of the Company have surged 14.03%. The stock is trading at a PE ratio of 30.07 and has a dividend yield of 1.49%. The net market capital for the Company as per its Friday's closing price was $36.84 billion. Active Wall Street (AWS) produces regular sponsored and non-sponsored reports, articles, stock market blogs, and popular investment newsletters covering equities listed on NYSE and NASDAQ and micro-cap stocks. AWS has two distinct and independent departments. One department produces non-sponsored analyst certified content generally in the form of press releases, articles and reports covering equities listed on NYSE and NASDAQ and the other produces sponsored content (in most cases not reviewed by a registered analyst), which typically consists of compensated investment newsletters, articles and reports covering listed stocks and micro-caps. Such sponsored content is outside the scope of procedures detailed below. AWS has not been compensated; directly or indirectly; for producing or publishing this document. The non-sponsored content contained herein has been prepared by a writer (the "Author") and is fact checked and reviewed by a third party research service company (the "Reviewer") represented by a credentialed financial analyst, for further information on analyst credentials, please email info@activewallst.com. Rohit Tuli, a CFA® charterholder (the "Sponsor"), provides necessary guidance in preparing the document templates. The Reviewer has reviewed and revised the content, as necessary, based on publicly available information which is believed to be reliable. Content is researched, written and reviewed on a reasonable-effort basis. The Reviewer has not performed any independent investigations or forensic audits to validate the information herein. The Reviewer has only independently reviewed the information provided by the Author according to the procedures outlined by AWS. AWS is not entitled to veto or interfere in the application of such procedures by the third-party research service company to the articles, documents or reports, as the case may be. Unless otherwise noted, any content outside of this document has no association with the Author or the Reviewer in any way. AWS, the Author, and the Reviewer are not responsible for any error which may be occasioned at the time of printing of this document or any error, mistake or shortcoming. No liability is accepted whatsoever for any direct, indirect or consequential loss arising from the use of this document. AWS, the Author, and the Reviewer expressly disclaim any fiduciary responsibility or liability for any consequences, financial or otherwise arising from any reliance placed on the information in this document. Additionally, AWS, the Author, and the Reviewer do not (1) guarantee the accuracy, timeliness, completeness or correct sequencing of the information, or (2) warrant any results from use of the information. The included information is subject to change without notice. This document is not intended as an offering, recommendation, or a solicitation of an offer to buy or sell the securities mentioned or discussed, and is to be used for informational purposes only. Please read all associated disclosures and disclaimers in full before investing. Neither AWS nor any party affiliated with us is a registered investment adviser or broker-dealer with any agency or in any jurisdiction whatsoever. To download our report(s), read our disclosures, or for more information, visit http://www.activewallst.com/disclaimer/. For any questions, inquiries, or comments reach out to us directly. If you're a company we are covering and wish to no longer feature on our coverage list contact us via email and/or phone between 09:30 EDT to 16:00 EDT from Monday to Friday at: CFA® and Chartered Financial Analyst® are registered trademarks owned by CFA Institute. LONDON, UK / ACCESSWIRE / May 22, 2017 / Active Wall St. blog coverage looks at the headline from Brookfield Asset Management Inc. (NYSE: BAM) as the Company announced on May 19, 2017, that it has received approval from the Toronto Stock Exchange (TSX) for its proposed normal course issuer bid to purchase up to 82,965,721 Class A Limited Voting Shares, representing 10% of the public float of Brookfield's outstanding Class A shares. Brookfield will pay the market price at the time of acquisition for any Class A shares purchased. Register with us now for your free membership and blog access at: One of Brookfield Asset Management's competitors within the Real Estate Development space, The Howard Hughes Corp. (NYSE: HHC), announced on May 03, 2017, its operating results for Q1 ended March 31, 2017. AWS will be initiating a research report on Howard Hughes in the coming days. Today, AWS is promoting its blog coverage on BAM; touching on HHC. Get all of our free blog coverage and more by clicking on the link below: Under terms of the announcement, purchases under the bid will be made through the facilities of the TSX, the NYSE, and any alternative Canadian trading system. The period of the normal course issuer bid will extend from May 24, 2017, to May 23, 2018, or an earlier date, subject to the case when Brookfield completes its purchases. All Class A shares acquired by Brookfield under the bid will be canceled and/or purchased by a non-independent trustee pursuant to a long-term incentive plan. The number of Class A shares issued and outstanding were about 988.52 million, of which 829.66 million shares represented the public float as of May 09, 2017. In accordance with the rules of the TSX, the maximum daily purchase on the TSX under this bid will be 247,466 Class A shares, which is 25% of 989,865 shares which was the average daily trading volume of Class A shares on the TSX for the six months, ended April 30, 2017. Under its prior normal course issuer bid that started on May 24, 2016, and stands to be expired on May 23, 2017, Brookfield purchased 2.71 million Class A shares through open market purchases on the NYSE. The weighted average price that Brookfield paid per Class A share acquired under this bid was $34.72. Brookfield will enter into an automatic purchase plan on, or around June 26, 2017, in relation to the normal course issuer bid. The automatic purchase plan will allow for the purchase of Class A shares, subject to certain trading parameters. Outside of these periods, Class A shares will be repurchased in accordance with management's discretion and in compliance with the applicable law. Brookfield is renewing its normal course issuer bid as it believes that, from time to time, the market price of its Class A shares may not fully reflect the underlying value of the business, assets and its future business prospects. The Company believes that, under such circumstances, the outstanding Class A shares represent an active investment opportunity for Brookfield. Additionally, a portion of its excess cash generated on an annual basis can be invested for an attractive risk adjusted return through the issuer bid. Brookfield recently reported its Q1 FY17 results on May 11, 2017. Under the announcement, the Company reported an EPS of $0.08 for the period. The Company had a return on equity of 2.63% and a net margin of 6.76%. Prior to the announcement on May 05, 2017, Brookfield announced a monthly distribution of $0.0817 per share payable on May 25, 2017, to stockholders of record on May 18, 2017. Based on the closing price of $13.53 on May 04, 2017, the Fund's annualized distribution rate was 7.25%. The annualized distribution rate was 6% higher than the preceding month (April 2017) distribution rate of 7.31%, reported on April 07, 2017. At the close of trading session on Friday, May 19, 2017, Brookfield Asset Management's share price finished trading session at $37.50, advancing 1.96%. A total volume of 809.42 thousand shares exchanged hands. The stock has rallied 14.27% and 15.54% in the last six months and past twelve months, respectively. Furthermore, since the start of the year, shares of the Company have surged 14.03%. The stock is trading at a PE ratio of 30.07 and has a dividend yield of 1.49%. The net market capital for the Company as per its Friday's closing price was $36.84 billion. Active Wall Street (AWS) produces regular sponsored and non-sponsored reports, articles, stock market blogs, and popular investment newsletters covering equities listed on NYSE and NASDAQ and micro-cap stocks. AWS has two distinct and independent departments. One department produces non-sponsored analyst certified content generally in the form of press releases, articles and reports covering equities listed on NYSE and NASDAQ and the other produces sponsored content (in most cases not reviewed by a registered analyst), which typically consists of compensated investment newsletters, articles and reports covering listed stocks and micro-caps. Such sponsored content is outside the scope of procedures detailed below. AWS has not been compensated; directly or indirectly; for producing or publishing this document. The non-sponsored content contained herein has been prepared by a writer (the "Author") and is fact checked and reviewed by a third party research service company (the "Reviewer") represented by a credentialed financial analyst, for further information on analyst credentials, please email info@activewallst.com. Rohit Tuli, a CFA® charterholder (the "Sponsor"), provides necessary guidance in preparing the document templates. The Reviewer has reviewed and revised the content, as necessary, based on publicly available information which is believed to be reliable. Content is researched, written and reviewed on a reasonable-effort basis. The Reviewer has not performed any independent investigations or forensic audits to validate the information herein. The Reviewer has only independently reviewed the information provided by the Author according to the procedures outlined by AWS. AWS is not entitled to veto or interfere in the application of such procedures by the third-party research service company to the articles, documents or reports, as the case may be. Unless otherwise noted, any content outside of this document has no association with the Author or the Reviewer in any way. AWS, the Author, and the Reviewer are not responsible for any error which may be occasioned at the time of printing of this document or any error, mistake or shortcoming. No liability is accepted whatsoever for any direct, indirect or consequential loss arising from the use of this document. AWS, the Author, and the Reviewer expressly disclaim any fiduciary responsibility or liability for any consequences, financial or otherwise arising from any reliance placed on the information in this document. Additionally, AWS, the Author, and the Reviewer do not (1) guarantee the accuracy, timeliness, completeness or correct sequencing of the information, or (2) warrant any results from use of the information. The included information is subject to change without notice. This document is not intended as an offering, recommendation, or a solicitation of an offer to buy or sell the securities mentioned or discussed, and is to be used for informational purposes only. Please read all associated disclosures and disclaimers in full before investing. Neither AWS nor any party affiliated with us is a registered investment adviser or broker-dealer with any agency or in any jurisdiction whatsoever. To download our report(s), read our disclosures, or for more information, visit http://www.activewallst.com/disclaimer/. For any questions, inquiries, or comments reach out to us directly. If you're a company we are covering and wish to no longer feature on our coverage list contact us via email and/or phone between 09:30 EDT to 16:00 EDT from Monday to Friday at: CFA® and Chartered Financial Analyst® are registered trademarks owned by CFA Institute.


LONDON, UK / ACCESSWIRE / May 22, 2017 / Active Wall St. blog coverage looks at the headline from Brookfield Asset Management Inc. (NYSE: BAM) as the Company announced on May 19, 2017, that it has received approval from the Toronto Stock Exchange (TSX) for its proposed normal course issuer bid to purchase up to 82,965,721 Class A Limited Voting Shares, representing 10% of the public float of Brookfield's outstanding Class A shares. Brookfield will pay the market price at the time of acquisition for any Class A shares purchased. Register with us now for your free membership and blog access at: One of Brookfield Asset Management's competitors within the Real Estate Development space, The Howard Hughes Corp. (NYSE: HHC), announced on May 03, 2017, its operating results for Q1 ended March 31, 2017. AWS will be initiating a research report on Howard Hughes in the coming days. Today, AWS is promoting its blog coverage on BAM; touching on HHC. Get all of our free blog coverage and more by clicking on the link below: Under terms of the announcement, purchases under the bid will be made through the facilities of the TSX, the NYSE, and any alternative Canadian trading system. The period of the normal course issuer bid will extend from May 24, 2017, to May 23, 2018, or an earlier date, subject to the case when Brookfield completes its purchases. All Class A shares acquired by Brookfield under the bid will be canceled and/or purchased by a non-independent trustee pursuant to a long-term incentive plan. The number of Class A shares issued and outstanding were about 988.52 million, of which 829.66 million shares represented the public float as of May 09, 2017. In accordance with the rules of the TSX, the maximum daily purchase on the TSX under this bid will be 247,466 Class A shares, which is 25% of 989,865 shares which was the average daily trading volume of Class A shares on the TSX for the six months, ended April 30, 2017. Under its prior normal course issuer bid that started on May 24, 2016, and stands to be expired on May 23, 2017, Brookfield purchased 2.71 million Class A shares through open market purchases on the NYSE. The weighted average price that Brookfield paid per Class A share acquired under this bid was $34.72. Brookfield will enter into an automatic purchase plan on, or around June 26, 2017, in relation to the normal course issuer bid. The automatic purchase plan will allow for the purchase of Class A shares, subject to certain trading parameters. Outside of these periods, Class A shares will be repurchased in accordance with management's discretion and in compliance with the applicable law. Brookfield is renewing its normal course issuer bid as it believes that, from time to time, the market price of its Class A shares may not fully reflect the underlying value of the business, assets and its future business prospects. The Company believes that, under such circumstances, the outstanding Class A shares represent an active investment opportunity for Brookfield. Additionally, a portion of its excess cash generated on an annual basis can be invested for an attractive risk adjusted return through the issuer bid. Brookfield recently reported its Q1 FY17 results on May 11, 2017. Under the announcement, the Company reported an EPS of $0.08 for the period. The Company had a return on equity of 2.63% and a net margin of 6.76%. Prior to the announcement on May 05, 2017, Brookfield announced a monthly distribution of $0.0817 per share payable on May 25, 2017, to stockholders of record on May 18, 2017. Based on the closing price of $13.53 on May 04, 2017, the Fund's annualized distribution rate was 7.25%. The annualized distribution rate was 6% higher than the preceding month (April 2017) distribution rate of 7.31%, reported on April 07, 2017. At the close of trading session on Friday, May 19, 2017, Brookfield Asset Management's share price finished trading session at $37.50, advancing 1.96%. A total volume of 809.42 thousand shares exchanged hands. The stock has rallied 14.27% and 15.54% in the last six months and past twelve months, respectively. Furthermore, since the start of the year, shares of the Company have surged 14.03%. The stock is trading at a PE ratio of 30.07 and has a dividend yield of 1.49%. The net market capital for the Company as per its Friday's closing price was $36.84 billion. Active Wall Street (AWS) produces regular sponsored and non-sponsored reports, articles, stock market blogs, and popular investment newsletters covering equities listed on NYSE and NASDAQ and micro-cap stocks. AWS has two distinct and independent departments. One department produces non-sponsored analyst certified content generally in the form of press releases, articles and reports covering equities listed on NYSE and NASDAQ and the other produces sponsored content (in most cases not reviewed by a registered analyst), which typically consists of compensated investment newsletters, articles and reports covering listed stocks and micro-caps. Such sponsored content is outside the scope of procedures detailed below. AWS has not been compensated; directly or indirectly; for producing or publishing this document. The non-sponsored content contained herein has been prepared by a writer (the "Author") and is fact checked and reviewed by a third party research service company (the "Reviewer") represented by a credentialed financial analyst, for further information on analyst credentials, please email [email protected]. Rohit Tuli, a CFA® charterholder (the "Sponsor"), provides necessary guidance in preparing the document templates. The Reviewer has reviewed and revised the content, as necessary, based on publicly available information which is believed to be reliable. Content is researched, written and reviewed on a reasonable-effort basis. The Reviewer has not performed any independent investigations or forensic audits to validate the information herein. The Reviewer has only independently reviewed the information provided by the Author according to the procedures outlined by AWS. AWS is not entitled to veto or interfere in the application of such procedures by the third-party research service company to the articles, documents or reports, as the case may be. Unless otherwise noted, any content outside of this document has no association with the Author or the Reviewer in any way. AWS, the Author, and the Reviewer are not responsible for any error which may be occasioned at the time of printing of this document or any error, mistake or shortcoming. No liability is accepted whatsoever for any direct, indirect or consequential loss arising from the use of this document. AWS, the Author, and the Reviewer expressly disclaim any fiduciary responsibility or liability for any consequences, financial or otherwise arising from any reliance placed on the information in this document. Additionally, AWS, the Author, and the Reviewer do not (1) guarantee the accuracy, timeliness, completeness or correct sequencing of the information, or (2) warrant any results from use of the information. The included information is subject to change without notice. This document is not intended as an offering, recommendation, or a solicitation of an offer to buy or sell the securities mentioned or discussed, and is to be used for informational purposes only. Please read all associated disclosures and disclaimers in full before investing. Neither AWS nor any party affiliated with us is a registered investment adviser or broker-dealer with any agency or in any jurisdiction whatsoever. To download our report(s), read our disclosures, or for more information, visit http://www.activewallst.com/disclaimer/. For any questions, inquiries, or comments reach out to us directly. If you're a company we are covering and wish to no longer feature on our coverage list contact us via email and/or phone between 09:30 EDT to 16:00 EDT from Monday to Friday at: CFA® and Chartered Financial Analyst® are registered trademarks owned by CFA Institute.


LONDON, UK / ACCESSWIRE / April 24, 2017 / Active Wall St. announces the list of stocks for today's research reports. Pre-market the Active Wall St. team provides the technical coverage impacting selected stocks trading on the Toronto Exchange and belonging under the Real Estate Services industry. Companies recently under review include Brookfield Asset Management, Brookfield Property Partners, First Capital Realty, and FirstService. Get all of our free research reports by signing up at: On Friday, April 21, 2017, the Toronto Exchange Composite Index was down 0.07%, finishing the day at 15,614.48. Active Wall St. has initiated research reports on the following equities: Brookfield Asset Management Inc. (TSX: BAM-A), Brookfield Property Partners L.P. (TSX: BPY-UN), First Capital Realty Inc. (TSX: FCR), and FirstService Corporation (TSX: FSV). Register with us now for your free membership and research reports at: Toronto, Canada-based Brookfield Asset Management Inc.'s stock fell 1.15%, to finish Friday's session at $48.89 with a total volume of 736,646 shares traded. Over the last one month and the previous three months, Brookfield Asset Management's shares have advanced 2.77% and 5.94%, respectively. Furthermore, the stock has gained 14.96% in the past one year. The Company's shares are trading above its 50-day and 200-day moving averages. Brookfield Asset Management's 50-day moving average of $48.73 is above its 200-day moving average of $46.57. Shares of the Company, which through its subsidiaries, the firm invests in the property, power, and infrastructure sectors, are trading at a PE ratio of 31.54. See our research report on BAM-A.TO at: On Friday, shares in Hamilton, Bermuda headquartered Brookfield Property Partners L.P. recorded a trading volume of 123,075 shares. The stock ended the day 0.13% higher at $31.06. Brookfield Property Partners' stock has gained 6.37% in the last one month and 8.34% in the previous three months. Furthermore, the stock has advanced 4.65% in the past one year. The Company's shares are trading above its 50-day and 200-day moving averages. The stock's 50-day moving average of $29.76 is above its 200-day moving average of $29.41. Shares of the Company, which owns, operates, and invests in commercial properties in North America, Europe, Australia, and Brazil, are trading at PE ratio of 13.84. The complimentary research report on BPY-UN.TO at: On Friday, shares in Toronto, Canada headquartered First Capital Realty Inc. ended the session 0.99% lower at $20.09 with a total volume of 269,259 shares traded. First Capital Realty's shares have advanced 1.11% in the past one month. The stock is trading below its 50-day and 200-day moving averages. Furthermore, the stock's 200-day moving average of $20.64 is greater than its 50-day moving average of $20.12. Shares of First Capital Realty, which acquires, develops, redevelops, owns, and manages urban retail-centered real estate properties, are trading at a PE ratio of 12.63. Register for free and access the latest research report on FCR.TO at: Toronto, Canada headquartered FirstService Corp.'s stock closed the day 0.27% lower at $81.97. The stock recorded a trading volume of 43,253 shares. FirstService' shares have gained 4.77% in the last one month and 25.30% in the past three months. Furthermore, the stock has surged 50.13% in the previous one year. The company's shares are trading above their 50-day and 200-day moving averages. Moreover, the stock's 50-day moving average of $78.91 is greater than its 200-day moving average of $66.49. Shares of the Company, which provides property services to residential and commercial customers in the US and Canada, are trading at a PE ratio of 89.10. Get free access to your research report on FSV.TO at: Active Wall Street (AWS) produces regular sponsored and non-sponsored reports, articles, stock market blogs, and popular investment newsletters covering equities listed on NYSE and NASDAQ and micro-cap stocks. AWS has two distinct and independent departments. One department produces non-sponsored analyst certified content generally in the form of press releases, articles and reports covering equities listed on NYSE and NASDAQ and the other produces sponsored content (in most cases not reviewed by a registered analyst), which typically consists of compensated investment newsletters, articles and reports covering listed stocks and micro-caps. Such sponsored content is outside the scope of procedures detailed below. AWS has not been compensated; directly or indirectly; for producing or publishing this document. The non-sponsored content contained herein has been prepared by a writer (the "Author") and is fact checked and reviewed by a third party research service company (the "Reviewer") represented by a credentialed financial analyst, for further information on analyst credentials, please email [email protected]. Rohit Tuli, a CFA® charterholder (the "Sponsor"), provides necessary guidance in preparing the document templates. The Reviewer has reviewed and revised the content, as necessary, based on publicly available information which is believed to be reliable. Content is researched, written and reviewed on a reasonable-effort basis. The Reviewer has not performed any independent investigations or forensic audits to validate the information herein. The Reviewer has only independently reviewed the information provided by the Author according to the procedures outlined by AWS. AWS is not entitled to veto or interfere in the application of such procedures by the third-party research service company to the articles, documents or reports, as the case may be. Unless otherwise noted, any content outside of this document has no association with the Author or the Reviewer in any way. AWS, the Author, and the Reviewer are not responsible for any error which may be occasioned at the time of printing of this document or any error, mistake or shortcoming. No liability is accepted whatsoever for any direct, indirect or consequential loss arising from the use of this document. AWS, the Author, and the Reviewer expressly disclaim any fiduciary responsibility or liability for any consequences, financial or otherwise arising from any reliance placed on the information in this document. Additionally, AWS, the Author, and the Reviewer do not (1) guarantee the accuracy, timeliness, completeness or correct sequencing of the information, or (2) warrant any results from use of the information. The included information is subject to change without notice. This document is not intended as an offering, recommendation, or a solicitation of an offer to buy or sell the securities mentioned or discussed, and is to be used for informational purposes only. Please read all associated disclosures and disclaimers in full before investing. Neither AWS nor any party affiliated with us is a registered investment adviser or broker-dealer with any agency or in any jurisdiction whatsoever. To download our report(s), read our disclosures, or for more information, visit http://www.activewallst.com/disclaimer/. For any questions, inquiries, or comments reach out to us directly. If you're a company we are covering and wish to no longer feature on our coverage list contact us via email and/or phone between 09:30 EDT to 16:00 EDT from Monday to Friday at: CFA® and Chartered Financial Analyst® are registered trademarks owned by CFA Institute. SOURCE: Active Wall Street


As part of this plan, SunEd also recently announced the proposed sale of its interest in the YieldCo's – Terraform Global (NASDQ: GLBL) and Terraform Power (NASDQ: TERP) – to Brookfield Asset Management (NYSE: BAM).  Insiders have described the BAM transaction as a "sweetheart deal" in keeping with company's conduct for the year it has been in bankruptcy – namely, shedding its assets at fire sale prices under the protection of chapter 11. A group of over 1,000 SunEd shareholders have joined together to fight the plan and have retained Nastasi Partners, StoneTurn Group and Energyzt Advisors to assist. Jordan Danelz, a leader of the SunEd shareholder group says, "No independent third party was ever appointed by the court to figure out what happened to our investments. A year has gone by since SunEdison entered bankruptcy – and we've been in the dark that entire time." "The case has reached a critical juncture. I cannot overstate the importance of shareholders coming forward and acting as a unified group in the pending court proceedings. There is no guarantee of a successful outcome, but at this point, two things are absolutely certain: we will lose everything if we don't act immediately, and we can't do it alone." Individuals who own SunEdison stock are encouraged to visit the SUNE shareholder portal www.suneq-equity.com to learn more about what actions they can take to preserve their investments in SunEdison. To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/sunedison-shareholder-group-sunedison-equity-shareholders-needed-to-help-stop-fire-sale-of-assets-and-total-loss-of-investments-300443277.html


News Article | May 1, 2017
Site: www.prweb.com

MindRocket Media Group announced today the addition of Ross Romano, formerly of ASCD, to the MindRocket team as Managing Director of Communications and Public Affairs. Romano will be a key figure in MindRocket’s work as the PR agency of record for the Future of Education Technology Conference (FETC), and his knowledge and expertise will enhance the communications support MindRocket can deliver for each of its clients. Based in Arlington, Va., Romano will further anchor MindRocket’s presence in the nation’s capitol. “I am thrilled to join the talented team at MindRocket Media Group and step into this new role at a defining moment for the company,” said Romano. “In just a few short years, MindRocket has earned industry credibility by consistently delivering quality thought leadership, and I’m confident that even greater things lie just ahead. I’m excited to collaborate with my colleagues and begin developing plans for the next stage of success.” Dr. Rod Berger, CEO of MindRocket Media Group, said of the hire: “Adding Ross to the MindRocket team is the latest exciting indicator of our explosive growth, as well as our commitment to providing unmatched expertise to each of our valued partners. Ross’s experience and connections in the education and EdTech industries will add new capabilities to the skilled and dedicated MindRocket Media Group team.” In his time with ASCD, most recently as Senior Publicist, Romano spearheaded the association’s media relations efforts and designed publicity campaigns across traditional and social media to promote the work of leading education authors, innovators, and thought leaders, as well as ASCD’s conferences and events. His efforts increased the public profile of the association’s programs and personalities and contributed to his unit’s recognition as the best small communications team by Ragan and PR Daily in 2014 and as a top Social Media-Savvy Association by Association Trends in 2015. "Ross Romano is an outstanding addition to the MindRocket team," said Dr. Peter DeWitt, a leading education author and consultant. DeWitt, who also writes the Finding Common Ground blog for Education Week, added, "I have worked with Ross over the last four years and he has an outstanding presence in person, as well as a great deal of credibility and respect in the field of education. I look forward to seeing what he does with MindRocket Media Group." Romano improved the ways in which ASCD connected with its educator audience by implementing best practices for engagement and expanding to new platforms. In partnership with BAM! Radio Network, he created and developed ASCD Learn Teach Lead Radio, a popular weekly podcast hosted by award-winning educators and featuring ASCD’s industry-leading authors and experts as guests. "I'm delighted to hear that Ross Romano will be joining MindRocket Media Group," said Errol St. Clair Smith, CEO of BAM! Radio Network. "Ross brings a strong and diverse skill set to the company. Over the last four years, we've been impressed with the way he leverages his expertise and experience in PR, new media, community building, and content development into powerful experiences for educators. We look forward to seeing how his vision and creativity will impact the trajectory of MindRocket." Prior to entering the education industry, Romano worked in the sports industry, including roles in both communications and baseball operations within Major League Baseball. He earned his Bachelor of Arts degree from The George Washington University and a Master’s degree from Georgetown University.


News Article | May 8, 2017
Site: www.marketwired.com

BROOKFIELD, NEWS--(Marketwired - May 8, 2017) - Brookfield Business Partners L.P. (NYSE:BBU)(TSX:BBU.UN) ("Brookfield Business Partners") announced today financial results for the quarter ended March 31, 2017. Brookfield Business Partners reported net income attributable to unitholders for the quarter ended March 31, 2017 of $66 million ($0.61 per unit), compared to a loss of $5 million in 2016. We generated Company Funds from Operations ("Company FFO") totaling $95 million ($0.88 per unit) for the quarter, compared to $37 million in 2016. Our results benefited from a gain on the sale of our bath and shower manufacturing operations. "We had an active first quarter, signing the acquisition of Greenergy, selling our bath and shower manufacturing operations for a sizable gain, and maintaining momentum on a number of strategic initiatives to support the growth of our business," said Cyrus Madon, CEO of Brookfield Business Partners. "After the quarter, we completed the acquisition of BRK Ambiental and announced an agreement to acquire the Loblaw gas station operations. Looking ahead, we see a favorable environment for Brookfield Business Partners given strengthening market conditions, a strong balance sheet and ample liquidity, all of which will help us deliver on planned initiatives and pursue growth opportunities." The following table presents Company FFO by segment: Our business services segment generated Company FFO of $4 million in the first quarter of 2017, compared to $2 million in the same period in 2016. We are starting to recognize the benefit of the two acquisitions completed in our facilities management business in 2016 and have also seen a modest improvement in our real estate services businesses, with an early start to the spring selling season. The positive contributions from these businesses were partially offset by a slow start to the year in our financial advisory business, which tends to fluctuate from quarter to quarter. Our construction services segment contributed negative $3 million of Company FFO in the quarter, compared to $22 million in 2016, as margin compression on three Australian projects offset the positive contribution from the remainder of our portfolio. We currently have over 100 projects under construction, and although the negative impact of these three projects lowered the current quarter's results, we are confident with the projects across our diversified business. We continue to replenish our workbook and secured $500 million of new work in the quarter. Our backlog remains strong at approximately $7.3 billion, as we continue to win sizable projects across each of our primary operating regions. Our energy segment generated Company FFO of $20 million during the quarter compared to $18 million in 2016, and included $10 million of gains on the monetization of our remaining high yield debt position. Results from our Canadian operations have improved with higher commodity prices during the quarter and we continue to benefit from the active cost management and operational improvements made over the past few years. Our Australian energy operation continues to benefit from its large hedge position for oil and long term fixed price contracts for gas with our customers. Our Australian energy operation paid a $250 million dividend, or $25 million net to Brookfield Business Partners, during the first quarter. Since our acquisition in June 2015, we have recovered approximately half of our capital invested in this operation. Our industrials segment generated Company FFO of $79 million during the first quarter, compared to a loss of $5 million in 2016. The monetization of our bath and shower manufacturing operations, Maax Bath Inc. and Maax Spas Industries Corp. ("Maax") generated approximately $140 million of cash proceeds for Brookfield Business Partners and resulted in an $82 million gain for unitholders. We continue to focus on operational restructuring efforts at our graphite electrode manufacturing operation, GrafTech International Holdings Inc. ("GrafTech") and are beginning to benefit from these initiatives. Volumes and prices have improved significantly in 2017, but as graphite electrodes are primarily sold under annual fixed price contracts that are negotiated in the fourth quarter of each year in advance of delivery, recent spot price improvements are not expected to have a significant impact on 2017 results. Company FFO contribution from our palladium operations increased in the first quarter with the current rebound in the market price of palladium metal. We are selling forward the majority of our near term sales as a means to de-risk our cash flows. Subsequent to the quarter end, together with our institutional partners, we completed the previously announced acquisition of a 70% controlling stake in the core water, wastewater and industrial water treatment business of Odebrecht Ambiental, for a total investment of $908 million. Upon close, we renamed the company BRK Ambiental. The investment is comprised of a payment of $768 million to the seller and approximately $140 million of additional capital contributed at closing to fund working capital requirements and support expected growth of the business. In addition, Brookfield Business Partners and its institutional partners also expect to purchase a direct interest in related assets held through a joint venture for $116 million. Brookfield Business Partners' share of capital invested at closing is approximately $340 million for an ownership interest in the business of 26%, and its share of the direct asset purchase is expected to total $44 million. A future payment to the seller of up to R$350 million (approximately $115 million at the current exchange rate) may be made if the business achieves certain performance milestones over the three years following closing. During the first quarter of 2017, together with institutional partners, we entered into a definitive agreement to acquire an 85% controlling stake in Greenergy Fuels Holdings Ltd ("Greenergy") and expect to close the transaction imminently. Greenergy is a leading provider of road fuels in the U.K. with over 300 kT of biodiesel production capacity, significant import and storage infrastructure and an extensive distribution network which delivers over 18 billion liters of road fuels annually. The total equity commitment is approximately £210 million ($262 million), or £36 million ($45 million) at Brookfield Business Partners' proportionate share, representing an ownership in the company of 14%. Subsequent to the quarter end, with our institutional partners, we entered into a definitive agreement with Loblaw Companies Limited ("Loblaw") to acquire its gas station operations for approximately C$540 million. Brookfield Business Partners expects to have an ownership interest in the business of approximately 25%. The gas station network is one of the largest in Canada, consisting of 213 stations and associated convenience kiosks adjacent to Loblaw-owned grocery stores. We are entering into an agreement with Imperial Oil to rebrand the gas station portfolio to the Mobil fuel brand, to ensure we have a highly competitive source of fuel supply across the country. The transaction is expected to close in the third quarter of this year. The Board of Directors of the General Partner of Brookfield Business Partners (the "Board") has declared a quarterly distribution in the amount of $0.0625 per unit, payable on June 30, 2017 to unitholders of record as at the close of business on May 31, 2017. The Board has reviewed and approved this news release, including the summarized unaudited consolidated financial statements contained herein. Brookfield Business Partners' Letter to Unitholders and the Supplemental Information are available at https://bbu.brookfield.com/reports-and-filings/financial-reports. Brookfield Business Partners is a business services and industrial company focused on owning and operating high-quality businesses that benefit from barriers to entry and/or low production costs. Brookfield Business Partners is listed on the New York and Toronto stock exchanges. Important information may be disseminated exclusively via the website; investors should consult the site to access this information. Brookfield Business Partners is the flagship listed business services and industrials company of Brookfield Asset Management Inc. (NYSE:BAM)(TSX:BAM.A)(EURONEXT:BAMA), a leading global alternative asset manager with approximately $250 billion of assets under management. For more information, please visit our website at https://bbu.brookfield.com. Investors, analysts and other interested parties can access Brookfield Business Partners' 2017 first quarter results as well as the Letter to Unitholders and Supplemental Information on our website at https://bbu.brookfield.com The conference call can be accessed via webcast on May 8, 2017 at 11:00 a.m. Eastern Time at https://bbu.brookfield.com or via teleconference at 1-800-319-4610 toll free in North America. For overseas calls please dial +1-604-638-5340, at approximately 10:50 a.m. Eastern Time. A recording of the teleconference can be accessed at 1-855-669-9658 or +1-604-674-8052 (Password 1212#). Note: This news release contains "forward-looking information" within the meaning of Canadian provincial securities laws and "forward-looking statements" within the meaning of Section 27A of the U.S. Securities Act of 1933, as amended, Section 21E of the U.S. Securities Exchange Act of 1934, as amended, "safe harbor" provisions of the United States Private Securities Litigation Reform Act of 1995 and in any applicable Canadian securities regulations. Forward-looking statements include statements that are predictive in nature, depend upon or refer to future events or conditions, include statements regarding the operations, business, financial condition, expected financial results, performance, prospects, opportunities, priorities, targets, goals, ongoing objectives, strategies and outlook of Brookfield Business Partners, as well as the outlook for North American and international economies for the current fiscal year and subsequent periods, and include words such as "expects," "anticipates," "plans," "believes," "estimates," "seeks," "intends," "targets," "projects," "forecasts" or negative versions thereof and other similar expressions, or future or conditional verbs such as "may," "will," "should," "would" and "could." Although we believe that our anticipated future results, performance or achievements expressed or implied by the forward-looking statements and information are based upon reasonable assumptions and expectations, the reader should not place undue reliance on forward-looking statements and information because they involve known and unknown risks, uncertainties and other factors, many of which are beyond our control, which may cause the actual results, performance or achievements of Brookfield Business Partners to differ materially from anticipated future results, performance or achievement expressed or implied by such forward-looking statements and information. Factors that could cause actual results to differ materially from those contemplated or implied by forward-looking statements include, but are not limited to: the impact or unanticipated impact of general economic, political and market factors in the countries in which we do business; the behavior of financial markets, including fluctuations in interest and foreign exchange rates; global equity and capital markets and the availability of equity and debt financing and refinancing within these markets; strategic actions including dispositions; the ability to complete and effectively integrate acquisitions into existing operations and the ability to attain expected benefits; changes in accounting policies and methods used to report financial condition (including uncertainties associated with critical accounting assumptions and estimates); the ability to appropriately manage human capital; the effect of applying future accounting changes; business competition; operational and reputational risks; technological change; changes in government regulation and legislation within the countries in which we operate; governmental investigations; litigation; changes in tax laws; ability to collect amounts owed; catastrophic events, such as earthquakes and hurricanes; the possible impact of international conflicts and other developments including terrorist acts and cyber terrorism; and other risks and factors detailed from time to time in our documents filed with the securities regulators in Canada and the United States. We caution that the foregoing list of important factors that may affect future results is not exhaustive. When relying on our forward-looking statements, investors and others should carefully consider the foregoing factors and other uncertainties and potential events. Except as required by law, Brookfield Business Partners undertakes no obligation to publicly update or revise any forward-looking statements or information, whether written or oral, that may be as a result of new information, future events or otherwise. CAUTIONARY STATEMENT REGARDING USE OF NON-IFRS MEASURES This press release contains references to Company FFO. When determining Company FFO, we include our unitholders' proportionate share of Company FFO for equity accounted investments. Company FFO is not a generally accepted accounting measure under IFRS and therefore may differ from definitions of Company FFO or Funds from Operations used by other entities. We believe that this is a useful supplemental measure that may assist investors in assessing the financial performance of Brookfield Business Partners and its subsidiaries. Company FFO should not be considered as the sole measure of our performance and should not be considered in isolation from, or as a substitute for, analysis of our financial statements prepared in accordance with IFRS. References to Brookfield Business Partners are to Brookfield Business Partners L.P. together with its subsidiaries, controlled affiliates and operating entities. Brookfield Business Partners' results include publically held limited partnership units, redemption-exchange units and general partnership units.

Loading BAM collaborators
Loading BAM collaborators