Belfast, United Kingdom
Belfast, United Kingdom

Andor Technology Ltd is a developer and manufacturer of high performance light measuring solutions . It became a subsidiary of Oxford Instruments after it was purchased for £176m in December 2013.Andor Technology was set up by its founders, Dr. Hugh Cormican, Dr. Donal Denvir and Mr. Mike Pringle in the mid-1980s. While studying at Queen's University Belfast, they "used their physics know-how to build a highly sensitive digital camera...as a tool for their laser research." They subsequently set up Andor Technology to develop it into a commercial product for use in scientific research.Andor Technology Ltd was established in 1989, as a spin out from Queen's University, Belfast. In December 2004 the company became a PLC when it listed on the Alternative Investment Market of the London Stock Exchange.The company is based in Belfast, Northern Ireland, and it designs and manufactures and sells scientific imaging equipment including charge-coupled device , electron-multiplying CCD and Intensified charge-coupled device camera systems, spectroscopy instrumentation, and microscopy systems. The cameras can be used for low light imaging, spectroscopy, X-ray, time resolved, and microscopy studies and have a wide range of users including physicists, biologists, life scientists, geneticists and nano-technologists all around the world.Andor introduced its first EMCCD camera, the DV 465 in 2001 and the company was awarded The Photonics Circle of Excellence Awards from Laurin Publishing, which recognizes the 25 Most Technically Innovative New Products of the Year.EMCCD is based on a CCD chip that incorporates electron multiplication, or EMCCD technology. It is used in fields such as drug discovery, where scientists need to watch vats of chemicals in real time, astrophysics, and oceanography.In June 2010, Andor Technology announced a profits rise by 87%. Wikipedia.


Time filter

Source Type

Grant
Agency: Cordis | Branch: FP7 | Program: CP-FP | Phase: HEALTH-2009-1.2-1 | Award Amount: 2.34M | Year: 2010

Since the histopathological diagnosis of tumours is based on microscopy, it would be highly desirable to possess a microscopical technique allowing morphological investigation with a wide zoom range, high resolution and the implementation of multiplex staining. Thus, the goal of the REMEDI project is to explore the possibilites of novel light microscopy techniques, which overcome the diffraction limit of visible light and extend the range of observation to the molecular level of proteins in tumour cells and analyze their interaction and spatial distribution. This proposal aims at the use of single-molecule-microscopy of cancer tissue samples with ultra-high sensitivity, simplified handling and increased speed of analysis. This shall be accomplished by the development of a novel resolution-enhanced microscopy platform with an integrated novel CMOS camera and an adequate image acquistion and analysis software. The REMEDI platform will be validated with two relevant applications: diagnostic/experimental pathology of breast cancer and alterations of plasma membrane components of lymphoma cells.


Grant
Agency: Cordis | Branch: FP7 | Program: CP | Phase: INFRA-2007-2.1-01 | Award Amount: 6.78M | Year: 2008

This is the project definition for the Conceptual Design Study of the large aperture European Solar Telescope (EST). EST is a pan-European project involving 29 partners from 14 different countries. A consortium EAST (European Association for Solar Telescopes) exists with the aim, among others, of undertaking the development of EST, to keep Europe in the frontier of Solar Physics in the world. EST will be optimised for studies of magnetic coupling between the deep photosphere and upper chromosphere. This will require diagnostics of the thermal, dynamic and magnetic properties of the plasma over many scale heights, by using multiple wavelength imaging, spectroscopy and spectropolarimetry. The EST design will strongly emphasise the use of a large number of visible and near-infrared instruments simultaneously, thereby improving photon efficiency and diagnostic capabilities relative to other existing or proposed ground-based or space-borne solar telescopes. To achieve these goals, EST must specialise in high spatial and temporal resolution using instruments that can efficiently produce two-dimensional spectral information. The study aims at demonstrating the scientific, technical and financial feasibility of EST. It includes key aspects needed for a conceptual design of the whole telescope, such as optomechanical design, cooling mechanisms, adaptive optics, instrumentation and control. Different existing alternatives will be analysed for all systems and subsystems, with decisions taken on the most adequate ones that are compatible with the scientific goals and the technical strategies. Technical specifications will be given at the end of the Design Study for all systems and subsystems.


News Article | August 24, 2016
Site: www.nature.com

All in vitro experiments used C57BL/6 mice younger than 5 weeks old, except for adult DRG temperature threshold experiments (for example, Fig. 1c, d), in which 3-month-old adult mice were used (these mice were from the same group as was used for two-plate thermal preference tests experiments, see Fig. 3). Trpm2−/− mice were gifts from Y. Mori, and were generated as reported previously27, 28. Mice were maintained on a 12 h day/12 h night cycle. All mice used in two-plate thermal preference tests had been backcrossed onto the parental C57Bl6/6J strain for 7 generations, and wild-type and Trpm2−/− mice were littermates from breeding pairs of Trpm2+/− heterozygote mice. PPG, SCG and paravertebral chain ganglia were extracted from 3 or more mice and DRG from a single mouse. Ganglia were incubated in papain (2 mg ml−1 in Ca2+-free and Mg2+-free HBSS) for 30 min at 30 °C, followed by incubation in collagenase (2.5 mg ml−1 in Ca2+-free and Mg2+-free HBSS) for 30 min at 37 °C. Ganglia were re-suspended and mechanically dissociated in Neurobasal-A/B27 growing medium, which was prepared with Neurobasal-A Medium supplemented with 0.25% (v/v) l-glutamine 200 mM (Invitrogen), 2% (v/v) B-27 supplement (Invitrogen), 1% (v/v) penicillin-streptomycin (Invitrogen), and nerve growth factor (NGF) (Sigma-Aldrich) at 50 ng ml−1. Dissociated neurons were centrifuged and plated onto coverslips pre-coated with poly- l-lysine (10 μg ml−1) and laminin (40 μg ml−1). Neurons were kept in a 37 °C incubator with a 95% air / 5% CO atmosphere for at least 3 h before use, and all neurons were used within 24 h. The growth medium used for PC12 cell culture was RPMI-1640 (Sigma-Aldrich), supplemented with: 1% (v/v) penicillin-streptomycin (Invitrogen), 1% (v/v) L-glutamine 200 mM (Invitrogen), 10% (v/v) horse serum (Invitrogen) and 5% (v/v) fetal bovine serum (FBS, Invitrogen). The differentiation medium for PC12 cells was RPMI-1640 supplemented with: 1% (v/v) penicillin-streptomycin (Invitrogen), 1% (v/v) l-glutamine-200 mM (Invitrogen), 1% (v/v) horse serum (Invitrogen), and NGF (Sigma-Aldrich) with final concentration at 100 ng ml−1. PC12 cells were incubated and maintained in a 37 °C incubator with a 95% air / 5% CO atmosphere. Medium was changed every 2 days, and cells were split every 3–4 days when grown to 90% confluency. The PC12 cells were seeded for imaging on coverslips pre-coated with poly-l-lysine (1 mg ml−1; Sigma-Aldrich) and collagen IV (1 mg ml−1; Sigma-Aldrich). PC12 cell lines were not authenticated and were not tested for mycoplasma contamination. MAH cells were kind gifts from A. Tolkovsky and S. Birren18. The growth medium used for MAH cell culture was L-15 medium (Sigma-Aldrich) supplemented with: 1% (v/v) penicillin-streptomycin (Invitrogen), 1% (v/v) l-glutamine 200 mM (Invitrogen), 10% (v/v) fetal bovine serum (FBS, Invitrogen), 17% (v/v) NaHCO (150 mM), and dexamethasone (Sigma-Aldrich) at 5 μM. The differentiation medium for MAH cells was the same as the growth medium except dexamethasone was replaced with a cocktail of neurotrophic factors: CNTF (10 ng ml−1; Peprotech), bFGF (10 ng ml−1; Peprotech), and NGF (50 ng ml−1; Sigma-Aldrich). Medium was changed every 2 days and MAH cells were split every 4 days when grown to 90% confluency and incubated and maintained in a 37 °C incubator with a 95% air / 5% CO atmosphere. MAH cells used for imaging were seeded on coverslips pre-coated with poly-l-lysine (1 mg ml−1; Sigma-Aldrich) and laminin (40 μg ml−1; BD Science). MAH cell lines were not authenticated and were not tested for mycoplasma contamination. Unless otherwise specified, all experiments were carried out with extracellular solution containing 140 mM NaCl, 4 mM KCl, 1.8 mM CaCl , 1 mM MgCl , 10 mM HEPES and 5 mM glucose; pH was adjusted to 7.4 with NaOH and osmolarity was between 295–305 mOsm. Sodium-free extracellular solution is prepared with the formulation above except for replacing sodium chloride with equimolar choline chloride. Calcium-free extracellular solution is prepared with the formulation above except for removal of calcium chloride. An 8-line manifold gravity-driven system controlled by an automated solution changer with a common outlet was used to apply solution to the cells. The temperature in three lines was heated or cooled with a Peltier device regulated by a proportional gain feedback controller designed by V. Vellani (CV Scientific). The temperature in each experimental protocol was recorded by a miniature thermocouple immediately before the solution entered the bath or (in separate control experiments) at the cell location at the tip of the solution outlet. All compounds applied were prepared as stock solutions first and then diluted to the concentration needed before experiments. Capsaicin was dissolved in ethanol to make 5 mM stock solutions. Pregnenolone sulphate was dissolved in DMSO to make 500 mM stock solutions. 2-APB was dissolved in DMSO to make 500 mM stock solutions. The TRPV4 agonist, PF-4674114, was dissolved in DMSO to make 5 mM stock solutions. Nifedipine was dissolved in DMSO to make 100 mM stock solutions. TTX was dissolved in pH 4.8 citrate buffer to make 100 mM stock solutions. Verapamil, ruthenium red, and H O were dissolved in extracellular solution on the day of experiments. Cells were loaded with 5 μM fura-2 AM (Invitrogen) with 0.02% (v/v) pluronic acid (Invitrogen) for 30 min. After loading, coverslips were put in an imaging chamber and transferred to a Nikon Eclipse Ti-E inverted microscope. Cells were continuously perfused with extracellular solution and were illuminated with a monochromator alternating between 340 and 380 nm (OptoScan; Cairn Research), controlled by WinFluor 3.2 software (J. Dempster, University of Strathclyde, UK). Emission was collected at 510 nm and the resulting pairs of images were acquired every two seconds with a 100 ms exposure time using an iXon 897 EM-CCD camera (Andor Technology, Belfast, UK). Image time series were converted to TIFF files and processed with ImageJ software. Images of the background fluorescence intensity were obtained for both wavelengths and subtracted from the respective image stack before calculating the F ratio images. A minority of neurons (<10%) exhibited an unstable F baseline in the absence of any applied stimulus, usually caused by poor dye loading but in some cases apparently due to low-frequency repetitive firing even in the absence of any treatment, and were removed from analysis. In experiments to identify neurons responding to known TRP channel agonists (Fig. 1a), we found that PS caused a very slow increase in F ratio in some neurons, clearly distinguishable from the rapid elevation in [Ca] seen in TRPM3-expressing DRG neurons. This slow response can probably be attributed to an off-target effect of PS as it was also seen in autonomic neurons which do not appear to express TRPM3 (Fig. 2). A positive response to all agonists was therefore defined from the rate of increase of [Ca] following agonist application, as an increase of F ratio, between two consecutive time points following application of agonist, which exceeds the mean + 3.09 s.d. (cumulative probability value of 99.9%) of all such differences in the absence of any agonist. A heat-sensitive neuron is defined as a neuron with a peak increase in F during a heat stimulus larger than the mean + 3.09 s.d. of the peak increase in F of the glial cells in the same experiment (see Extended Data Fig. 1b). The thermal threshold of a heat-responsive neuron (see Fig. 1d, e) was defined as the temperature when the increase in F ratio between two consecutive time points is larger than the mean + 3.09 s.d. of the increase in F of the glial cells between two consecutive time points in the same experiment. For MAH and PC12 cell cultures, where no glial cells were present, we used the value of mean + 3.09 s.d. obtained from glial cells in similar experiments on neuronal cultures. Supplementary Information Video 1 shows an example series of calcium images. The intracellular solution for concurrent calcium imaging and patch clamp (see Fig. 2b) contained 140 mM KCl, 1.6 mM MgCl , 2.5 mM MgATP, 0.5 mM NaGTP, 10 mM HEPES and 167 μM fura-2; pH was adjusted to 7.3 with KOH. The intracellular solution for current-voltage relationship determination, in which Ca2+ and K+ currents were blocked (see Fig. 2c), contained 130 mM CsCl, 2.5 mM MgATP, 0.5 mM NaGTP, 10 mM HEPES, 10 mM TEA, and 5 mM 4-AP; pH was adjusted to 7.3 with CsOH. The osmolarity of both of the intracellular solutions was between 295–305 mOsm. The extracellular solution for current–voltage relationship determination contained 125 mM NaCl, 2 mM CaCl , 10 mM HEPES and 5 mM glucose, 10 mM TEA, 5 mM 4-AP, 2 μM tetrodotoxin, and 100 μM CdCl . All patch clamp experiments were carried out with an Axopatch 200B patch-clamp amplifier (Axon Instrument, USA). Patch pipettes (Blaubrand 100 μl borosilicate glass, Scientific Laboratory Supplies, Germany) were pulled using a Flaming/Brown P-97 horizontal micropipette puller (Sutter Instruments, USA) and had a resistance between 3 and 5.5 MΩ. A giga-ohm seal was formed between the patch pipette and the cell membrane and the pipette capacitance transients were cancelled before achieving the whole cell configuration. All experiments were begun in voltage clamp mode with holding potential at −60 mV at the time of entering whole cell mode. After entering the whole-cell mode, series resistance was adjusted to be lower than 20 mega-ohm. Resting membrane potential was tested and only neurons with membrane potentials more negative than −50 mV were used for recording. Data were acquired and analysed with pClamp10 software (Axon Instruments, USA) and whole cell currents and voltages were filtered at 1 kHz and sampled at 10 kHz. MAH cells were trypsinized and collected as a cell pellet before lysis. RNA extraction was performed with the miRNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. Two samples from MAH cells grown in growth medium and 2 samples from MAH cells grown in differentiation medium were sent to Oxford Gene Technology to complete the rest of the steps for RNA-sequencing. Sequencing libraries were prepared with the Illumina TruSeq RNA Sample Prep Kit v2. A total of 4 samples (two cold-sensitive MAH cells and two cold-insensitive MAH cells) were sequenced on 2 lanes on the Illumina HiSeq2000 platform using TruSeq v3 chemistry. All sequences were paired-end and sequencing was performed over 100 cycles. Read files (Fastq) were generated from the sequencing platform via the manufacturer’s proprietary software. Reads were processed through the Tuxedo suite. Reads were mapped to their location to the appropriate Illumina iGenomes build using Bowtie version 2.02. Splice junctions were identified using TopHat, version v2.0.9. Cufflinks version 2.1.1 was used to perform transcript assembly, abundance estimation and differential expression and regulation for the samples. Visualization of differential expression results were performed with CummeRbund. RNA-seq alignment metrics were generated with Picard. Coverslips were marked on the periphery with a diamond knife to assist localization of the imaged region and were then calcium-imaged as above to identify novel heat-sensitive neurons. Following calcium imaging, coverslips were rinsed with phosphate-buffered saline (PBS) then fixed in 4% paraformaldehyde (PFA) at 4 °C for 20 min. TRPM2 mRNA was detected with digoxigenin-labelled antisense probes against mouse Trpm2 (NM_138301.2). We are very grateful to Y. Mori of Kyoto University for providing the mouse Trpm2 gene cloned into the pCI-neo plasmid (Promega). For the Trpm2 antisense probe the plasmid was linearized with EcoRI and transcribed with T3 RNA polymerase and for the Trpm2 sense probe, which was used as a negative control, the plasmid was linearized with SalI and transcribed with T7 RNA polymerase. Fixed coverslips were rinsed in PBS with 0.1% Triton, and were then incubated in in situ hybridization solution without probe at 47 °C for 30 min as pre-hybridization step. After pre-hybridization, coverslips were transferred into in situ hybridization solution with antisense or sense probes for hybridization at 47 °C overnight29. Following hybridization coverslips were washed in 2× SSC and then 0.2× SSC at 47 °C for 30 min for each solution. Coverslips were then washed twice with KTBT solution at room temperature for 5 min for each washing. 25% normal goat serum was then used for blocking cells for 1 h at room temperature. Coverslips were then incubated in 25% normal goat serum containing pre-absorbed anti-digoxygenin antibody coupled to alkaline phosphatase for 2 h at room temperature, followed by washing 3× in KTBT for 15 min each wash, and then twice in alkaline phosphatase buffer at room temperature for 10 min each wash. Coverslips were then developed in alkaline phosphatase buffer containing 337.5 μg ml−1 NBT and 175 μg ml−1 BCIP in the dark for 8 h before being washed in KTBT, fixed in 4% PFA for 10 min, washed in PBS, and then mounted in SlowFade Gold Antifade Mountant with DAPI29. DIC transmitted-light images were acquired through a Plan Fluor 10× Ph1 DLL objective with a DS-Qi2 monochrome camera on a Nikon Eclipse Ti-E inverted microscope. A GFPHQ filter was used to enhance the dark purple colour. The images were rotated, cropped, and resized with ImageJ to be aligned with the images obtained in calcium imaging. DRG neurons on marked coverslips were calcium imaged as above then rinsed with phosphate-buffered saline (PBS) and fixed in 4% paraformaldehyde (PFA) at 4 °C for 20 min. After fixation, coverslips were washed twice in PBS with 0.1% Triton then incubated in solution containing 10 μg ml−1 IB4 bound to Alexa Fluor 594, 10% normal goat serum, 2% bovine serum albumin, 0.1% Triton, and 10 mM sodium azide for 1 h at room temperature followed by washing with PBS three times. DIC transmitted-light images were acquired through a Plan Fluor 10× Ph1 DLL objective with a DS-Qi2 monochrome camera on a Nikon Eclipse Ti-E inverted microscope. A Texas Red HYQ filter was used to capture the Alexa 594 signal. The images obtained were rotated, cropped, and resized with ImageJ to be aligned with the images obtained in calcium imaging. To eliminate as far as possible any extraneous genetic influences the Trpm2−/− mice were backcrossed onto the parental C57Bl6/6J line for 7 generations27, 28. To minimize environmental effects, wild-type and Trpm2−/− littermates from heterozygous matings were compared in behavioural experiments. Sample size to achieve significance was determined from trial experiments but no power analysis was performed. All mice were tested at all temperatures so no randomization of experimental groups was necessary (see Fig. 3 legend). We used a two-plate thermal preference test (BioSeb, France) with one plate maintained at a temperature of 33 °C, which other studies have shown is the preferred temperature11, and the other at a variable temperature. The temperatures of test and control plates were reversed after 30 min to control for any influence of environmental cues. Other studies have observed sex differences in mouse thermal behaviour12 so we followed other authors5, 11 in using only adult males (10–16 weeks old) in behavioural experiments. Two hot/cold-plate machines (Bioseb, France), placed back to back, formed the two-plate thermal apparatus. Plates were enclosed in a plexiglass chamber divided into two lanes, with an opaque compartment between them, and two mice were tested simultaneously in adjacent lanes (see Supplementary Information Video 2). The temperature of each plate was controlled by T2CT software (Bioseb, France). Plate temperatures were tested with an infrared thermometer (Bioseb) and were found to be accurately controlled to within 0.2 °C of the command temperature over the entire plate area. One plate was maintained at the preferred temperature of 33 °C, and mice were initially placed onto the plate with starting temperature other than 33 °C (‘plate A’, see Fig. 3) before initiating recording. The movements of the mice between the two plates were recorded for 3,495 s without human presence and the mouse position was determined with an automated video tracking system (Bioseb), so operator blinding was not necessary. The temperatures of the two plates were exchanged 1,800 s after initiation of recording; plate temperature settled to within 0.2 °C of the new temperature within 180 s of the change. Experiments were performed between 8 a.m. and 10 p.m., with room temperature at 20 °C. For experiments testing thermal preference between the two mildest temperatures, 28 °C versus 33 °C and 33 °C versus 38 °C, mice were tested again, with the starting temperatures of the two plates exchanged, 3–5 h after the first recording. For other temperatures recordings were made only once on a particular mouse. Mice were tested with the protocols, in order, of 28 °C versus 33 °C, 33 °C versus 38 °C, 23 °C versus 33 °C and 33 °C versus 43 °C. Sample size was based on pilot experiments. When making statistical comparisons variances were checked to ensure that it was similar between groups being compared. All animal experiments were approved by the Animal Welfare and Ethical Review Body (AWERB), King’s College London. Supplementary Information Video 2 shows an example of a thermal-choice behavioural experiment. All data are expressed as means ± s.e.m. Analyses were performed with GraphPad Prism version 6.01 or SigmaPlot 11.0. The particular statistical test used is stated either in the text or figure legends. Biological replicates are stated in the legends for each figure. Given the nature of these experiments, technical replicates were not possible.


Filipin III was from Sigma. Amplex Red cholesterol assay kit was from Invitrogen. IL-2 was from Promega. For the flow cytometric analysis, anti-mCD4 (RM4-5), anti-mCD8 (53-6.7), anti-mCD3ε (145-2C11), anti-IFNγ (XMG1.2), anti-TNFα (MP6-XT22), anti-granzyme B (NGZB), anti-CD44 (IM7), anti-CD69 (H1.2F3), anti-PD-1 (J43), anti-CTLA-4 (UC10-4B9), anti-Ki-67 (16A8), anti-FoxP3 (FJK-16 s), anti-Gr1 (RB6-8C5), anti-CD11b (M1/70) and anti-CD45 (30-F11) were purchased from eBioscience. For western blots, anti-pCD3ζ, anti-CD3ζ, anti-pZAP70, anti-ZAP70, anti-pLAT, anti-LAT, anti-pERK1/2 and anti-ERK1/2 were from Cell Signaling Technology. Avasimibe was from Selleck. MβCD-cholesterol and MβCD were from Sigma. Lovastatin was from Sigma. U18666A was from Merck. K604 was chemically synthesized in F.-J. Nan’s laboratory. CP113,818 was a research gift from P. Fabre. MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was from Promega. B16F10, Lewis lung carcinoma and EL-4 cell lines were originally obtained from the American Type Culture Collection, and proved mycoplasma-free. Listeria monocytogenes was provided by Q. Leng. C57BL/6 mice were purchased from SLAC. OT-I TCR transgenic mice were from the Jackson Laboratory. CD4cre transgenic mice was described previously31. InGeneious Labs produced homozygous Acat1flox/flox mouse. To produce this mouse, the Acat1 loxP construct was made by inserting two loxP sites covering Acat1 exon 14, which includes His460 known to be essential for the enzymatic activity32. The construct was injected into embryonic stem cells. The correctly targeted clones as determined by Southern blot and diagnostic PCR were injected into C57BL/6 blastocysts. To remove the Neo marker, the mice were further backcrossed to the C57BL/6 Frt mice. Through mouse crossing, the wild-type Acat1 allele (Acat1+/+), heterozygous Acat1 loxP allele (Acat1flox/+) and homozygous Acat1 loxP allele (Acat1flox/flox) were obtained and confirmed by using diagnostic PCR. Acat1flox/flox mice were crossed with CD4cre transgenic mice to get Acat1CKO mice with ACAT1 deficiency in T cells. Acat1CKO mice were further crossed with OT-I TCR transgenic mice to get Acat1CKO OT-I mice. Animal experiments using Acat1CKO mice were controlled by their littermates with normal ACAT1 expression (Acat1flox/flox). Animal experiments using Acat1CKO OT-I mice were controlled by their littermate with normal ACAT1 and OT-I TCR expression (Acat1flox/flox OT-I). Acat2−/− mice were purchased from Jackson Laboratory. All mice were maintained in pathogen-free facilities at the Institute of Biochemistry and Cell Biology. All animal experiments used mice with matched age and sex. Animals were randomly allocated to experimental groups. The animal experiments performed with a blinded manner were described below. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. The maximal tumour measurements/volumes are in accordance with the IACUC. All human studies have been approved by the Research Ethical Committee from ChangZheng Hospital, Shanghai, China. Informed consent was obtained from all study subjects. Total RNA was extracted with Trizol (Life technology) from the indicated cells and subjected to quantitative reverse transcription PCR (qRT–PCR) using gene specific primers (5′–3′): Acat1 (forward, GAAACCGGCTGTCAAAATCTGG; reverse, TGTGACCATTTCTGTATGTGTCC); Acat2 (forward, ACAAGACAGACCTCTTCCCTC; reverse, ATGGTTCGGAAATGTTCACC); Nceh (forward, TTGAATACAGGCTAGTCCCACA; reverse, CAACGTAGGTAAACTGTTGTCCC); Srebp1 (forward, GCAGCCACCATCTAGCCTG; reverse, CAGCAGTGAGTCTGCCTTGAT); Srebp2 (forward, GCAGCAACGGGACCATTCT; reverse, CCCCATGACTAAGTCCTTCAACT); Acaca (forward, ATGGGCGGAATGGTCTCTTTC; reverse, TGGGGACCTTGTCTTCATCAT); Fasn (forward, GGAGGTGGTGATAGCCGGTAT; reverse, TGGGTAATCCATAGAGCCCAG); Hmgcs (forward, AACTGGTGCAGAAATCTCTAGC; reverse, GGTTGAATAGCTCAGAACTAGCC); Hmgcr (forward, AGCTTGCCCGAATTGTATGTG; reverse, TCTGTTGTGAACCATGTGACTTC); Sqle (forward, ATAAGAAATGCGGGGATGTCAC; reverse, ATATCCGAGAAGGCAGCGAAC); Ldlr (forward, TGACTCAGACGAACAAGGCTG, reverse, ATCTAGGCAATCTCGGTCTCC); Idol (forward, TGCAGGCGTCTAGGGATCAT; reverse, GTTTAAGGCGGTAAGGTGCCA); Abca1 (forward, AAAACCGCAGACATCCTTCAG; reverse, CATACCGAAACTCGTTCACCC); Abcg1 (forward, CTTTCCTACTCTGTACCCGAGG; reverse, CGGGGCATTCCATTGATAAGG); Ifng (forward, ATGAACGCTACACACTGCATC; reverse, CCATCCTTTTGCCAGTTCCTC). Three methods were used to measure the cholesterol level of T cells. Filipin III was dissolved in ethanol to reach the final concentration of 5 mg ml−1. Cells were fixed with 4% paraformaldehyde (PFA) and stained with 50 μg ml−1 filipin III for 30 min at 4 °C. Images were collected using a Leica SP8 confocal microscope and analysed using a Leica LAS AF software. The total cellular cholesterol level was quantified using the Amplex Red cholesterol assay kit (Invitrogen). To quantify the intracellular cholesterol, CD8+ T cells were fixed with 0.1% glutaraldehyde and then treated with 2 U ml−1 cholesterol oxidase for 15 min to oxidize the plasma membrane cholesterol. The intracellular cholesterol was then extracted with methanol/chloroform (vol/vol, 1: 2), and quantified using the Amplex Red cholesterol assay kit. The value of the plasma membrane cholesterol was obtained by subtracting the intracellular cholesterol from the total cellular cholesterol. Plasma membrane cholesterol level was measured as previously described33. The plasma membrane of CD8+ T cells was biotinylated by 1 mg ml−1 sulfo-NHS-S-biotin, and then the cells were lysed by passing 13 times through a ball-bearing homogenizer. Plasma membrane was isolated from the supernatant of homogenate by streptavidin magnetic beads. Lipids were extracted with hexane/isopropanol (vol/vol, 3: 2), and then were used for measurement of unesterified cholesterol with Amplex Red Cholesterol Assay Kit and choline-containing phospholipids with EnzyChrom Phospholipid Assay Kit. The relative plasma membrane cholesterol level was normalized to the total phospholipids. To deplete cholesterol from the plasma membrane, CD8+ T cells were treated with 0.1–1 mM MβCD for 5 min at 37 °C, and then washed three times with PBS. To add cholesterol to the plasma membrane, CD8+ T cells were incubated with the culture medium supplied with 1–20 μg ml−1 MβCD-coated cholesterol at 37 °C for 15 min. The cells were then washed three times with PBS. Peripheral T cells were isolated from mouse spleen and draining lymph nodes by a CD8+ or CD4+ T-cell negative selection kit (Stem cell). To analyse the tumour-infiltrating T cells, tumours were first digested by collagenase IV (sigma), and tumour-infiltrating leukocytes were isolated by 40–70% Percoll (GE) gradient centrifugation. To measure the effector function of CD8+ T cells, the isolated cells were first stimulated with 1 μM ionomycin and 50 ng ml−1 phorbol 12-myristate 13-acetate (PMA) for 4 h in the presence of 5 μg ml−1 BFA, and then stained with PERCP-conjugated anti-CD8a. Next, cells were fixed with 4% PFA and stained with FITC-conjugated anti-granzyme B, allophycocyanin (APC)-conjugated anti-IFNγ and phycoerythrin (PE)-conjugated anti-TNFα. In general, to gate the cytokine or granule-producing cells, T cells without stimulation or stained with isotype control antibody were used as negative controls. This gating strategy is applicable for most of the flow cytometric analyses. To detect the MDSC cells in the tumour, the Percoll-isolated leukocyte were stained with anti-CD45, anti-CD11b and anti-Ly6G (Gr1), the CD45+ population was gated, after which the MDSC population (CD11b+ Gr1+) in CD45+ were gated. A pan T-cell isolation kit (Miltenyi biotech) was used to deplete T cells from splenocytes isolated from C57BL/6 mice. The T-cell-depleted splenocytes were pulsed with antigenic peptides for 2 h and washed three times. SIINFEKL (OVA or N4), SAINFEKL (A2), SIITFEKL (T4), SIIGFEKL (G4) are four types of agonist antigens with strong to weak TCR affinities. RTYTYEKL (Catnb) is a self-antigen of OT-I TCR. SIIRFEKL (R4) supports the positive selection of OT-I T cells and thus mimics a self-antigen. The T-cell-depleted and antigen-pulsed splenocytes were co-incubated with Acat1CKO OT-I T cells or wild-type OT-I T cells for 24 h. Cytokine production of CD8+ T cells was measured by intracellular staining and flow cytometric analysis. To generate mature CTLs, splenocytes isolated from Acat1CKO OT-I mice or wild-type OT-I mice were stimulated with OVA (N4) for 3 days in the presence of 10 ng ml−1 IL-2. Cells were centrifuged and cultured in fresh medium containing 10 ng ml−1 IL-2 for 2 more days, after which most of the cells in the culture were CTLs. To measure CD8+ T-cell cytotoxicity, EL-4 cells were pulsed with 2 nM antigenic peptide (N4, A2, T4, G4, R4 or Catnb) for 30 min. After washing EL-4 cells and CTLs three times with PBS, we mixed CTLs and antigen-pulsed EL-4 cells (1 × 105) in the killing medium (phenol-free RPMI 1640, 2% FBS), at the ratios of 1:1, 2:1 and 5:1, respectively. After 4 h, the cytotoxic efficiency was measured by quantifying the release of endogenous lactate dehydrogenase (LDH) from EL-4 cells using a CytoTox 96 Non-Radioactive Cytotoxicity kit (Promega). Human peripheral blood mononuclear cells from healthy donators were stimulated with 5 μg ml−1 phytohaemagglutinin (Sigma) for 2 days and then rested for 1 day. Cells were pretreated with vehicle (DMSO), CP113,818 or avasimibe for 12 h and then stimulated with 5 μg ml−1 plate-bound anti-CD3 and anti-CD28 antibodies for 24 h. Intracellular staining and flow cytometry were used to measure cytokine productions of CD8+ T cells. Oxygen consumption rates and extracellular acidification rates were measured in nonbuffered DMEM (sigma) containing either 25 mM or 10 mM glucose, 2 mM l-glutamine, and 1 mM sodium pyruvate, under basal conditions and in response to 1 μM oligomycin (to block ATP synthesis), 1.5 μM FCCP (to uncouple ATP synthesis from the electron transport chain), 0.5 μM rotenone and antimycin A (to block complex I and III of the electron transport chain, respectively), and 200 μM etomoxir (to block mitochondrial fatty acid oxidation) on the XF-24 or XF-96 Extracellular Flux Analyzers (Seahorse Bioscience) according to the manufacturer’s recommendations. B16F10 cells (5 × 103) in 100 μl media containing avasimibe or DMSO were cultured for 24, 48 or 72 h. MTS reagent (20 μl) (CellTiter 96 AQueous One Solution Cell Proliferation Assay, Promega) was added into each well. After a 2–3-h incubation, the absorbance at 490 nm was measured. The effect of avasimibe on cell viability was obtained by normalizing the absorbance of avasimibe-treated cells with that of the DMSO-treated cells. The viability value of DMSO-treated cells was set as 1. L. monocytogenes (2 × 104–7 × 104 colony-forming units (CFU)) expressing a truncated OVA protein were intravenously injected into Acat1CKO and littermate wild-type mice aged 8–10 weeks. On day 6, T cells isolated from spleens were stimulated with 50 ng ml−1 PMA and 1 μM ionomycin for 4 h in the presence of brefeldin A and then assessed by flow cytometry to detect IFNγ production. At the same time, the serum IFNγ level was assessed by ELISA. To detect the antigen-specific response of CD8+ T cells, the splenocytes were stimulated with 1 μM OVA peptide for 24 h. IFNγ production was analysed as mentioned above. To detect the L. monocytogens titre in the livers of infected mice, the livers were homogenized in 10 ml 0.2% (vol/vol) Nonidet P-40 in PBS, and the organ homogenates were diluted and plated on agar plates to determine the CFU of L. monocytogenes. Investigator was blinded to group allocation during the experiment and when assessing the outcome. B16F10 cells were washed three times with PBS, and filtered through a 40-μm strainer. In a skin melanoma model, B16F10 cells (2 × 105) were subcutaneously injected into the dorsal part of mice (aged 8–10 weeks). From day 10, tumour size was measured every 2 days, and animal survival rate was recorded every day. Tumour size was calculated as length × width. Mice with tumour size larger than 20 mm at the longest axis were euthanized for ethical consideration. To analyse effector function of tumour-infiltrating T cells, mice were euthanized on day 16. In the avasimibe therapy, melanoma-bearing mice with similar tumour size were randomly divided into two groups. From day 10, avasimibe was injected intraperitoneally to the mice at the dose of 15 mg kg−1 every 2 days. In a lung-metastatic melanoma model, B16F10 cells (2 × 105) were intravenously injected into mice (aged 8–10 weeks). Animal survival rate was recorded every day. To study tumour growth, mice were euthanized on day 20 and tumour numbers on lungs were counted. Lung-infiltrating T cells were isolated and analysed as mentioned above. In the lung-metastatic melanoma model, investigator was blinded to group allocation during the experiment and when assessing the outcome. B16F10-OVA cells (2 × 105) were injected subcutaneously into C57BL/6 mice at age 8–10 weeks. On day 16, the naive wild-type or Acat1CKO OT-I CD8+ T cells were isolated and labelled with live cell dye CFSE or CTDR (Cell Tracker Deep Red, Life Technologies), respectively. The labelled wild-type and CKO cells were mixed together at a 1:1 ratio, and 1 × 107 mixed cells per mouse were injected intravenously into the B16F10-OVA-bearing mice. After 12 h, blood, spleens, inguinal lymph nodes (draining) and mesenteric lymph nodes (non-draining) of the mice were collected. Single-cell suspensions from these tissues were stained with the anti-CD8a antibody, and the ratio of transferred cells in CD8+ populations was analysed using flow cytometry. The Lewis lung carcinoma cells were washed twice with PBS and filtered through a 40-μm strainer. After which, the Lewis lung carcinoma cells (2 × 106) were intravenously injected into wild-type or Acat1CKO mice at age 8–10 weeks. To detect the tumour multiplicity in the lung, the mice were euthanized at day 35 after tumour inoculation and tumour numbers in the lung were counted. In the avasimibe therapy, mice were randomly divided into two groups. From days 10 to 35 after tumour inoculation, avasimibe was delivered to the mice by intragastric administration at the dose of 15 mg kg−1 every 3 days. B16F10-OVA cells (2 × 105) were injected subcutaneously into C57BL/6 mice at age 8–10 weeks. On day 10, melanoma-bearing mice with similar tumour size were randomly divided into three groups (n = 9–10) and respectively received PBS, wild-type OT-I CTLs (1.5 × 106) or Acat1CKO OT-I CTLs (1.5 × 106) by intravenous injection. From day 13, the tumour size was measured every two days, and the animal survival rate was recorded every day. Tumour size was calculated as length × width. Mice with tumour size larger than 20 mm at the longest axis were euthanized for ethical consideration. B16F10 cells (2 × 105) were injected subcutaneously into C57BL/6 mice at age 8–12 weeks. On day 10, melanoma-bearing mice with similar tumour size were randomly divided into four groups (n = 8–10) and received PBS, avasimibe, anti-PD-1 antibody or both avasimibe and anti-PD-1 antibody, respectively. Avasimibe was delivered every 2 days at the dose of 15 mg kg−1 by intragastric administration. Anti-PD-1 antibody (RMP1-14, Bio X Cell, 200 μg per injection) was injected intraperitoneally every 3 days. The tumour size and survival were measured as mentioned above. Mice with tumour size larger than 20 mm at the longest axis were euthanized for ethical consideration. Super-resolution STORM imaging was performed on a custom modified Nikon N-STORM microscope equipped with a motorized inverted microscope ECLIPSE Ti-E, an Apochromat TIRF 100 × oil immersion lens with a numerical aperture of 1.49 (Nikon), an electron multiplying charge-coupled device (EMCCD) camera (iXon3 DU-897E, Andor Technology), a quad band filter composed of a quad line beam splitter (zt405/488/561/640rpc TIRF, Chroma Technology Corporation) and a quad line emission filter (brightline HC 446, 523, 600, 677, Semrock, Inc.). The TIRF angle was adjusted to oblique incidence excitation at the value of 3,950–4,000, allowing the capture of images at about 1 μm depth of samples. The focus was kept stable during acquisition using Nikon focus system. For the excitation of Alexa647, the 647 nm continuous wave visible fibre laser was used, and the 405 nm diode laser (CUBE 405-100C, Coherent Inc.) was used for switching back the fluorophores from dark to the fluorescent state. The integration time of the EMCCD camera was 90–95 frames per second. To image TCR distribution in the plasma membrane, naive CD8+ T cells or activated CD8+ T cells (stimulated with 10 μg ml−1 anti-CD3 for 10 min at 37 °C) were placed in Ibidi 35 mm μ-Dish and fixed with 4% PFA, followed by surface staining with 5 μg ml−1 anti-mCD3ε (145-2C11) for 4 h at 4 °C, then the cells were stained with 2 μg ml−1 Alexa 647-conjugated goat anti-hamster IgG (the secondary antibody) for 2 h at 4 °C after washing with PBS ten times. Before imaging, the buffer in the dish was replaced with the imaging buffer contained 100 mM β-mercaptoethanolamin (MEA) for a sufficient blinking of fluorophores. Super-resolution images were reconstructed from a series of 20,000–25,000 frames using the N-STORM analysis module of NIS Elements AR (Laboratory imaging s.r.o.). Molecule distribution and cluster position were analysed with MATLAB (MathWorks) based on Ripley’s K function. L(r) − r represents the efficiency of molecule clustering, and r value represents cluster radius. The r value at the maximum L(r) − r value represents the cluster size with the highest probability34. Planar lipid bilayers (PLBs) containing biotinylated lipids were prepared to bind biotin-conjugated stimulating antibody by streptavidin as previously described35, 36. Biotinylated liposomes were prepared by sonicating 1,2-dioleoyl-sn-glycero-3-phosphocholine and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-cap-biotin (25:1 molar ratio, Avanti Polar Lipids) in PBS at a total lipid concentration of 5 mM. PLBs were formed in Lab-Tek chambers (NalgeNunc) in which the cover glasses were replaced with nanostrip-washed coverslips. Coverslips were incubated with 0.1 mM biotinylated liposomes in PBS for 20 min. After washing with 10 ml PBS, PLBs were incubated with 20 nM streptavidin for 20 min, and excessive streptavidin was removed by washing with 10 ml PBS. Streptavidin-containing PLBs were incubated with 20 nM bionylated anti-mCD3ε (145-2C11) (Biolegend). Excessive antibody was removed by washing with PBS. Next, PLBs were treated with 5% FBS in PBS for 30 min at 37 °C and washed thoroughly for TIRFM of T cells. Adhesion ligands necessary for immunological synapse formation were provided by treating the bilayer with serum. Freshly isolated mouse splenocytes were stained with Alexa568-anti-mTCRβ Fab and FITC-anti-mCD8 and washed twice. Anti-mTCRβ antibody was labelled with Alexa568-NHS ester (Molecular probes) and digested to get Fab fragments with Pierce Fab Micro Preparation Kit (Thermo). Cells were then placed on anti-mCD3ε-containing PLBs to crosslink TCR. Time-lapse TIRFM images were acquired on a heated stage with a 3-s interval time at 37 °C, 5% CO , using a Zeiss Axio Observer SD microscopy equipped with a TIRF port, Evolve 512 EMCCD camera and Zeiss Alpha Plan-Apochromat 100 × oil lens. The acquisition was controlled by ZEN system 2012 software. An OPSL laser 488 nm and a DPSS laser 561 nm were used. Field of 512 × 512 pixels was used to capture 6–8 CD8+ T cells per image. Results of synapse formation and TCR movements were the population averages of all CD8+ T cells from 2–3 individual images. The movements of TCR microclusters were splitted into directed, confined and random movement using the method described37. To sort the three movements, the MSD plot of each TCR microcluster was fitted with three functions as described37. The ones with good fit (square of correlation coefficients (R2) ≥ 0.33) were selected for further classification. For a certain TCR microcluster, the movement is defined as random if s.d. < 0.010. The distinction of directed and confined movement depends on which function fit better in the population of those s.d. ≥ 0.010. Images were analysed with Image Pro Plus software (Media Cybernetics), ImageJ (NIH) and MATLAB (MathWorks). In the granule polarization imaging, CTLs stained with Alexa568-anti-mTCRβ Fab were placed on anti-mCD3ε-containing PLBs for indicated time and fixed with 4% PFA. After the permabilization, cells were stained with Alexa488-anti-mCD107a (1D4B) antibody. Three-dimensional spinning-disc confocal microscopy was used to image the granules polarized at 0–2 μm distance from the synapse. The total granule volumes were quantified with Imaris software. The degranulation level was measured as previously described38. OT-I CTLs were mixed with OVA pulsed EL4 cells at 1:1 ratio. The mixed cells were then cultured in the medium supplemented with 1 μg ml−1 Alexa488-anti-CD107a antibody and 2 μM monensin for 1, 2 and 4 h. After which, cells were washed with PBS and further stained with PE–Cy7-anti-CD8a antibody. Flow cytometry was used for assessing the surface and internalized CD107a levels. MATLAB code used to perform STORM and TIRFM data analysis can be accessed by contacting W.L. (liuwanli@biomed.tsinghua.edu.cn). All sample sizes are large enough to ensure proper statistical analysis. Statistical analyses were performed using GraphPad Prism (GraphPad Software, Inc.). Statistical significance was determined as indicated in the figure legends. P < 0.05 was considered significant; *P < 0.05; **P < 0.01; ***P < 0.001. All t-test analyses are two-tailed unpaired t-tests. The replicates in Figs 2, 3b, i, k–o, 4a, b, e–j, l, m and Extended Data Figs 1a, 3a–c, g–l, 4f, 5a–e, 6, 7g, 8, 9e, h, j and 10 were biological replicates. The replicates in Figs 1, 3c, d, p, Fig. 4o, p and Extended Data Figs 1b–i, 2, 3d–f, m, n, 4b–e, 5f, g, 7a, b, i–l and 9a–c were technical replicates. The centre values shown in all figures are average values.


Grant
Agency: Cordis | Branch: H2020 | Program: MSCA-ITN-ETN | Phase: MSCA-ITN-2014-ETN | Award Amount: 3.87M | Year: 2015

Cell migration (cell motility) is a fundamental biological process that is pivotal in (i) tissue formation and repair (health) and (ii) tissue invasion during carcinogenesis (disease). Understanding and controlling cell migration will have major clinical impact. Clarifying mechanisms driving cell motility has been challenging due to the complex underlying cellular mechanisms; these involve multiple components coordinated by structural, chemical and physical signals in terms of time and space. To accomplish breakthroughs in this field, researchers are needed who (i) master cutting-edge experimental techniques for monitoring the different cellular processes at high resolution and (ii) have competencies in theoretical science for integrating the resulting data sets into mechanistic mathematical models for predicting motile cell behaviour. The Research Training Network on Integrated Component Cycling in Epithelial Cell Motility (InCeM) aims to endow up-and-coming researchers with exactly these competencies. They will be able to develop and apply innovative devices for microscopic recording, image processing techniques, data analysis tools and modelling procedures for mechanistic understanding of cell migration. InCeM will focus on epithelial cells, since inducing motility in this cell type is clinically relevant for wound healing and cancer invasion. The ultimate goal is to control and manipulate cell migration for clinical applications. A dedicated multidisciplinary team of 11 beneficiaries from universities (4), research institutions (4) and industry (3), based in 5 European countries and Israel, together with 17 associated partners from the public and private sector, will train 15 Early Stage Researchers (ESRs) to use the relevant technologies and sciences and will offer business training to prepare them for successful careers in both academic and non-academic environments.


Grant
Agency: Cordis | Branch: H2020 | Program: RIA | Phase: INFRADEV-1-2014 | Award Amount: 3.96M | Year: 2015

The present project is intended to take the European Solar Telescope (EST) to the next level of development by undertaking crucial activities to improve the performance of current state-of-the-art instrumentation. Legal, industrial and socio-economic issues will also be addressed, as key questions for the attainment of EST. The particular developments and strategic tasks proposed here can be summarised in the following specific objectives: (i) Boosting new generation detectors, with the development of two prototype sensors, one for large-format imaging and a the other for high-precision polarimetry, the evaluation of an existing large format wavefront sensing camera is also addressed; (ii) Development of a capacitance-stabilised Fabry-Perot prototype for a high quality control of the parallelism of the etalon plates; (iii) new techniques for 2D solar spectro-polarimetry; with integral field units based on multi-slit image slicers or a microlens-fed spectrograph; (iv) development of large format liquid-crystal modulators, required for the large-format sensors that will be needed for the new generation large aperture telescopes ; (v) evaluation of the performance of the EST-MCAO deformable mirrors to improve the design and performance of this system; and (vi) strategic work to covering industrial, financial and legal issues related the future construction and operation of EST. The following issues will be addressed: Elaboration of a census of the European solar physics community Analysis of the technological expertise of European companies in the different countries and their potential expertise related with the construction needs of EST Revision and update of the construction budget of EST Stimulation of a discussion of all these aspects within the consortium EAST With all these elements in hand, the project will be in the condition to present a definite proposal for detailed design, construction, managing and operation of EST.


Trademark
Andor Technology | Date: 2016-06-23

Scientific and optical apparatus and instruments; photographic apparatus and instruments for scientific purposes; microscopes and parts and fittings therefor; computer software for use in the field of microscopy; electrical apparatus and instruments for use in the field of microscopy; data processing equipment and computers. Scientific and technological services and research and design relating thereto; industrial analysis and research services; design and development of computer hardware and software.


Patent
Andor Technology | Date: 2011-03-09

A digital interface interconnected between a controller for a spatial light modulator device and a pattern generation subsystem. The digital interface comprises a clock which provides a clock signal and a logic device responsive to pattern image data output by the pattern generation subsystem and the clock signal and configured to assign pixels to the pattern Image data and to serialize the assigned pixels according to the clock signal to reformat the pattern image data to correspond to the spatial addressing of the spatial light modulator device.


News Article | November 16, 2015
Site: phys.org

Solar flares are massive explosions of energy in the Sun's atmosphere. Experts have warned that even a single 'monster' solar flare could cause up to $2 trillion worth of damage on Earth, including the loss of satellites and electricity grids, as well the potential knock-on dangers to human life and health. A key goal of the $300 million Daniel K Inouye Solar Telescope (DKIST), which will be the largest solar telescope in the world when construction is finished in 2019 on the Pacific island of Maui, is the measurement of magnetic fields in the outer regions of the Sun's atmosphere. The technique pioneered by the Queen's-led team, published today in the journal Nature Physics, will feed into the DKIST project, as well as allowing greater advance warning of potentially devastating space storms. The new technique allows changes in the Sun's magnetic fields, which drive the initiation of solar flares, to be monitored up to ten times faster than previous methods. The Queen's-led team, who span universities in Europe, the Asia-Pacific and the USA, harnessed data from both NASA's premier space-based telescope (the Solar Dynamics Observatory), and the ROSA multi-camera system, which was designed at Queen's University Belfast, using detectors made by Northern Ireland company Andor Technology. Lead researcher Dr. David Jess from Queen's Astrophysics Research Centre said: "Continual outbursts from our Sun, in the form of solar flares and associated space weather, represent the potentially destructive nature of our nearest star. Our new techniques demonstrate a novel way of probing the Sun's outermost magnetic fields, providing scientists worldwide with a new approach to examine, and ultimately understand, the precursors responsible for destructive space weather." "Queen's is increasingly becoming a major player on the astrophysics global stage. This work highlights the strong international links we have with other leading academic institutes from around the world, and provides yet another example of how Queen's research is at the forefront of scientific discovery." (1) The datasets used provided unprecedented images of all layers of the Sun's tenuous atmosphere, allowing the team to piece the jigsaw puzzle together of how magnetic fields permeate the dynamic atmosphere (2) Waves propagated along magnetic fields, similar to how sound waves travel through the air on Earth. The speed at which these waves can travel is governed by the characteristics of the Sun's atmosphere, including its temperature and the strength of its magnetic field. The waves were found to propagate with speeds approaching half a million (500,000) mph, and when coupled with temperatures of around 1,000,000 degrees in the Sun's outer atmosphere, the researchers were able to determine the magnetic field strengths to a high degree of precision (3) The strength of the magnetic fields decreases by a factor of 100 as they travel from the surface of the Sun out into the tenuous, hot corona (the region of the Sun's atmosphere visible during total solar eclipses). While the magnetic fields have decreased in strength, they still possess immense energy that can twist and shear, ultimately releasing huge blasts towards Earth in the form of solar flares. The team's methods provide a much faster way of examining magnetic field changes in the lead up to solar flares, which can ultimately be used to provide advanced warning against such violent space weather Explore further: Image: Supercomputer simulation of magnetic field loops on the Sun More information: David B. Jess et al. Solar coronal magnetic fields derived using seismology techniques applied to omnipresent sunspot waves, Nature Physics (2015). DOI: 10.1038/nphys3544

Loading Andor Technology collaborators
Loading Andor Technology collaborators