ATCC

Manassas, VA, United States
Manassas, VA, United States
SEARCH FILTERS
Time filter
Source Type

Parkinson's is a chronic, degenerative neurological disorder that affects one in 100 people over age 60. Recent research indicates that as many as one million Americans, and more than five million people worldwide, live with Parkinson's disease. In 2016, ATCC released three cell lines for investigating biological processes associated with LRRK2, a key Parkinson's disease genetic target. The Michael J. Fox Foundation funded the production and validation of these cell lines. ATCC also continues to work with MJFF to provide additional research tools, and is currently working on the production, validation, storage and future distribution of Parkin-expressing HeLa cells, which will be available later in 2017. "Research tools and reference reagents enable scientists to gain insight into the mechanisms of disease, and are critical in the development of new treatments," said Dr. Raymond Cypess, ATCC's Chairman and CEO. "These tools and reagents are also critical in recruiting scientists to work in specific disease areas. As partners to the scientific community for more than 90 years, ATCC is proud to join MJFF at ISBER to discuss the significance of these tools and the need to increase access and availability for the global research community." "The Michael J. Fox Foundation's collaboration with ATCC delivers vital pre-clinical tools to the Parkinson's research community to address field-wide challenges and advance disease understanding," said Nicole Polinski, Ph.D., associate director of research programs at MJFF. "We are pleased to join ATCC at ISBER to highlight the importance of these tools in developing therapeutic strategies and speeding PD research." About ATCC ATCC is a leader in biological materials management supporting the scientific community and government with research and development, products, and services in support of global health issues. With a history of innovation spanning more than 90 years, ATCC offers the world's largest and most diverse collection of human and animal cell lines, microorganisms, biological products, and standards. ATCC is a non-profit organization with headquarters in Manassas, Va. For more information about ATCC, visit us at www.atcc.org. To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/atcc-and-the-michael-j-fox-foundation-for-parkinsons-research-to-facilitate-workshop-at-isber-annual-meeting-300453151.html


News Article | May 17, 2017
Site: www.nature.com

The Cdh5(PAC)-CreERT2 transgenic mice (iECre) were a gift from R. H. Adams39. Krit1fl/fl and Ccm2fl/fl animals have been previously described40, 41. Tlr4fl/fl, Cd14−/−, Ai14 (R26-LSL-RFP), and R26-CreERT2 animals42, 43, 44, 45 were obtained from the Jackson Laboratories. The Slco1c1(BAC)-CreERT2 transgenic mice have been previously described18. All experimental animals were maintained on a mixed 129/SvJ, C57BL/6J, DBA/2J genetic background unless specifically described. C57BL/6J and timed pregnant Swiss Webster mice were purchased from Charles River Laboratories. Germ-free Swiss Webster mice were purchased from Taconic. Breeding pairs between two and ten months of age were used to generate the neonatal CCM mouse model pups. Mice were housed in a specific pathogen-free facility where cages were changed on a weekly basis; ventilated cages, bedding, food, and acidified water (pH 2.5–3.0) were autoclaved before use, ambient temperature maintained at 23 °C, and 5% Clidox-S was used as a disinfectant. Experimental breeding cages were randomly housed on three different racks in the vivarium, and all cages were kept on automatic 12-h light/dark cycles. The University of Pennsylvania Institutional Animal Care and Use Committee (IACUC) approved all animal protocols, and all procedures were performed in accordance with these protocols. A group of the resistant Ccm2ECKO colony was exported to the Centenary Institute, Sydney, Australia, where the mice were permanently maintained as an inbred colony in a quarantine facility. After several generations, this colony uniformly converted to lesion susceptibility. Cages were changed on a weekly basis; ventilated cages, bedding, food and acidified water (pH 2.5–3.0) were autoclaved before use. Ambient temperature was maintained between 22–26 °C, and 80% ethanol and F10SC (1:125 dilution of the concentrate, a quaternary ammonium compound) were used as disinfectants. Experimental breeding cages were randomly distributed throughout the vivarium, and all cages were kept on 12-h light/dark cycles. The Sydney Local Health District Animal Welfare Committee approved all animal ethics and protocols. All experiments were conducted under the guidelines/regulations of Centenary Institute and the University of Sydney. Germ-free Swiss Webster mice were purchased from Taconic and directly transferred into sterile isolators (Class Biologically Clean Ltd) under the care of the Penn Gnotobiotic Mouse Facility. Food, bedding and water (non-acidified) were autoclaved before transfer into the sterile isolators. Ventilated cages were changed weekly, and all cages in the vivarium were kept under 12-h light/dark cycles. Microbiology testing (aerobic and anaerobic culture, 16S qPCR) was performed every ten days and faecal samples were sent to Charles Rivers Laboratories for pathology testing on a quarterly basis. Further details regarding the sterile C-section fostering can be found below. The University of Pennsylvania Institutional Animal Care and Use Committee (IACUC) approved all animal protocols, and all procedures were performed in accordance with these protocols. For all neonatal CCM mouse model experiments, at one day post-birth (P1), pups were intragastrically injected by 30-gauge needle with 40 μg of 4-hydroxytamoxifen (4OHT, Sigma Aldrich, H7904) dissolved in a 9% ethanol/corn oil (volume/volume) vehicle (50 μl total volume per injection). This solution was freshly prepared from pre-measured, 4OHT powder for every injection. Before injection, the pup skin was sanitized using ethanol wipes. The P1 time point was defined by checking experimental breeding pairs every evening for new litters. The following morning (P1), pups were injected with 4OHT. All experimental pups were subjected to this induction regimen. For the Tlr4 rescue experiment (Fig. 2), and all lineage-tracing experiments, an additional dose of 40 μg 4OHT was intragastrically delivered at P2 (P1+2, two total doses). Pups were then harvested as previously described9 at the specified time points. Tissue samples were fixed in 4% formaldehyde overnight, dehydrated in 100% ethanol, and embedded in paraffin. 5-μm-thick sections were used for haematoxylin and eosin (H&E) and immunohistochemistry staining. The following antibodies were used for immunostaining: rat anti-PECAM (1:20, Histo Bio Tech DIA-310), rabbit anti-pMLC2 (1:200, Cell Signaling 3674S), goat anti-KLF4 (1:100, R&D AF3158), and rabbit anti-RFP (1:50, Rockland 600-401-379). Littermate control and experimental animal sections were placed on the same slide and immunostained at the same time under identical conditions. Images were taken at the same time using the same exposure times and colour channels, and were subsequently overlaid using ImageJ. Intra-abdominal abscesses were dissected and triturated in 500 μl of SOC medium. Drops of the mixture were placed on a microscope slide, briefly exposed to heat, and Gram staining was performed using a kit from Sigma Aldrich (77730) following the manufacturer’s protocol. Eyes from euthanized P17 mice were removed and fixed overnight in cold 4% PFA/PBS solution. The following day, retinas were dissected, cut into petals, and stained with isolectin-B4 conjugated to Alexa488 fluorophore (Thermo Fisher I21411) as previously described46. The retinas were then whole-mounted on microscopy slides in a flat, four-petal shape for fluorescence imaging. B. fragilis was purchased directly from the ATCC (strain 25285) and grown in chopped meat glucose (CMG) broth (Anaerobe Systems AS-813) under anaerobic conditions at 37 °C. Autoclaved, degassed caecal contents (ACC) were generated by collecting caecal contents from the colons of euthanized adult mice between 2–8 months of age. Caecal contents were then autoclaved and pulverized in an equal volume of CMG broth. This slurry was filtered through a 70-μm nylon strainer and degassed overnight in the anaerobic chamber. 1 ml of CMG broth was inoculated with B. fragilis and grown overnight to an optical density of between 0.8 and 1.0. An equal volume of ACC was mixed with the overnight bacterial culture. 100 μl of this B. fragilis–ACC mixture was injected intraperitoneally into five-day-old pups with a 31-gauge needle. Control littermates were simultaneously injected intraperitoneally with 100 μl of ACC alone. Pups were harvested at P17. Spleen weight was measured immediately after dissection, and all tissue was subsequently processed as described above. LPS from E. coli O127:B8 was purchased from Sigma (L3129) and administered to the low-lesion-penetrance, resistant Ccm2ECKO neonatal CCM disease model. At P5, a 3 μg dose of LPS dissolved in sterile PBS was administered retro-orbitally in a total 30 μl volume by 31-gauge needle. At P10, a 5 μg dose of LPS was administered retro-orbitally in a total 50 μl volume by 31-gauge needle. Control animals were identically injected with PBS alone. Pups were euthanized and brains dissected at specified time points. Peptidoglycan from Bacillus subtilis (a Gram-positive gut commensal) was purchased from Invivogen (tlrl-pgnb3) and administered to the resistant Ccm2ECKO neonatal CCM disease model under identical conditions as the LPS experiments. Poly(I:C) was purchased from Invivogen (tlrl-picw) and administered to the resistant Ccm2ECKO neonatal CCM disease model under identical conditions as the LPS experiments. Mouse IL-1β was purchased from Genscript (Z02988) and administered to the resistant Ccm2ECKO neonatal CCM disease model. At P5, a 5 ng dose of IL-1β dissolved in sterile PBS was administered retro-orbitally in a total 30 μl volume by 31-gauge needle. At P10, an 8-ng dose of IL-1β was administered retro-orbitally in a total 50 μl volume by 31-gauge needle. Control animals were identically injected with PBS alone. Pups were euthanized and brains dissected at specified time points. Mouse TNFα was purchased from Genscript (Z02918) and administered to the resistant Ccm2ECKO neonatal CCM disease model under identical conditions as the IL-1β experiments. For all experiments using microCT quantification of CCM lesion volume, brains were harvested and immediately placed in 4% PFA/PBS fixative. Brains remained in fixative until staining with non-destructive, iodine contrast and subsequent microCT imaging performed as previously described47. All tissue processing, imaging and volume quantification were performed in a blinded manner by investigators at the University of Chicago without any knowledge of experimental details. We blinded samples at three distinct points in the analysis. First, neonatal CCM model pups were injected with 4OHT without knowledge of genotypes. Second, hindbrains from genotyped animals were given randomized, de-identified labels to provide for blinded microCT scanning by an independent operator. Third, randomized microCT image stacks were analysed in a blinded manner by individuals not involved in any prior experimental steps. Mice were anaesthetized with Avertin and underwent intra-cardic perfusion with 10 ml of cold PBS. The brain was separated from the brainstem, and the cerebellum was separated from the remaining brain and processed in parallel. The tissue was minced with scissors, placed in digestion buffer (RPMI, 20 mM HEPES, 10% FCS, 1 mM CaCl , 1 mM MgCl , 0.05 mg ml−1 Liberase (Sigma), 0.02 mg ml−1 DNase I (Sigma)), and incubated for 40 min at 37 °C with shaking at 200 r.p.m. The mixture was passed through a 100-μm strainer and washed with FACS buffer (PBS, 1% FBS). Cells were resuspended in 4 ml of 40% Percoll (GE Healthcare) and overlaid on 4 ml of 67% Percoll. Gradients were centrifuged at 400g for 20 min at 4 °C and cells at the interface were collected, washed with 10 ml of FACS buffer, and stained for flow cytometric analysis. Neonatal P10 mice were anaesthetized with Avertin and underwent intracardiac puncture/blood draw using a 27-gauge needle/syringe coated with 0.5 M EDTA, pH 8.0 immediately before use. Cells were pelleted by centrifugation at 300g for 5 min at 4 °C. Serum was removed and red blood cells were lysed using ACK lysis buffer. Spleens were dissected in parallel, hand-homogenized using a mini-pestle and red blood cells were lysed using ACK lysis buffer. Cells from both sets of tissues were passed through a 70-μm cell-strainer, pelleted and resuspended in FACS buffer (PBS, 2% FBS, 0.1% NaN ) for immunostaining and subsequent FACS analysis. Cells were isolated from the indicated tissues. Single-cell suspensions were stained with CD16/32 and with indicated fluorochrome-conjugated antibodies. Live/Dead Fixable Violet Cell Stain Kit (Invitrogen) was used to exclude non-viable cells. Multi-laser, flow cytometry analysis procedures were performed at the University of Pennsylvania Flow Cytometry and Cell Sorting Facility using BD LSRII cell analysers running FACSDiva software (BD Biosciences). Two-laser, flow cytometry analyses were performed at the University of Pennsylvania iPS Cell Core using BD Accuri C6 instruments. FlowJo software (v.10 TreeStar) was used for data analysis and graphics rendering. All fluorochrome-conjugated antibodies used are listed as follows (Clone, Company, Catalog Number): CD11b (M1/70, Biolegend, 101255); CD11c (N418, Biolegend, 117318); CD16/32 (93, Biolegend, 101319); CD16/32 (93, eBiosciences, 56D0161D80); CD19 (6D5, Biolegend, 115510); CD3ε (145D2C11, Biolegend, 100304); CD4 (GK1.5, Biolegend, 100406); CD45 (30-F11, Biolegend, 103121 or 103151), CD8a (53D6.7, Biolegend, 100725); Foxp3 (FJK-16 s, eBiosciences, 50-5773-82); Ly-6G (1A8, Biolegend, 127624); Live/Dead (N/A, Thermofisher, LD34966); NK1.1 (PK136, Biolegend, 108745); RORγt (B2D, eBiosciences, 12-6981-82); Siglec-F (E50D2440, BD, 562757); TCRγδ (UC7-13D5, Biolegend, 107504) At the specified time points, cerebellar endothelial cells were isolated through enzymatic digestion followed by separation using magnetic-activated cell sorting by anti-CD31-conjugated magnetic beads (MACS MS system, Miltenyl Biotec), as previously described9. Lung endothelial cells were isolated through enzymatic digestion, as previously described, followed by separation using anti-CD31-conjugated magnetic beads and the MACS MS system48. Isolated endothelial cells were pelleted and total RNA was extracted using the RNeasy Micro kit (Qiagen 74004). For qPCR analysis, cDNA was synthesized from 300 ng to 500 ng total RNA using the SuperScript VILO cDNA Synthesis Kit and Master Mix (Thermo Fisher 11755050). Real-time PCR was performed with Power SYBR Green PCR Master Mix (Thermo Fisher 4368577) using the primers listed (all mouse): Gapdh forward: 5′-AAATGGTGAAGGTCGGTGTGAACG-3′; Gapdh reverse: 5′-ATCTCCACTTTGCCACTGC-3′; Klf2 forward: 5′-CGCCTCGGGTTCATTTC-3′; Klf2 reverse: 5′-AGCCTATCTTGCCGTCCTTT-3′; Klf4 forward: 5′-GTGCCCCGACTAACCGTTG-3′; Klf4 reverse: 5′-GTCGTTGAACTCCTCGGTCT-3′; Krit1 forward: 5′-CCGACCTTCTCCCCTTGAAC-3′; Krit1 reverse: 5′-TCTTCCACAACGCTGCTCAT-3′; Il1b forward: 5′-GCAACTGTTCCTGAACTCAACT-3′; Il1b reverse: 5′-ATCTTTTGGGGTCCGTCAACT-3′; Sele forward: 5′-ATGCCTCGCGCTTTCTCTC-3′; Sele reverse: 5′-GTAGTCCCGCTGACAGTATGC-3′; Tlr4 forward: 5′-ACTGGGGACAATTCACTAGAGC-3′; Tlr4 reverse: 5′-GAGGCCAATTTTGTCTCCACA-3′. As part of the Brain Vascular Malformation Consortium (BVMC) CCM study (Project 1), a large cohort of familial CCM individuals with identical KRIT1(Q455X) mutations were enrolled between 2009–2014 at the University of New Mexico. All study protocols were approved by the Institutional Review Boards at the University of New Mexico and University of California San Francisco (UCSF) and all procedures were performed in accordance with these protocols. Prior to participation in the study, written informed consent was obtained from every patient and properly documented by UNM investigators. At study enrollment, participants received a neurological examination and 3T MRI imaging using a volume T1 acquisition (MPRAGE, 1-mm slice reconstruction) and axial TSE T2, T2 gradient recall, susceptibility-weighted, and FLAIR sequences. Lesion counting by the neuroradiologist was based on concurrent evaluation of axial susceptibility-weighted imaging with 1.5-mm reconstructed images and axial T2 gradient echo 3-mm images. Participants also provided blood or saliva samples for genetic studies. Genomic DNA was extracted using standard protocols. De-identified samples were normalized, plated on 96-well plates, and genotyped at the UCSF Genomics Core Facility using the Affymetrix Axiom Genome-wide LAT1 Human Array. Affymetrix Genotyping Console (GTC) 4.1 Software package was used to generate quality control metrics and genotype calls. All samples had genotyping call rates of ≥ 97% and were further checked for sample mix-ups (sex check, Mendelian errors and cryptic relatedness), resulting in 188 samples for genetic analysis. 21 candidate genes were further examined in the TLR4 and MEKK3–KLF2/4 signalling pathways (TLR4, CD14, MD-2, LBP, MYD88, TICAM1, TIRAP, TRAF1-6, MAP3K3, MEK5, ERK5, MEF2C, KLF2, KLF4, ADAMTS4, ADAMTS5) including 467 SNPs within 20 kb upstream or downstream of each gene locus using UCSC Genome Browser coordinates (GRCh37/hg19). Because total lesion counts are highly right-skewed, raw counts were log-transformed and analysis was performed on residuals (adjusted for age at enrollment and sex). To identify genotypes associated with log-transformed residual counts, linear regression analysis was implemented using QFAM family-based association tests for quantitative traits (PLINK v1.07 software), with stringent multiple testing correction (Bonferroni correction for the number of SNPs tested within each gene) given that some SNPs on the Affymetrix array were in linkage disequilibrium with each other, that is, statistically correlated with R2 > 0.8. The Fehrmann dataset used for eQTL lookups consisted of peripheral blood samples from the UK and the Netherlands49, 50. Samples were genotyped with Illumina HumanHap300, HumanHap370 or 610 Quad platforms. Genotypes were input by Impute v2 (ref. 51) using the GIANT 1000G p1v3 integrated call set for all ancestries as a reference52. Gene expression levels were measured by Illumina HT12v3 arrays. Gene expression pre-processing involved quantile normalization, log transformation, probe centring and scaling, population stratification correction (first four genetic multi-dimensional scaling components were removed from gene expression data) and correction for unknown confounders (first 20 gene expression principal components not associated with genetic variants were removed from gene expression data). Identification of potential sample mix-ups was conducted by MixupMapper21 and finally 1,227 samples remained. All pre-processing steps were performed with the QTL mapping pipeline v1.2.4D (https://github.com/molgenis/systemsgenetics/tree/master/eqtl-mapping-pipeline - downloading-the-software). These results are corroborated by an independently conducted GTEX Consortium study (http://www.gtexportal.org/home/snp/rs10759930 and http://www.gtexportal.org/home/snp/rs778587). TAK-242 was purchased from EMD Millipore (614316) and administered to the neonatal CCM disease model. Five, seven and nine days after birth, a 60-μg dose of TAK-242 was dissolved in DMSO/sterile intralipid (Sigma, I141) vehicle and administered retro-orbitally in a total volume of 30 μl. Control animals were identically injected with sterile DMSO/intralipid vehicle alone. Pups were euthanized and brains dissected 10 days after birth. LPS-RS ultrapure was purchased from Invivogen (tlrl-prslps) and administered to the neonatal CCM disease model. Starting at P5, a 20 μg dose dissolved in sterile PBS was administered retro-orbitally in a total volume of 30 μl every 24 h. Control animals were identically injected with sterile PBS alone. Pups were euthanized and brains dissected 10 days after birth. Experimental breeding pairs of mice, yielding susceptible neonatal CCM pups, were identified by induction of a neonatal CCM litter and evaluation of lesion burden. These breeding pairs then underwent timed matings and at E14.5, both male and female adult mice received antibiotic-laced drinking water mixed with 40 g l−1 of sucralose and red food colouring. Antibiotic water was replaced daily. The following antibiotics were mixed with 0.22-μm-filtered water: penicillin (500 mg l−1), neomycin (500 mg l−1), streptomycin (500 mg l−1), metronidazole (1 g l–1) and vancomycin (1 g l−1). Antibiotics were purchased from the Hospital of the University of Pennsylvania pharmacy. The neonatal CCM model was induced as described above. At P10, pups were euthanized and antibiotic water switched to normal drinking water. Experimental breeding pairs were then mated to obtain third generation, post-antibiotic pups. Co-housed, susceptible Krit1fl/fl females underwent evening–morning timed matings with a single susceptible Krit1ECKO male. Upon detection of a plug in the morning, the females were subsequently separated into singly-housed cages. At E14.5, female mice were received either vancomycin (1 g l−1)-laced or untreated (vehicle) sterile-filtered drinking water, changed daily. The drinking water was further mixed with 40 g l−1 sucralose and red food colouring. Pups were harvested at P11. The entire neonatal gut was dissected, snap-frozen on dry ice, and stored at −80 °C. The QIAamp DNA Stool Mini Kit (Qiagen 51504 or 51604) was used to extract bacterial DNA from the neonatal gut. Before commencing the standard Qiagen protocol, the frozen gut was mixed in the included stool lysis buffer and homogenized with a 5 mm stainless steel bead in a TissueLyser LT (Qiagen 69980) at 50 Hz for 10 min at 4 °C. Concentration of the extracted DNA was equalized and 16 ng of DNA was used per qPCR reaction with universal bacterial 16S rRNA gene primers53, two different sets of previously characterized Bacteroidetes s24-7 primers54, 55, and Firmicutes primers56. Universal 16S rRNA forward: 5′-ACTGAGAYACGGYCCA-3′; universal 16S rRNA reverse: 5′-TTACCGCGGCTGCTGGC-3′; Bacteroidetes s24-7 rRNA set 1 forward: 5′-GGAGAGTACCCGGAGAAAAAGC-3′; Bacteroidetes s24-7 rRNA set 1 reverse: 5′-TTCCGCATACTTCTCGCCCA-3′; Bacteroidetes s24-7 rRNA set 2 forward: 5′-CCAGCAGCCGCGGTAATA-3′; Bacteroidetes s24-7 rRNA set 2 reverse: 5′-CGCATTCCGCATACTTCTC-3′; Firmicutes rRNA forward: 5′-TGAAACTYAAAGGAATTGACG-3′; Firmicutes rRNA reverse: 5′-ACCATGCACCACCTGTC-3′. Evening–morning timed matings to generate donor susceptible or resistant females yielding Krit1ECKO or Ccm2ECKO pups were performed and timed pregnant Swiss Webster females (Charles River 024) served as foster mothers. To prevent delivery of the pups, at E16.5, donor females were injected subcutaneously with 100 μl of a 15 μg ml−1 solution of medroxyprogesterone (Sigma Aldrich, M1629) dissolved in DMSO. The morning of E19.5, the donor mother was euthanized by cervical dislocation and submerged in a warm sterile solution of 1% VirkonS/PBS (weight/volume) for one minute. The uterus was then dissected in a sterile laminar flow hood, submerged in a warm sterile solution of 1% VirkonS/PBS for one minute and quickly rinsed with warm sterile PBS. Pups were then removed from the uterus and fostered to the Swiss Webster recipient female. The following morning, induction of the neonatal CCM model was performed as described above. Timed matings were performed using germ-free Swiss Webster mice housed in sterile isolators under care of the University of Pennsylvania Gnotobiotic Mouse Facility. Simultaneous evening–morning timed matings were also performed using co-housed, susceptible Krit1fl/fl females and Krit1ECKO males previously characterized to yield CCM-susceptible pups. Medroxyprogesterone was administered to donor females and the sterile C-section was performed at E19.5 as described in the previous section. The intact uterus was passed through a J-tube filled with warm 1% VirkonS/PBS that was hermetically sealed to the sterile isolator. Pups were dissected from the uterus inside the sterile isolator and fostered to the recipient germ-free Swiss Webster mother. Approximately one week later, faecal samples were collected for microbiology testing. Germ-free status was further confirmed by 16S qPCR of bacterial DNA isolated from maternal faeces and neonatal guts. Fresh faecal pellets were collected from experimental females yielding susceptible or resistant pups one day after harvesting the pups to determine phenotypic severity. Collection was performed between 16:00 and 18:00, pellets were immediately snap-frozen on dry ice, and stored at −80 °C. DNA was extracted from stool samples using the Power Soil htp kit (Mo Bio Laboratories) following the manufacturer’s protocol. Library preparation was performed by using previously described barcoded primers targeting the V1/V2 region of the 16S rRNA gene57. PCR reactions were performed in quadruplicate using AccuPrime Taq DNA Polymerase High Fidelity (Invitrogen). Each PCR reaction consisted of 0.4 μM primers, 1× AccuPrime Buffer II, 1 U Taq, and 25 ng DNA. PCRs were run using the following parameters: 95 °C for 5 min; 20 cycles of 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 90 s; and 72 °C for 8 min. Quadruplicate PCR reactions were pooled and products were purified using AMPureXP beads (Beckman-Coulter). Equimolar amounts from each sample were pooled to produce the final library. Positive and negative controls were carried through the amplification, purification and pooling procedures. Negative controls were used to assess reagent contamination and consisted of extraction blanks and DNA-free water. Positive controls were used to assess amplification and sequencing quality and consisted of gBlock DNA (Integrated DNA Technologies) containing non-bacterial 16S rRNA gene sequences flanked by bacterial V1 and V2 primer binding sites. Paired-end 2 × 250 bp sequence reads were obtained from the MiSeq (Illumina) using the 500 cycle v2 kit (Illumina). Sequence data were processed using QIIME version 1.9.1 (ref. 58). Read pairs were joined to form a complete V1/V2 amplicon sequence. Resulting sequences were quality filtered and demultiplexed. Operational taxonomic units (OTUs) were selected by clustering reads at 97% sequence similarity59. Taxonomy was assigned to each OTU with a 90% sequence similarity threshold using the Greengenes reference database60. A phylogenetic tree was inferred from the OTU data using FastTree61. The phylogenetic tree was then used to calculate weighted and unweighted UniFrac distances between each pair of samples in the study62, 63. Microbiome compositional differences were visualized using principle coordinates analysis (PCoA). Community-level differences between mice genetic background as well as disease susceptibility groups were assessed using a PERMANOVA test64 of weighted and unweighted UniFrac distances. To assess significance in the PERMANOVA test, each cage was randomly re-assigned to groups 9,999 times. Differential abundance was assessed for taxa present in at least 80% of the samples, using generalized linear mixed-effects models. For tests of taxon abundance, the cage was modelled as a random effect, as previous research has established that the faecal microbiota of mice are correlated within cages65. The P values were corrected for multiple testing using Benjamini–Hochberg method. Sample sizes were estimated on the basis of our previous experience with the neonatal CCM model and lesion volume quantification by microCT9. Using 40 historically collected, susceptible Krit1ECKO and Ccm2ECKO P10 brains, we calculated a sample standard deviation of 0.250 mm3. Between Krit1ECKO and Ccm2ECKO genotypes, an F-test to compare variances confirmed no significant difference (P = 0.340). Thus, for a two-group comparison of lesion volumes, each sample group requires seven animals for a desired statistical power of 95% (β = 0.05), and a conventional significance threshold of 5% (α = 0.05) assuming an effect size of 50% (0.5) and equal standard deviations between sample groups. These predictive calculations were corroborated by our recent publication in which larger effect sizes (>90%) were found to be statistically significant with four to five samples per group9. All experimental and control animals were littermates and none were excluded from analysis at the time of harvest. Experimental animals were lost or excluded at two pre-defined points: (i) failure to properly inject 4OHT and observation of significant leakage; (ii) death before P10 because of injection or chaos. Given the early time points, no attempt was made to distinguish or segregate results based on neonatal genders. P values were calculated as indicated in figure legends using an unpaired, two-tailed Student’s t-test; one-way ANOVA with multiple comparison corrections (Holm–Sidak or Bonferroni); PERMANOVA; or linear mixed effects modelling. As indicated in the figure legends, the standard error of the mean (s.e.m.), 95% confidence interval, or boxplot is shown. All relevant data are available from the authors upon reasonable request.


News Article | May 17, 2017
Site: www.nature.com

Ntn1βgeo(ref. 7) and Dcc (ref. 18) knockout lines have previously been described and genotyped by PCR. The Ntn1 conditional knockout was created (Genoway) by inserting two loxP sites flanking the coding sequences containing both the principal ATG (based on Ntn1 cDNA sequence NM_008744) and the cryptic ATG (based on Ntn1 cDNA: BC141294) and the alternative promoter described in intron 3 (ref. 28). The targeting vector was constructed as follows: three fragments of 2.1 kb, 3.4 kb and 4.6 kb (respectively, the 5′, floxed and 3′ arms) were amplified by PCR using 129Sv/Pas ES DNA as a template and sequentially subcloned into the pCR4-TOPO vector (Invitrogen). These fragments were used for the construction of the targeting vector in which a FRT-flanked neomycin cassette was inserted in 5′ of the loxP-flanked region. The linearized construct was electroporated into 129Sv/Pas mouse embryonic stem (ES) cells. After selection, targeted clones were identified by PCR using external primers and further confirmed by Southern blot analysis both with a neomycin and a 5′ external probe. The positive ES cell clones were injected into C57BL/6J blastocysts and gave rise to male chimaeras with a significant ES cell contribution. Breeding was established with C57BL/6 mice expressing the Flp-recombinase, to produce the heterozygous Ntn1 conditional knockout line devoid of the neomycin cassette. To generate a null allele of Ntn1, Ntn1fl/fl mice were crossed to Krox20:cre mice, which express Cre recombinase in the male and female germline after sexual maturity29. To ablate netrin-1 expression in the floor plate we used the Shh:cre line30 (Jackson laboratories). In this line, the eGFP reporter was also inserted in the Shh locus. Lastly, we crossed Ntn1fl/fl mice to Foxg1:cre mice31 and Nes:cre mice22 (Jackson laboratories). The Ai9 RosatdTomato reporter line (RosaTom; Jackson Laboratories) was used to monitor Cre expression. Developing inferior olivary neurons were visualized by crossing the RosaTom line with the Ptf1a:creERT2 line15. They were also further crossed to Ntn1βgeo mice. All mice are kept in C57BL/6 background. The day of the vaginal plug was counted as embryonic day 0.5 (E0.5). Mice were anaesthetized with intraperitoneal injection of ketamine (100 mg/kg body weight) and xylazine (10 mg/kg). All animal procedures were carried out in accordance to institutional guidelines and approved by the UPMC Charles Darwin Ethics Committee. Embryos of either sex were used. Ptf1a:creERT2;RosaTom pregnant mice were intraperitoneally injected at E10 with 1 mg of tamoxifen (Sigma-Aldrich, T-5648) dissolved in corn oil (Sigma-Aldrich, C-8267). The embryos were collected at E11. Pregnant females were injected intraperitoneally with EdU (1 mg per 10 g body weight) and killed three hours later. The proliferating cells were visualized after immunohistochemistry using the Alexa Fluor 647 Click-iT EdU Imaging Kit (Invitrogen). Antisense riboprobes were labelled with digoxigenin-11-d-UTP (Roche Diagnostics) as described elsewhere12, by in vitro transcription of cDNA of mouse Ntn1 (ref. 7) or mouse Ntn1 exon 3. E12-E13 hindbrains fixed in 4% PFA in an open book configuration were injected using a glass micropipette with DiI crystals or small drops of DiI (Invitrogen) diluted in dimethyl sulfoxide (DMSO, Sigma-Aldrich). Samples were kept for 24 h at 37 °C in 4% PFA. Embryos were fixed by immersion in 4% PFA in 0.12 M phosphate buffer, pH 7.4 (PFA) overnight at 4 °C. Samples were cryoprotected in a solution of 10% sucrose in 0.12 M phosphate buffer (pH 7.2), frozen in isopentane at 50 °C and then cut at 20 μm with a cryostat (Leica Microsystems). Immunohistochemistry was performed on cryostat sections after blocking in 0.2% gelatin in PBS containing 0.5% Triton-X 100 (Sigma-Aldrich). Sections were then incubated overnight with the following primary antibodies: goat anti-human Robo3 (1:250, R&D Systems AF3076), goat anti-Dcc (1:500, Santa Cruz sc-6535), goat anti-Robo1 (1:500, R&D Systems AF1749), rat anti-mouse netrin-1 (1:500, R&D Systems MAB1109), mouse anti-nestin–Alexa488 (1:1000, Abcam ab197495), mouse anti-neurofilament (1:300, DSHB 2H3), goat anti-Foxp2 (1:1000, Santa Cruz sc-21069), rabbit anti-Foxp2 (1:1000, Abcam ab16046), rabbit anti-Sox2 (1:500, Abcam ab97959), rabbit anti-βgal (1:500, Cappel 55976), goat anti-human ALCAM (1:500, R&D Systems AF656), rabbit anti-GFP (1:800, Life Technologies A11122), rabbit anti-DsRed (1:500, Clontech 632496) followed by 2 h incubation in species-specific secondary antibodies directly conjugated to fluorophores (Cy-5, Cy-3, Alexa Fluor 647 from Jackson ImmunoResearch, or from Invitrogen). For netrin-1 immunostaining, an antigen retrieval treatment was performed on the sections before to process them for immunochemistry. The sections were boiled in citrate buffer (pH 6) during 9 min. Sections were counterstained with DAPI (1:1,000, Sigma-Aldrich). In the case of netrin-1 immunostaining on non-permeabilized tissue, the Triton was removed from all the steps. Slides were scanned with a Nanozoomer (Hamamatsu) and laser scanning confocal microscope (FV1000, Olympus). Brightness and contrast were adjusted using Adobe Photoshop. Whole-mount immunostaining and 3DISCO optical clearing procedure has been described previously32. 3D imaging was performed with an ultramicroscope using Inspector Pro software (LaVision BioTec). HEK-293T cells (from ATCC, not authenticated, tested for mycoplasma contamination with a negative result) were transfected with pCDNA3, pCDNA3-human NTN3, pCDNA3-human NTN1 or pCDNA3-mouse Ntn1 plasmids using Fugene HD transfection reagent (Promega) according to the manufacturer’s instructions. Cells were harvested and lysed 36 h after transfection. Cells were lysed using RIPA buffer (150 mM NaCl, 50 mM Tris pH 8.0, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, complete protease inhibitor cocktail (Roche Diagnostics)) and incubated for 1 h at 4 °C. Floor plates were micro-dissected from hindbrains and spinal cords from Ntn1fl/fl, Shh:cre;Ntn1fl/fl and Ntn1−/− E11 embryos. Floor plates were lysed in RIPA buffer and incubated for 20 min at 4 °C. Protein content was determined by a BCA assay. 25 μg of total protein was loaded on a 10% Mini Protean TGX precast gel (Biorad) and blotted onto a nitrocellulose membrane (Biorad). Membranes were blocked with 5% dried milk and 3% of BSA in TBS-0.1% Tween (TBS-T) for 1 h at room temperature and incubated for 90 min at room temperature with primary antibodies: anti-actin (Sigma-Aldrich, A5060, rabbit polyclonal, 1:1,500), anti-HPRT (Abcam, ab109021, rabbit monoclonal EPR5299, 1:10,000), anti-Ntn1 (R&D Systems, MAB1109, rat monoclonal, 1:500), anti-NTN3 (Abcam, ab185200, rabbit polyclonal, 1:1,000) and anti-Slit2 (Abcam, ab134166, rabbit monoclonal, 1:400). After three washes in TBS-T, membranes were incubated with the appropriate HRP-conjugated secondary antibody (1:5,000, Jackson ImmunoResearch). Detection was performed using Pierce ECL Western Blotting Substrate (ThermoScientific). All data quantification was done by an observer blinded to the experimental conditions. We did not perform randomization into groups. No statistical methods were used to predetermine sample size. Data are presented as mean values ± s.e.m. Statistical significance was calculated using one-sided unpaired tests for non-parametric tendencies (Kruskal–Wallis and Mann–Whitney). For western blot, at least three independent cases were quantified from independent experiments using densitometric analysis (ImageJ) by normalizing phosphorylation signals to total protein levels. The control cases were normalized to 1 and for the mutants, data were presented as mean values ± s.e.m. (0.1133 ± 0.05 for Shh:cre; Ntn1fl/fl 1 for Ntn1fl/fl and 0 for Ntn1−/−). Differences were considered significant when P < 0.05. The thickness of hindbrain commissural bundles was quantified for each embryo on nine coronal sections. The sections were representative of three different hindbrain antero-posterior levels (three sections for each level). To minimize the developmental variations, mutant embryos and littermate controls were compared (except for Ntn1−/− embryos which were compared to wild-type embryos). The ratio of the commissural axon bundle size was normalized to controls. Six embryos of each genotype were quantified, from at least two different litters. Data are presented as mean ± s.e.m.: wild type: Dcc, 0.994 ± 0.052; Robo3, 1 ± 0.061; neurofilament, 1 ± 0.048; Ntn1βgeo/βgeo: Dcc, 0.416 ± 0.013; Robo3, 0.402 ± 0.007; neurofilament, 0.416 ± 0.01; Ntn1−/−: Dcc, 0.091 ± 0.008; Robo3, 0.061 ± 0.008; neurofilament, 0.104 ± 0.007; Shh:cre;Ntn1fl/fl: Dcc, 1.051 ± 0.011; Robo3, 1.084 ± 0.028; neurofilament, 1.063 ± 0.019; and Foxg1:cre;Ntn1fl/fl: Dcc, 0.411 ± 0.053; Robo3, 0.369 ± 0.056; neurofilament, 0.416 ± 0.050. Differences were considered significant when P < 0.05. Statistical analyses of the mean and variance were performed with Prism 7 (GraphPad Software). The data that support the findings of this study are available from the corresponding author upon reasonable request.


No statistical methods were used to predetermine sample sizes. All behaviour data were collected in a random manner. No blinding method was used in assessing experimental outcomes. The following flies were obtained from Bloomington Stock Center: isogenized w1118 (BL5905), norpAP24 (BL9048), ninaE-norpA (rh1>norpA; this is a direct fusion of the ninaE promoter to the norpA coding region; BL52276), ninaE–Gal4 (rh1–Gal4; BL8691), trpMB (BL23636), trplMB (BL29314), UAS–mcherry-NLS (BL38425), gl60j (BL 509), pdf–Gal4 (BL6900), and two UAS–plc21C RNAi lines (01210, BL 31269 and 01211, BL31270). GMR–hid31 was obtained from the Drosophila Genetic Resource Center, Kyoto (108419). We used w1118 as the control strain. The UAS–rh7 RNAi line (v1478) was from VDRC Stock Center. The tim–Gal4 transgene32 was provided by A. Sehgal. The cry–Gal4.E13 transgene2 was from M. Rosbash. The cryb and cry01 flies2, 33 were provided by M. Wu and the rh502, rh601, UAS-rh3, UAS-rh4 and UAS-rh5 lines34, 35 were provided by C. Desplan. We also used ninaEI17 flies36. To clone the rh7 coding region, we prepared mRNA from w1118 heads, performed reverse transcription (RT)-PCR using the following primers, and cloned the cDNA into the TOPO vector (pCR2.1-TOPO, Invitrogen). Primers: rh7 forward, GCGGCCGCCACCATGGAGGCCATCATCATGACG; rh7 reverse, GCGGCCGCTCAGAACTTACTCTGTTCCATGAC. To generate the UAS–rh7 transgene, we subcloned the rh7 open reading frame into the NotI site of the pUAST vector. To construct the plasmid for expression of Rh7 in HEK293T cells, we subcloned the rh7 open reading frame between the BamH1 and Xba1 sites of the pCS2+MT vector using the following primers: rh7 forward, ATCAGATCTCACCATGGAGGCCATCATCATGACG; rh7 reverse, ATCTCTAGATCAGAACTTACTCTGTTCCATGAC. To generate transgenic flies expressing an Rh7–FLAG fusion protein, we first constructed the pUAST–FLAG vector using the following two oligonucleotides, which we annealed and cloned into the XhoI and XbaI sites of the pUAST vector: FLAG 5′-XbaI, TCGAGGGGATTACAAGGATGACGACGATAAGTAAT and FLAG 3′-XhoI, CTAGATTACTTATCGTCGTCATCCTTGTAATCCCC. We amplified the rh7 coding region using the same forward primer as above, in conjunction with the following reverse primer to eliminate the stop codon: rh7 reverseno-stop, GCGGCCGCGAACTTACTCTGTTCCATGAC. Both the UAS–rh7 and UAS–rh7–FLAG transgenic flies were obtained by germline transformation using w1118 embryos (Bestgene Inc.). To generate flies expressing an rh7+ genomic transgene (P[rh7+]), a BAC genomic DNA clone (CH322180G19) was obtained from the P[acman] collection37. The germline transformation took advantage of site-specific integration using the Φ31-attB/attP system (Bestgene Inc.). We produced the plasmid for knocking out rh7 by ends-out homologous recombination38 as follows. We PCR amplified two homologous arms (left, 3.2 kb and right, 3.3 kb) using the following primers: left arm forward, AATTGCTGGGATCCCTCAATTGGCCTAATCGGTTTCTG; left arm reverse, AATTGCTGGGTACCGACTGACTTGGCCAAATATTTACG; right arm forward, AATGCTGGCGGCCGCTTAAAATGCTGCCCGAGACT; right arm reverse, AATTGCTGGCGGCCGCTGGCTTATGAAGTTGCAAAAAG. We cloned the two arms into the targeting vector, pw35loxp–Gal4. This construct was designed to delete 540 base pairs (bp) 3′ to the rh7 translational start site, and was replaced with a cassette containing the mini-white marker and Gal4 flanked by two loxP sites. The upstream loxP sequence contained a translational start site that rendered the Gal4 coding region out of frame. Consequently, the Gal4 was not functional. To obtain the donor lines for generating the rh7 knockout (rh71 allele), the targeting vector was injected into w1118 embryos (Bestgene Inc.). We mobilized the donor insertion by crossing the donor line to y,w;P[70FLP]11 P[70I-SceI]2B nocSco/CyO flies (Bloomington Stock Center, BL6934). The progeny were screened for gene targeting in the rh7 locus by PCR using two pairs of primers. The first pair (P1 and P2) were the following two primers that annealed to the first and second coding exons, and produced a DNA product (885 bp) only in the wild-type (Extended Data Fig. 2g): P1, CTCTCGCTCTCCGAGATGTT and P2, ACCACCGAAATCAGGCAATA. The following second pair of primers (P3 and P4) annealed to the mini-white gene and to a sequence 3′ to rh7, and therefore only generated a product in the rh71 mutant (4.4 kb; Extended Data Fig. 2g): P3, TGTACATAAAAGCGAACCGAACCT and P4, ACTGTGCGACAGAGTGAGAGAGCAATAGTA. After generating rh71, we outcrossed the flies to the control stain (w1118) for five generations. To determine whether the key fly lines used in this study harboured the perSLIH, timls or jetc mutations in the genetic background, we performed DNA sequencing. We extracted genomic DNA from adult flies, and amplified the relevant regions in the per, tim and jet genes by PCR (Phusion High-Fidelity DNA Polymerase, NEB) using the following primers: per: forward, GTCCACACACAACACCAAGG; reverse, TTGATGATCATGTCGCTGCT. tim: forward, TGGCTGGGGATTGAAAATAA; reverse, TTACAGATACCGCGCAAATG. jet: forward, AGCCGATCATAGTGGAGTGC; reverse, AAGGCACGCACAGGTTTACT. We purified the PCR products and subjected them to DNA sequencing (DNA Sequencing Facility at the University of California, Berkeley). The perSLIH allele has a C to A transversion at nucleotide 2688438. The control (per+) sequence encompassing this region (2688436–2688448, Drosophila genome release r6.14) is CTCCGGCAGCAGT. The perSLIH sequence is CTACGGCAGCAGT. All of the fly lines checked had sequences that matched per+. These include: (1) rh71, (2) rh71 cryb, (3) rh71 cry01, (4) pdf–Gal4 and (5) rh7-RNAi. The timls allele has a single nucleotide insertion (C) after nucleotide 3504474 relative to tims. The sequence spanning this region in the control (timls) is ATCAAAGTTCTGAT (3504473–3504486, Drosophila genome release r6.14) and in tims is ATAAAGTTCTGAT. We sequenced the following lines, all which had sequences that matched the control (tims): (1) cry01, (2) rh71 and (3) P[rh7+]; rh71. The jetc allele has a T-to-A transversion at nucleotide 4949048. The control (jet+) sequence spanning this region (4949059–4949047, Drosophila genome release r6.14) is CTTGATTATCTTC, while the jetc sequence is CTTGATTATCTAC. We sequenced the following lines, all of which had sequences that matched the control (jet+): (1) cry01, (2) rh71 and (3) P[rh7+];rh71. To quantify expression of opsin genes (Fig. 1b), we isolated total RNA from ~50 fly heads from each of the indicated fly stocks, and used 1 μg total RNA from each sample as a template for reverse transcription using SuperScript III Reverse Transcriptase (ThermoFisher, cat. 18080093). Oligo dT primers were used for cDNA synthesis. cDNA preparation was subjected to real-time quantitative PCR (Roche, LightCycler 480 system) according to the LightCycler 480 SYBR Green 1 Master Mix (cat. 04707516001) protocol. The primers used for real-time quantitative PCR were: rh1: forward CGCTACCAAGTGATCGTCAA, reverse GTATGAGCGTGGGTTCCAGT. rh2: forward TCCGTGCTGGACAATGTG, reverse AATCATGCACATGGACCAGA. rh3: forward CGAGCAAAAGAACAGGAAGC, reverse TCGATACGCGACTCTTTGTG. rh4: forward GTAGCCCTCTGGCACGAAT, reverse TCTTCAGCACATCCAAGTCG. rh5: forward TCCTGACCACCTGCTCCTTC, reverse GCTCCAGCTCCAGACGATAC. rh6: forward CAAGGACTGGTGGAACAGGT, reverse GTACTTCGGGTGGCTCAATC. rh7: forward GTTTCCACGGGTCTGACAAT, reverse GCTGTAGCACCAGATCAGCA. rp49: forward GACGCTTCAAGGGACAGTATCTG, reverse AAACGCGGTTCTGCATGAG. We also analysed opsin gene expression using an RNA-seq dataset (Fig. 1c). For each genotype, three independent RNA libraries were prepared from ~50 heads using the TruSeq Stranded mRNA Library Prep Kit. Pair-end sequencing was performed using the TruSeq platform (Illumina). Details of the RNA-seq experiments and data analysis will be presented elsewhere (J.D.N., I. Tekin and C.M., in preparation). Opsin RNA-seq mRNA levels were quantified as RPKM. RPKMs for each opsin were calculated independently and the average RPKMs are plotted. To knock-down plc21C expression, we combined each UAS–plc21C RNAi transgene (01210 and 01211) with UAS–Dicer2;;actin–Gal4. To quantify the efficacy of the RNAi, we extracted total RNA from ten adult flies (five male and five female), and used 1 μg total RNA from each sample as a template for reverse transcription using SuperScript III Reverse Transcriptase (ThermoFisher, cat. 18080093). Oligo dT primers were used for cDNA synthesis. cDNA preparation was subjected to quantitative PCR (Roche, LightCycler 480 system) according to the LightCycler 480 SYBR Green 1 Master Mix (cat. 04707516001) protocol. The plc21C primers used were: forward, GGATCTCTCCAAGTCGTTCG; reverse, TAGCCGCTTCACCAGCTTAT. The rp49 primers were: forward, GACGCTTCAAGGGACAGTATCTG; reverse, AAACGCGGTTCTGCATGAG. In each reaction, we normalized expression of plc21C transcripts to rp49. To obtain Rh7 antibodies, we generated a GST–Rh7 fusion protein by subcloning the region encoding the N-terminal 80 amino acids into the pGEX6P-1 vector (GE Healthcare Life Science). We expressed the fusion protein in Escherichia coli (BL21), purified the recombinant protein using glutathione sepharose beads (GE Healthcare Life Science) and generated antiserum in a rabbit (Covance). We affinity purified the antibodies by conjugating the antigen to Affi-Gel 10 (Bio-Rad). We performed immunohistochemistry using whole-mounted fly brains as described previously39. Briefly, we fixed dissected brains for 15–20 min at 4 °C in 4% paraformaldehyde in phosphate buffer (0.1 M Na PO , pH 7.4) with 0.3% Triton-X100 (Sigma), hereafter referred to as PBT. The brains were blocked with 5% normal goat serum (Sigma) in phosphate buffer for 1 h at 4 °C. We then incubated the tissue with primary antibodies at 4 °C for ≥24 h. After three washes in PBT, the brains were incubated overnight at 4 °C with the following secondary antibodies from Life Technologies: anti-mouse Alexa Fluor 488 or 568 Dyes, anti-rabbit Alexa Fluor 488 or 568 Dyes or Alexa dyes. The brains were washed three times with PBT and mounted in VECTASHIELD mounting medium (Vector Labs) for imaging. For Rh7 and PDF co-staining (Fig. 2d–i), four brains were examined. To analyse light-mediated degradation of Tim (Fig. 3c–f), we entrained the flies for 3 days under 12 h light–12 h dark cycles (~600 lx LED white light). The flies were then exposed to a 5-min LED light stimulation (~600 lx) at ZT22, kept in the dark for 55 min, fixed at ZT23 under a red photographic safety light (for 45 min), and dissected for whole-mount immunostaining. Flies that were not exposed to the nocturnal light treatment were fixed and stained at the same time. To examine Per staining at different ZT points (Extended Data Fig. 9), flies were entrained for 4 days under 12 h light (~400 lx)–12 h dark cycles, and were collected at the indicated ZTs. For nighttime samples, we handled the flies under a red photographic safety light. We prefixed whole flies at 4 °C with 4% paraformaldehyde in PBT for 45 min before dissecting out the brains. After the dissections, the brains were fixed again for 15–20 min at 4 °C in 4% paraformaldehyde in PBT. We used the following primary antibodies: anti-Rh7 (1:250, rabbit), anti-Per (1:1,000, guinea pig), anti-Tim (1:1,000, rat)40, anti-PDF (1:1,000, c7 mouse monoclonal antibody from the Developmental Studies Hybridoma Bank), anti-dsRed (1:500, mouse, Clontech Catalog #632392). The Per and Tim antibodies were contributed by A. Sehgal. The secondary antibodies (Thermo Fisher Scientific) were anti-rat Alexa Fluor 568 Dye and anti-guinea pig Alexa Fluor 555 Dye. We acquired the images using a Zeiss LSM 700 confocal microscope. To perform whole-mount staining of the retina, we dissected the retina (within the eye cup) and fixed the tissue at 4 °C in 4% paraformaldehyde in PBT for 20 min. After washing briefly in PBT, we blocked the retina for 1 h in PBT plus with 5% normal goat serum. We used the following primary antibodies: anti-Rh7 (1:250, rabbit), anti-Rh3 (1:200, mouse, gift from S. Britt, University of Colorado, Denver) and anti-Rh5 (1:200, mouse, gift from S. Britt, University of Colorado, Denver). The secondary antibodies were: anti-rabbit Alexa Fluor 568 Dye (1:1000) and anti-mouse Alexa Fluor 488 Dye (1:1000). Circadian experiments were performed at 25 °C using the Drosophila Activity Monitoring (DAM) System (Trikinetics). Individual 3–7-day-old male flies were loaded into monitoring tubes, which contained 1% agarose (Invitrogen) and 5% sucrose (Sigma) as the food source. The flies were entrained to 12 h light–12 h dark cycles for 4 days and released to constant darkness or constant light (10 lx for dim light conditions and 400 lx for bright light conditions, unless indicated otherwise) for at least six days to measure periodicity. Data collection and analyses were performed using Clocklab (Actimetrics). Activity data for each fly were binned every 30 min for the circadian analyses. To obtain the periodicities, data from constant darkness were subjected to χ2 periodograms and fast Fourier transfer analysis using Clocklab software. The rhythm strength of a fly was measured as the power minus the significance (p − s). Flies were considered arrhythmic based on either p − s < 10 or FFT < 0.03. Actograms of weakly rhythmic flies were visually inspected to confirm rhythmicity. To investigate the effects on activity of 5-min light pulses at night (Fig. 3a, b; Extended Data Figs 4, 10), we first entrained the flies for 3 days under 12 h light–12 h dark cycles (~600 lx LED white light). During the night of the fourth L–D cycle (at ZT14, ZT16, ZT18, ZT20 or ZT22), we exposed the flies to a single 5-min light pulse (LED white light, ~600 lx), and then maintained the flies under constant darkness. The phase shift was calculated as the phase difference of the evening peaks before and after the light pulse. Negative and positive phase changes indicate phase delays and phase advances, respectively. To conduct the phase delay experiments (Fig. 3g–l), we first entrained the flies for 4 days under 12 h light–12 h dark cycles (~400 lx LED white light). To obtain a phase delay of 8 h, on day 5 we extended the light phase to 20 h, and then returned the flies to normal 12 h dark–12 h light cycles. The phase shift magnitude was calculated as the phase difference between the evening peak of the day before the phase shift and the indicated day after the phase shift. To assess light-dependent arousal, we entrained the flies for 4 days under 12 h light–12 h dark cycles and then exposed the flies to a 5-min white light pulse (~600 lx LED lights) at ZT22. We binned the activity data for each fly every minute. ‘Light-coincident arousal’ is the increase in locomotion activity (bin-crosses) during the 5-min stimulation compared to the previous 5 min. ‘Arousal delay’ is the time between lights on and maximum activity. The HEK293T cells were obtained from the ATCC, which authenticates their lines. This line has not been tested for mycoplasma contamination. The HEK293T cells were cultured to 70% confluency and transfected with 2 μg pCS2+MT-rh7 plasmid per 10-cm dish. We used the FuGENE HD Transfection Reagent (Cat.E2311) to perform the transfections. Cells were harvested 24–36 h after transfection and stored at −80 °C. For reconstitution of Rh7 with the chromophore, the HEK293T cells were resuspended in cold PBS (pH 7.4, Quality Biological Inc.) supplemented with a protease inhibitor cocktail (Sigma P8340) and incubated with 40 μM 11-cis-retinal in the dark for 4 h. We prepared membrane protein extracts by resuspending membrane pellets in 0.1% CHAPs in PBS, rotating for 2 h at 4 °C, then centrifuging (14,000g) for 20 min at 4 °C. The supernatants were removed and analysed with a UV3600 UV-Nir-NIR Spectrometer (Shimadzu). To obtain the spectral absorption for Rh7, we used membrane extracts from untransfected cells as the blank. ERG recordings were performed by filling two glass electrodes with Drosophila Ringer’s solution (3 mM CaCl , 182 mM KCl, 46 mM NaCl, 10 mM Tris pH 7.2) and placing small droplets of electrode cream on the surface of the compound eye and the thorax to increase conductance. We inserted the recording electrode into the cream on the surface of the compound eye and the reference electrode into the cream on the thorax. Flies were dark adapted for 1 min before stimulating with a 2-s pulse using a halogen light (~30 mV/cm2 unless indicated otherwise). The ERG signals were amplified with a Warner electrometer and recorded with a Powerlab 4/30 analogue-to-digital converter (AD Instruments). Data were collected and analysed with the Laboratory Chart version 6.1 program (AD Instruments). Patch-clamp measurements were performed on acutely dissected adult fly brains as described previously18, 19. Briefly, all patch-clamp recordings were performed during the daytime to avoid clock-dependent variance in firing rate. All l-LNvs were recorded within a relatively narrow daytime window, and recordings for each genotype were normally distributed for the time of day and did not vary significantly among all three genotypes. l-LNv recordings were made in whole-cell current clamp mode. After allowing the membrane properties to stabilize after whole cell break-in, we recorded for 30–60 s in the current clamp configuration (unless otherwise stated) under nearly dark conditions (~0.05 mW/cm2) before the lights were turned on. Lights-on data were collected for 5–20 s and this was followed by 60–120 s of darkness. Multiple light sources were used for these studies. We used a standard halogen light source on an Olympus BX51 WI microscope (Olympus USA) for all experiments with white light (400–1,000 nm, 4 mW/cm2). Orange light (550–1,000 nm; 4 mW/cm2) for electrophysiological recordings was achieved by placing appropriate combinations of 25 mm long- and short-pass filters (Edmund Industrial Optics) over the halogen light source directly beneath the recording chamber. We changed the filters during the recordings to internally match the neuronal responses to different wavelengths of light. Recordings using 405 nm violet light (0.8 mW/cm2) were obtained using LEDs obtained from Prizmatix 405 LED (UHP-Mic-LED-405), which provide >2 W collimated purple light (405 nm peak, 15 nm spectrum half width). Light was measured for all sources using a Newport 818-UV sensor and the Optical Power/Energy Meter (842-PE, Newport Corporation) and expressed as mW/cm2. The control genotype for the electrophysiological recordings was w;pdf-Gal4-dORK-NC1-GFP. The cry01 and rh71 recordings were performed using w;pdf-Gal4-dORK-NC1-GFP;cry01 and w;pdf-Gal4-dORK-NC1-GFP; rh71, respectively. To analyse two sets of data, we used the unpaired Student’s t-test. To compare multiple sets of behavioural data, we used a one-away ANOVA (Kruskal–Wallis test) followed by Dunn’s test. Data are presented as mean ± s.e.m. We used Fisher’s exact test to analyse the percentages of rhythmic flies. For the patch-clamp recordings, the data are presented as mean ± s.e.m. Values of n refer to the number of measured light on–off cycles. In all cases the n values were obtained from at least 5 separate recordings (see legends). ANOVAs were performed using SigmaPlot 11 (Systat Software Inc.) or Prism 6 (Graphpad Software). The data were first tested for normal distribution. If the data were not normally distributed, we performed Kruskal–Wallis one way analysis of variance on ranks, followed by Dunn’s test. ANOVAs on normally distributed data were followed by Tukey’s test to determine significant differences between genotypes. All data are available from the corresponding author upon reasonable request.

Loading ATCC collaborators
Loading ATCC collaborators