Amickiewicz University

Poznań, Poland

Amickiewicz University

Poznań, Poland

Time filter

Source Type

Kichanov S.E.,Joint Institute for Nuclear Research | Kozlenko D.P.,Joint Institute for Nuclear Research | Bilski P.,Amickiewicz University | Wsicki J.,Amickiewicz University | And 8 more authors.
Journal of Molecular Structure | Year: 2011

Measurements of spin-lattice relaxation time T1 for resorcinol have been made by the proton NMR technique using the saturation method in the temperature range 280-380 K and pressure up to 800 MPa. The pressure-induced α-β transition evolved through two phase coexistence range was observed. The crystal structure and vibrational spectra of the resorcinol have also been studied by means of X-ray diffraction and Raman spectroscopy at pressures up to 19 GPa in temperature range 290-380 K. In experiments with a rapid pressurization rate, suppression of α-β polymorphic transition in resorcinol occurs. In experiments with a slow pressurization rate, two structural phase transitions, between orthorhombic α and β phases at P = 0.4 GPa and from β to another orthorhombic γ phase at P = 5.6 GPa, were observed. At pressures above 12.5 GPa, a gradual transformation to the amorphous phase was revealed. The lattice parameters, unit cell volumes and vibration modes as functions of pressure and temperature were obtained for the different polymorphic modifications of resorcinol. © 2011 Elsevier B.V. All rights reserved.


Kalwarczyk T.,Polish Academy of Sciences | Ziebacz N.,Polish Academy of Sciences | Bielejewska A.,Polish Academy of Sciences | Zaboklicka E.,Polish Academy of Sciences | And 9 more authors.
Nano Letters | Year: 2011

We present a scaling formula for size-dependent viscosity coefficients for proteins, polymers, and fluorescent dyes diffusing in complex liquids. The formula was used to analyze the mobilities of probes of different sizes in HeLa and Swiss 3T3 mammalian cells. This analysis unveils in the cytoplasm two length scales: (i) the correlation length ξ (approximately 5 nm in HeLa and 7 nm in Swiss 3T3 cells) and (ii) the limiting length scale that marks the crossover between nano- and macroscale viscosity (approximately 86 nm in HeLa and 30 nm in Swiss 3T3 cells). During motion, probes smaller than ξ experienced matrix viscosity: ηmatrix ≈ 2.0 mPa•s for HeLa and 0.88 mPa•s for Swiss 3T3 cells. Probes much larger than the limiting length scale experienced macroscopic viscosity, ηmacro ≈ 4.4 × 10-2 and 2.4 × 10-2 Pa•s for HeLa and Swiss 3T3 cells, respectively. Our results are persistent for the lengths scales from 0.14 nm to a few hundred nanometers. © 2011 American Chemical Society.


Makarewicz R.,Amickiewicz University | Kokowski P.,Amickiewicz University
Noise Control Engineering Journal | Year: 2011

The prediction methods of wind turbine noise in common use are valid for weather conditions that correspond to moderate down-wind. In this study the up-wind propagation is examined for a point source (turbine hub) and plane source (turbine blades with the hub). Since the wind turbine noise limits are related either to an average-or the highest noise imission at the receiver, the up-wind propagation is considered for the wind speed of 10 m/s at 10 m above the ground surface (wind class W5). It is shown that the up-wind refraction results in the change of the effective sound power level of the wind turbine. It explains some up-wind measurement data. © 2011 Institute of Noise Control Engineering.


Dybczynski P.A.,Amickiewicz University | Krolikowska M.,Polish Academy of Sciences
Planetary and Space Science | Year: 2016

We report the current status of the on-going project aimed at advancing our understanding of a source or sources of the actual long-period comets (LPCs). For the last several years we have developed several new methods and numerical packages to study in detail well-observed LPCs motion. Our main goal is to increase the thoroughness and precision of each step, starting from a sophisticated astrometric observation treatment through osculating orbit determination with different dynamical models, including different formulations of non-gravitational (NG) forces and, if necessary, adjusting the observational interval to obtain the most accurate past (original) and future orbits. Then we trace LPCs motion for one orbital period backward and forward. In this last step, we fully take into account Galactic perturbations as well as the gravitational influence of all known potential stellar perturbers acting during the relevant time interval around present time. At each step, we carefully propagate observational uncertainties by means of replacing each comet with a swarm of thousands of randomly generated virtual comets, all fully satisfying observational constraints. At the current stage of the project, we have determined osculating orbits for over 100 LPCs, some of them in several different variants. We carefully chose an appropriate osculating orbit variant for past and future motion studies and follow numerically LPCs motion up to a distance of 250 au from the Sun, obtaining original and future orbits. To study their motion further, we selected over 90 stars as potential perturbers and included their influence during the numerical integration of cometary motion. Our computer tools are fully prepared to use more stellar data, e.g. from the Gaia mission. We already noticed several important facts: (1) Including NG effects in the process of osculating orbit determination improves significantly our knowledge on cometary past and future motion. (2) In the case of well-observed comets with long periods covered with astrometric data it can be fruitful to obtain original or future orbits not from the whole set of observations but from shorter arcs, e.g. to exclude observations close to the perihelion, where violent NG effects can disturb a comet motion. (3) Taking into account the observational uncertainties for 1/a-distribution of original/future orbits, we produce a detailed shape of the famous 'Oort spike' that fully reflects observational constraints. (4) We found that the significant percentage of LPCs have their previous perihelia deep in the planetary region - as a result one cannot treat them as 'new comets' since they experienced both planetary perturbations and solar radiation heating at least during their previous perihelion passage. (5) The widely used concept of the Jupiter-Saturn barrier should be revised since significant number of LPCs can migrate through it without any significant orbital changes. (6) None of the known stars have changed dynamical status of any of studied orbits of LPCs significantly. © 2015 Elsevier Ltd. All rights reserved.


Odani A.,Kanazawa University | Jastrzab R.,Amickiewicz University | Lomozik L.,Amickiewicz University
Metallomics | Year: 2011

Interaction of phytic acid (myo-inositolhexakisphosphoric acid, IP) and polyamines (A = en, tn, Put, dien, 2,3-tri, 3,3-tri, Spd, 3,3,3-tet, spermine(Spm)) have been studied by potentiometric and 31P-NMR techniques. The non-covalent interactions have led to the formation of stable molecular complexes of (IP)H n(A) type at the 1:1 molar ratio of the ligands, but of different numbers of protons. The IP protonation constants, stability constants of the molecular complexes and metal (Mg 2+) complexes have been determined. The structural and pH dependences of stability constants showed the interactions between IP and A have the acid-base character determining their effectiveness, although the IP structure (5ax1eq, 5eq1ax) in molecular complexes should be also taken into account. 31P NMR study showed in the presence of Spm 31P highfield shifts and high pH shift of signal broadening due to chemical exchange between 5ax1eq and 5eq1ax. The preferable binding of Spm to IP over Mg 2+ in neutral pH indicated the importance of polyamine as a stabilizer of phosphate compounds. © 2011 The Royal Society of Chemistry.


Wozniak S.,Amickiewicz University
Journal of Computational Methods in Sciences and Engineering | Year: 2010

The molecular theory of optically induced static magnetization is extended to systems acted on with a dc electric field. The two effects, the invers Faraday effect and invers magnetochiral birefringence, are analysed for their dependence on an electric field perpendicular or parallel to the propagation direction of the incident light beam. The mechanisms responsible for the effects are described in terms of linear and nonlinear multipole polarizability tensors as well as molecular reorientation functions defined by the generalized Langevin-Kielich functions. The effects at electric saturation are a source of information concerning the tensor components of electric dipole, magnetic dipole and electric quadrupole polarizability. © 2010 - IOS Press and the authors. All rights reserved.


Krzyminska S.,Amickiewicz University | Szczuka E.,Amickiewicz University | Dudzinska K.,Amickiewicz University | Kaznowski A.,Amickiewicz University
Antonie van Leeuwenhoek, International Journal of General and Molecular Microbiology | Year: 2015

We examined thirty methicillin-resistant Staphylococcus haemolyticus isolates cultured from clinical specimens for antibiotic resistance, various important interactions of the bacteria with epithelial cells and putative virulence determinants. All strains were resistant to oxacillin and carried the mecA gene. Aminocyclitol-3′-phosphotransferase (aph(3′)-IIIa) gene encoding nucleotidyltransferases was detected in 43 %, aminocyclitol-6′-acetyltransferase-aminocyclitol-2″-phosphotransferase (aac(6′)/aph(2″)) gene encoding bifunctional acetyltransferases/phosphotransferases in 33 %, aminocyclitol-4′-adenylyltransferase (ant(4′)-Ia) gene encoding phosphotransferases in 20 %. The coexistence of resistance to methicillin and aminoglycosides was investigated in multi-resistant strains. Coexisting (aac(6′)/aph(2″)) and (aph(3′)-IIIa) genes were detected in 33 % of isolates, whereas 63 % of isolates had at least one of these genes. All strains revealed adherence ability and most of them (63 %) were invasive to epithelial cells. Electron microscopy revealed that the bacteria were found in vacuoles inside the cells. We observed that the contact of the bacteria with host epithelial cells is a prerequisite to their cytotoxicity at 5 h-incubation. Culture supernatant of the strains induced a low effect of cytotoxicity at the same time of incubation. Cell-free supernatant of all isolates expressed cytotoxic activity which caused destruction of HEp-2 cells at 24 h. None of the strains was cytotonic towards CHO cells. Among thirty strains, 27 % revealed lipolytic activity, 43 % produced lecithinase and 20 % were positive for proteinase activity. Analyses of cellular morphology and DNA fragmentation exhibited typical characteristic features of those undergoing apoptosis. The Pearson linear test revealed positive correlations between the apoptotic index at 24 h and percentage of cytotoxicity. Our results provided new insights into the mechanisms contributing to the development of S. haemolyticus-associated infections. The bacteria adhered and invaded to non-professional phagocytes. The invasion of epithelial cells by S. haemolyticus could be similar to phagocytosis that requires polymerization of the actin cytoskeleton. The process is inhibited by cytochalasin D. Moreover, they survived within the cells by residing in membrane bound compartments and induced apoptotic cell death. © 2015, The Author(s).


PubMed | Amickiewicz University
Type: Comparative Study | Journal: Journal of fluorescence | Year: 2010

We report steady state fluorescence and lifetime emission studies of d(GGTTGGTGTGGTTGG) (TBA) and d(GGGTTAGGGTTAGGGTTAGGG) (Htelom) oligonucleotides labeled with pyrene through a 3-aminopropyl linker. Such G-rich sequences are able to self-assemble into G-quadruplexes, especially in the presence of specific cations like potassium. A comparative studies with single- and double-labeled G-quadruplexes were carried out. For each probe we have measured fluorescence decays for emission wavelength of 390 and 480 nm in the varying concentration of potassium ion. We have calculated average lifetimes <> for every system as well as the fractional distribution (i) of emitting species.

Loading Amickiewicz University collaborators
Loading Amickiewicz University collaborators