Entity

Time filter

Source Type

Manassas Park, VA, United States

News Article
Site: http://www.nature.com/nature/current_issue/

No statistical methods were used to predetermine sample size. The investigators were not blinded to allocation during experiments and outcome assessment. A constitutively stabilized mutant of HIF2α (HIF2α-TM) was obtained from Christina Warnecke20. The HIF2α-TM (triple mutant) construct harbours the following mutations in the prolyl and asparagyl hydroxylation sites: P405A, P530G and N851A. Polypeptide fragments of DYRK1B were cloned into pcDNA3-HA and include DYRK1B N terminus, N-Ter (amino acids 1–110), DYRK1B kinase domain, KD (amino acids 111–431), and DYRK1B C terminus, C-Ter (amino acids 432–629). cDNAs for RBX1, Elongin B and Elongin C were kindly provided from Michele Pagano (New York University) and cloned into the pcDNA vector by PCR. HA-tagged HIF1α and HIF2α were obtained from Addgene. GFP-tagged DYRK1A and DYRK1B were cloned into pcDNA vector. pcDNA-HA-VHL was provided by Kook Hwan Kim (Sungkyunkwan University School of Medicine, Korea). Site-directed mutagenesis was performed using QuickChange or QuickChange Multi Site-Directed mutagenesis kit (Agilent) and resulting plasmids were sequence verified. Lentivirus was generated by co-transfection of the lentiviral vectors with pCMV-ΔR8.1 and pMD2.G plasmids into HEK293T cells as previously described9, 42. ShRNA sequences are: ID2-1: GCCTACTGAATGCTGTGTATACTCGAGTATACACAGCATTCAGTAGGC; ID2-2: CCCACTATTGTCAGCCTGCATCTCGAGATGCAGGCTGACAATAGTGGG; DYRK1A: CAGGTTGTAAAGGCATATGATCTCGAGATCATATGCCTTTACAACCTG; DYRK1B: GACCTACAAGCACATCAATGACTCGAGTCATTGATGTGCTTGTAGGTC. IMR-32 (ATCC CCL-127), SK-N-SH (ATCC HTB-11), U87 (ATCC HTB-14), NCI-H1299 (ATCC CRL-5803), HRT18 (ATCC CCL-244), and HEK293T (ATCC CRL-11268) cell lines were acquired through American Type Culture Collection. U251 (Sigma, catalogue number 09063001) cell line was obtained through Sigma. Cell lines were cultured in DMEM supplemented with 10% fetal bovine serum (FBS, Sigma). Cells were routinely tested for mycoplasma contamination using Mycoplasma Plus PCR Primer Set (Agilent, Santa Clara, CA) and were found to be negative. Cells were transfected with Lipofectamine 2000 (Invitrogen) or calcium phosphate. Mouse NSCs were grown in Neurocult medium (StemCell Technologies) containing 1× proliferation supplements (StemCell Technologies), and recombinant FGF-2 and EGF (20 ng ml−1 each; Peprotech). GBM-derived glioma stem cells were obtained by de-identified brain tumour specimens from excess material collected for clinical purposes at New York Presbyterian-Columbia University Medical Center. Donors (patients diagnosed with glioblastoma) were anonymous. Progressive numbers were used to label specimens coded in order to preserve the confidentiality of the subjects. Work with these materials was designated as IRB exempt under paragraph 4 and it is covered under IRB protocol #IRB-AAAI7305. GBM-derived GSCs were grown in DMEM:F12 containing 1× N2 and B27 supplements (Invitrogen) and human recombinant FGF-2 and EGF (20 ng ml−1 each; Peprotech). Cells at passage (P) 4 were transduced using lentiviral particle in medium containing 4 μg ml−1 of polybrene (Sigma). Cells were cultured in hypoxic chamber with 1% O (O Control Glove Box, Coy Laboratory Products, MI) for the indicated times or treated with a final concentration of 100–300 μM CoCl (Sigma) as specified in figure legends. Mouse neurosphere assay was performed by plating 2,000 cells in 35 mm dishes in collagen containing NSC medium to ensure that distinct colonies were derived from single cells and therefore clonal in origin43. We determined neurosphere formation over serial clonal passages in limiting dilution semi-solid cultures and the cell expansion rate over passages, which is considered a direct indication of self-renewing symmetric cell divisions44. For serial sub-culturing we mechanically dissociated neurospheres into single cells in bulk and re-cultured them under the same conditions for six passages. The number of spheres was scored after 14 days. Only colonies >100 μm in diameter were counted as spheres. Neurosphere size was determined by measuring the diameters of individual neurospheres under light microscopy. Data are presented as percent of neurospheres obtained at each passage (number of neurospheres scored/number of NSCs plated × 100) in three independent experiments. P value was calculated using a multiple t-test with Holm–Sidak correction for multiple comparisons. To determine the expansion rate, we plated 10,000 cells from 3 independent P1 clonal assays in 35 mm dishes and scored the number of viable cells after 7 days by Trypan Blue exclusion. Expansion rate of NSCs was determined using a linear regression model and difference in the slopes (P value) was determined by the analysis of covariance (ANCOVA) using Prism 6.0 (GraphPad). Limiting dilution assay (LDA) for human GSCs was performed as described previously45. Briefly, spheres were dissociated into single cells and plated into 96-well plates in 0.2 ml of medium containing growth factors at increasing densities (1–100 cells per well) in triplicate. Cultures were left undisturbed for 14 days, and then the percent of wells not containing spheres for each cell dilution was calculated and plotted against the number of cells per well. Linear regression lines were plotted, and we estimated the minimal frequency of glioma cells endowed with stem cell capacity (the number of cells required to generate at least one sphere in every well = the stem cell frequency) based on the Poisson distribution and the intersection at the 37% level using Prism 6.0 software. Data represent the means of three independent experiments performed in different days for the evaluation of the effects of ID2, ID2(T27A) in the presence or in the absence of DYRK1B. LDA for the undegradable HIF2α rescue experiment was performed by using three cultures transduced independently on the same day. To identify the sites of ID2 phosphorylation from IMR32 human neuroblastoma cells, the immunoprecipitated ID2 protein was excised, digested with trypsin, chymotrypsin and Lys-C and the peptides extracted from the polyacrylamide in two 30 μl aliquots of 50% acetonitrile/5% formic acid. These extracts were combined and evaporated to 25 μl for MS analysis. The LC–MS system consisted of a state-of-the-art Finnigan LTQ-FT mass spectrometer system with a Protana nanospray ion source interfaced to a self-packed 8 cm × 75 μm id Phenomenex Jupiter 10 μm C18 reversed-phase capillary column. 0.5–5 μl volumes of the extract were injected and the peptides eluted from the column by an acetonitrile/0.1 M acetic acid gradient at a flow rate of 0.25 μl min−1. The nanospray ion source was operated at 2.8 kV. The digest was analysed using the double play capability of the instrument acquiring full scan mass spectra to determine peptide molecular weights and product ion spectra to determine amino acid sequence in sequential scans. This mode of analysis produces approximately 1200 CAD spectra of ions ranging in abundance over several orders of magnitude. Tandem MS/MS experiments were performed on each candidate phosphopeptide to verify its sequence and locate the phosphorylation site. A signature of a phosphopeptide is the detection of loss of 98 daltons (the mass of phosphoric acid) in the MS/MS spectrum. With this method, three phosphopeptides were found to carry phosphorylations at residues Ser5, Ser14 and Thr27 of the ID2 protein. The anti-phospho-T27-ID2 antibody was generated by immunizing rabbits with a short synthetic peptide containing the phosphorylated T27 (CGISRSK-pT-PVDDPMS) (Yenzym Antibodies, LLC). A two-step purification process was applied. First, antiserum was cross-absorbed against the phospho-peptide matrix to purify antibodies that recognize the phosphorylated peptide. Then, the anti-serum was purified against the un-phosphorylated peptide matrix to remove non-specific antibodies. Cells were lysed in NP40 lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)) or RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 0.5% sodium dexoycholate, 0.1% sodium dodecyl sulphate, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)). Lysates were cleared by centrifugation at 15,000 r.p.m. for 15 min at 4 °C. For immunoprecipitation, cell lysates were incubated with primary antibody (hydroxyproline, Abcam, ab37067; VHL, BD, 556347; DYRK1A, Cell Signaling Technology, 2771; DYRK1B, Cell Signaling Technology, 5672) and protein G/A beads (Santa Cruz, sc-2003) or phospho-Tyrosine (P-Tyr-100) Sepharose beads (Cell Signaling Technology, 9419), HA affinity matrix (Roche, 11815016001), Flag M2 affinity gel (Sigma, F2426) at 4 °C overnight. Beads were washed with lysis buffer four times and eluted in 2× SDS sample buffer. Protein samples were separated by SDS–PAGE and transferred to polyvinyl difluoride (PVDF) or nitrocellulose (NC) membrane. Membranes were blocked in TBS with 5% non-fat milk and 0.1% Tween20, and probed with primary antibodies. Antibodies and working concentrations are: ID2 1:500 (C-20, sc-489), GFP 1:1,000 (B-2, sc-9996), HIF2α/EPAS-1 1:250 (190b, sc-13596), c-MYC (9E10, sc-40), and Elongin B 1:1,000 (FL-118, sc-11447), obtained from Santa Cruz Biotechnology; phospho-Tyrosine 1:1,000 (P-Tyr-100, 9411), HA 1:1,000 (C29F4, 3724), VHL 1:500 (2738), DYRK1A 1:1,000, 2771; DYRK1B 1:1,000, 5672) and RBX1 1:2,000 (D3J5I, 11922), obtained from Cell Signaling Technology; VHL 1:500 (GeneTex, GTX101087); β-actin 1:8000 (A5441), α-tubulin 1:8,000 (T5168), and Flag M2 1:500 (F1804) obtained from Sigma; HIF1α 1:500 (H1alpha67, NB100-105) and Elongin C 1:1,000 (NB100-78353) obtained from Novus Biologicals; HA 1:1000 (3F10, 12158167001) obtained from Roche. Secondary antibodies horseradish-peroxidase-conjugated were purchased from Pierce and ECL solution (Amersham) was used for detection. For in vitro binding assays, HA-tagged RBX1, Elongin B, Elongin C and VHL were in vitro translated using TNT quick coupled transcription/translation system (Promega). Active VHL protein complex was purchased from EMD Millipore. Purified His-VHL protein was purchased from ProteinOne (Rockville, MD). GST, GST–ID2 and Flag–ID2 proteins were bacterial expressed and purified using glutathione sepharose beads (GE healthcare life science). Active DYRK1B (Invitrogen) was used for in vitro phosphorylation of Flag-ID2 proteins. Biotinylated wild-type and modified (pT27 and T27W) ID2 peptides (amino acids 14–34) were synthesized by LifeTein (Somerset, NJ). In vitro binding experiments between ID2 and VCB–Cul2 were performed using 500 ng of Flag-ID2 and 500 ng of VCB–Cul2 complex or 500 ng VHL protein in binding buffer (50 mM Tris-Cl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10 mM β-glycerophosphate, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1.5 mM Na VO , 0.2% NP40, 10% glycerol, 0.1 mg ml−1 BSA and EDTA-free protease inhibitor cocktail (Roche)) at 4 °C for 3 h. In vitro binding between ID2 peptides and purified proteins was performed using 2 μg of ID2 peptides and 200 ng of recombinant VCB–Cul2 complex or 200 ng recombinant VHL in binding buffer (50 mM Tris-Cl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10 mM β-glycerophosphate, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1.5 mM Na VO , 0.4% NP40, 10% glycerol, 0.1 mg ml−1 BSA and EDTA-free protease inhibitor cocktail (Roche)) at 4 °C for 3 h or overnight. Protein complexes were pulled down using glutathione sepharose beads (GE Healthcare Life Science) or streptavidin conjugated beads (Thermo Fisher Scientific) and analysed by immunoblot. Cdk1, Cdk5, DYRK1A, DYRK1B, ERK, GSK3, PKA, CaMKII, Chk1, Chk2, RSK-1, RSK-2, aurora-A, aurora-B, PLK-1, PLK-2, and NEK2 were all purchased from Life Technology and ATM from EMD Millipore. The 18 protein kinases tested in the survey were selected because they are proline-directed S/T kinases (Cdk1, Cdk5, DYRK1A, DYRK1B, ERK) and/or because they were considered to be candidate kinases for Thr27, Ser14 or Ser5 from kinase consensus prediction algorithms (NetPhosK1.0, http://www.cbs.dtu.dk/services/NetPhosK/; GPS Version 3.0 http://gps.biocuckoo.org/#) or visual inspection of the flanking regions and review of the literature for consensus kinase phosphorylation motifs. 1 μg of bacterially purified GST-ID substrates were incubated with 10–20 ng each of the recombinant active kinases. The reaction mixture included 10 μCi of [γ-32P]ATP (PerkinElmer Life Sciences) in 50 μl of kinase buffer (25 mM Tris-HCl, pH 7.5, 5 mM β-glycerophosphate, 2 mM dithiothreitol (DTT), 0.1 mM Na VO , 10 mM MgCl , and 0.2 mM ATP). Reactions were incubated at 30 °C for 30 min. Reactions were terminated by addition of Laemmli SDS sample buffer and boiling on 95 °C for 5 min. Proteins were separated on SDS–PAGE gel and phosphorylation of proteins was visualized by autoradiography. Coomassie staining was used to document the amount of substrates included in the kinase reaction. In vitro phosphorylation of Flag– ID2 proteins by DYRK1B (Invitrogen) was performed using 500 ng of GST–DYRK1B and 200 ng of bacterially expressed purified Flag–ID2 protein. In vivo kinase assay in GSCs and glioma cells was performed using endogenous or exogenously expressed DYRK1A and DYRK1B. Cell lysates were prepared in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)). DYRK1 kinases were immunoprecipitated using DYRK1A and DYRK1B antibodies (for endogenous DYRK1 proteins) or GFP antibody (for exogenous GFP–DYRK1 proteins) from 1 mg cellular lysates at 4 °C. Immunoprecipitates were washed with lysis buffer four times followed by two washes in kinase buffer as described above and incubated with 200 ng purified Flag–ID2 protein in kinase buffer for 30 min at 30 °C. Kinase reactions were separated by SDS–PAGE and analysed by western blot using p-T27-ID2 antibody. HIF2α half-life was quantified using ImageJ processing software (NIH). Densitometry values were analysed by Prism 6.0 using the linear regression function. Stoichiometric quantification of ID2 and VHL in U87 cells was obtained using recombinant Flag–ID2 and His-tagged-VHL as references. The chemiluminescent signal of serial dilutions of the recombinant proteins was quantified using ImageJ, plotted to generate a linear standard curve against which the densitometric signal generated by serial dilutions of cellular lysates (1 × 106 U87 cells) was calculated. Triplicate values ± s.e.m. were used to estimate the ID2:VHL ratio per cell. The stoichiometry of pT27-ID2 phosphorylation was determined as described46. Briefly, SK-N-SH cells were plated at density of 1 × 106 in 100 mm dishes. Forty-eight hours later 1.5 mg of cellular lysates from cells untreated or treated with CoCl during the previous 24 h were prepared in RIPA buffer and immunoprecipitated using 4 μg of pT27-ID2 antibody or rabbit IgG overnight at 4 °C. Immune complexes were collected with TrueBlot anti-rabbit IgG beads (Rockland), washed 5 times in lysis buffer, and eluted in SDS sample buffer. Serial dilutions of cellular lysates, IgG and pT27-ID2 immunoprecipitates were loaded as duplicate series for SDS–PAGE and western blot analysis using ID2 or p-T27-ID2 antibodies. Densitometry quantification of the chemiluminescent signals was used to determine (1) the efficiency of the immunoprecipitation using the antibody against p-ID2-T27 and (2) the ratio between efficiency of the immunoprecipitation evaluated by western blot for p-T27-ID2 and total ID2 antibodies. This represents the percent of phosphorylated Thr27 of ID2 present in the cell preparation. Cellular ID2 complexes were purified from the cell line NCI-H1299 stably engineered to express Flag-HA–ID2. Cellular lysates were prepared in 50 mM Tris-HCl, 250 mM NaCl, 0.2% NP40, 1 mM EDTA, 10% glycerol, protease and phosphatase inhibitors. Flag-HA–ID2 immunoprecipitates were recovered first with anti-Flag antibody-conjugated M2 agarose (Sigma) and washed with lysis buffer containing 300 mM NaCl and 0.3% NP40. Bound polypeptides were eluted with Flag peptide and further affinity purified by anti-HA antibody-conjugated agarose (Roche). The eluates from the HA beads were analysed directly on long gradient reverse phase LC–MS/MS. A specificity score of proteins interacting with ID2 was computed for each polypeptide by comparing the number of peptides identified from mass spectrometry analysis to those reported in the CRAPome database that includes a list of potential contaminants from affinity purification-mass spectrometry experiments (http://www.crapome.org). The specificity score is computed as [(#peptide*#xcorr)/(AveSC*MaxSC* # of Expt.)], #peptide, identified peptide count; #xcorr, the cross-correlation score for all candidate peptides queried from the database; AveSC, averaged spectral counts from CRAPome; MaxSC, maximal spectral counts from CRAPome; and # of Expt., the total found number of experiments from CRAPome. U87 cells were transfected with pcDNA3-HA-HIFα (HIF1α or HIF2α), pcDNA3-Flag–ID2 (WT or T27A), pEGFP-DYRK1B and pcDNA3-Myc-Ubiquitin. 36 h after transfection, cells were treated with 20 μM MG132 (EMD Millipore) for 6 h. After washing with ice-cold PBS twice, cells were lysed in 100 μl of 50 mM Tris-HCl pH 8.0, 150 mM NaCl (TBS) containing 2% SDS and boiled at 100 °C for 10 min. Lysates were diluted with 900 μl of TBS containing 1% NP40. Immunoprecipitation was performed using 1 mg of cellular lysates. Ubiquitylated proteins were immunoprecipitated using anti-Myc antibody and analysed by western blot using HA antibody. A previously described47, highly accurate flexible peptide docking method implemented in ICM software (Molsoft LLC, La Jolla CA) was used to dock ID2 peptides to VCB or components thereof. A series of overlapping peptides of varying lengths were docked to the complex of VHL and Elongin C (EloC), or VHL or EloC alone, from the recent crystallographic structure22 of the VHL-CRL ligase. Briefly, an all-atom model of the peptide was docked into grid potentials derived from the X-ray structure using a stochastic global optimization in internal coordinates with pseudo-Brownian and collective ‘probability-biased’ random moves as implemented in the ICM program. Five types of potentials for the peptide-receptor interaction energy — hydrogen van der Waals, non-hydrogen van der Waals, hydrogen bonding, hydrophobicity and electrostatics — were precomputed on a rectilinear grid with 0.5 Å spacing that fills a 34 Å × 34 Å × 25 Å box containing the VHL-EloC (V-C) complex, to which the peptide was docked by searching its full conformational space within the space of the grid potentials. The preferred docking conformation was identified by the lowest energy conformation in the search. The preferred peptide was identified by its maximal contact surface area with the respective receptor. ab initio folding and analysis of the peptides was performed as previously described48, 49. ab initio folding of the ID2 peptide and its phospho-T27 mutant showed that both strongly prefer an α-helical conformation free (unbound) in solution, with the phospho-T27 mutant having a calculated free energy almost 50 kcal-equivalent units lower than the unmodified peptide. Total RNA was prepared with Trizol reagent (Invitrogen) and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen) as described42, 50. Semi-quantitative RT–PCR was performed using AccuPrime Taq DNA polymerase (Invitrogen) and the following primers: for HIF2A Fw 5′_GTGCTCCCACGGCCTGTA_3′ and Rv 5′_TTGTCACACCTATGGCATATCACA_3′; GAPDH Fw 5′_AGAAGGCTGGGGCTCATTTG_3′ and Rv 5′_AGGGGCCATCCACAGTCTTC_3′. The quantitative RT–PCR was performed with a Roche480 thermal cycler, using SYBR Green PCR Master Mix from Applied Biosystem. Primers used in qRT–PCR are: SOX2 Fw 5′_TTGCTGCCTCTTTAAGACTAGGA_3′ and Rv 5′_CTGGGGCTCAAACTTCTCTC_3′; NANOG Fw 5′_ATGCCTCACACGGAGACTGT_3′ and Rv 5′_AAGTGGGTTGTTTGCCTTTG_3′; POU5F1 Fw 5′_GTGGAGGAAGCTGACAACAA_3′ and Rv 5′_ATTCTCCAGGTTGCCTCTCA_3′; FLT1 Fw 5′_AGCCCATAAATGGTCTTTGC_3′ and Rv 5′_GTGGTTTGCTTGAGCTGTGT_3′; PIK3CA Fw 5′_TGCAAAGAATCAGAACAATGCC_3′ and 5′_CACGGAGGCATTCTAAAGTCA_3′; BMI1 Fw 5′_AATCCCCACCTGATGTGTGT_3′ and Rv 5′_GCTGGTCTCCAGGTAACGAA_3′; GAPDH Fw 5′_GAAGGTGAAGGTCGGAGTCAAC_3′ and Rv 5′_CAGAGTTAAAAGCAGCCCTGGT_3′; 18S Fw 5′_CGCCGCTAGAGGTGAAATTC_3′ and Rv 5′_CTTTCGCTCTGGTCCGTCTT_3′. The relative amount of specific mRNA was normalized to 18S or GAPDH. Results are presented as the mean ± s.d. of three independent experiments each performed in triplicate (n = 9). Statistical significance was determined by Student’s t-test (two-tailed) using GraphPad Prism 6.0 software. Mice were housed in pathogen-free animal facility. All animal studies were approved by the IACUC at Columbia University (numbers AAAE9252; AAAE9956). Mice were 4–6-week-old male athymic nude (Nu/Nu, Charles River Laboratories). No statistical method was used to pre-determine sample size. No method of randomization was used to allocate animals to experimental groups. Mice in the same cage were generally part of the same treatment. The investigators were not blinded during outcome assessment. In none of the experiments did tumours exceed the maximum volume allowed according to our IACUC protocol, specifically 20 mm in the maximum diameter. 2 × 105 U87 cells stably expressing a doxycycline inducible lentiviral vector coding for DYRK1B or the empty vector were injected subcutaneously in the right flank in 100 μl volume of saline solution (7 mice per each group). Mice carrying 150–220 mm3 subcutaneous tumours (21 days after injection) generated by cells transduced with DYRK1B were treated with vehicle or doxycycline by oral gavage (Vibramycin, Pfizer Labs; 8 mg ml−1, 0.2 ml per day)51; mice carrying tumours generated by cells transduced with the empty vector were also fed with doxycycline. Tumour diameters were measured daily with a caliper and tumour volumes estimated using the formula: width2 × length/2 = V (mm3). Mice were euthanized after 5 days of doxycycline treatment. Tumours were dissected and fixed in formalin for immunohistochemical analysis. Data are means ± s.d. of  7 mice in each group. Statistical significance was determined by ANCOVA using GraphPad Prism 6.0 software package (GraphPad). Orthotopic implantation of glioma cells was performed as described previously using 5 × 104 U87 cells transduced with pLOC-vector, pLOC-DYRK1B (WT) or pLOC-DYRK1B-K140R mutant in 2 μl phosphate buffer42. In brief, 5 days after lentiviral infection, cells were injected 2 mm lateral and 0.5 mm anterior to the bregma, 2.5 mm below the skull of 4–6-week-old athymic nude (Nu/Nu, Charles River Laboratories) mice. Mice were monitored daily for abnormal ill effects according to AAALAS guidelines and euthanized when neurological symptoms were observed. Tumours were dissected and fixed in formalin for immunohistochemical analysis and immunofluorescence using V5 antibody (Life technologies, 46-0705) to identify exogenous DYRK1B and an antibody against human vimentin (Sigma, V6630) to identify human glioma cells. A Kaplan–Meier survival curve was generated using the GraphPad Prism 6.0 software package (GraphPad). Points on the curves indicate glioma related deaths (n = 7 animals for each group, p was determined by log rank analysis). We did not observe non-glioma related deaths. Mice injected with U87 cells transduced with pLOC-DYRK1B(WT) that did not show neurological signs on day 70 were euthanized for histological evaluation and shown as tumour-free mice in Fig. 5g. Intracranial injection of H-Ras-V12-IRES-Cre-ER-shp53 lentivirus was performed in 4-week-old Id1Flox/Flox, Id2Flox/Flox, Id3−/− mice (C57Bl6/SV129). Briefly, 1.3 µl of purified lentiviral particles in PBS were injected 1.45 mm lateral and 1.6 mm anterior to the bregma and 2.3 mm below the skull using a stereotaxic frame. Tamoxifen was administered for 5 days at 9 mg per 40 g of mouse weight by oral gavage starting 30 days after surgery. Mice were killed 2 days later and brains dissected and fixed for histological analysis. Tissue preparation and immunohistochemistry on tumour xenografts were performed as previously described42, 50, 52. Antibodies used in immunostaining are: HIF2α, mouse monoclonal, 1:200 (Novus Biological, NB100-132); Olig2, rabbit polyclonal, 1:200 (IBL International, JP18953); human Vimentin 1:50 (Sigma, V6630), Bromodeoxyuridine, mouse monoclonal 1:500 (Roche, 11170376001), V5 1:500 (Life technologies, 46-0705). Sections were permeabilized in 0.2% tritonX-100 for 10 min, blocked with 1% BSA-5% goat serum in PBS for 1 h. Primary antibodies were incubated at 4 °C overnight. Secondary antibodies biotinylated (Vector Laboratories) or conjugated with Alexa594 (1:500, Molecular Probes) were used. Slides were counterstained with haematoxylin for immunohistochemistry and DNA was counterstained with DAPI (Sigma) for immunofluorescence. Images were acquired using an Olympus 1X70 microscope equipped with digital camera and processed using Adobe Photoshop CS6 software. BrdU-positive cells were quantified by scoring the number of positive cells in five 4 × 10−3 mm2 images from 5 different mice from each group. Blinding was applied during histological analysis. Data are presented as means of five different mice ± standard deviation (s.d.) (two-tailed Student’s t-test, unequal variance). To infer if ID2 modulates the interactions between HIF2α and its transcriptional targets we used a modified version of MINDy53 algorithm, called CINDy25. CINDy uses adaptive partitioning method to accurately estimate the full conditional mutual information between a transcription factor and a target gene given the expression or activity of a signalling protein. Briefly, for every pair of transcription factor and target gene of interest, it estimates the mutual information that is, how much information can be inferred about the target gene when the expression of the transcription factor is known, conditioned on the expression/activity of the signalling protein. It estimates this conditional mutual information by estimating the multi-dimensional probability densities after partitioning the sample distribution using adaptive partitioning method. We applied CINDy algorithm on gene expression data for 548 samples obtained from The Cancer Genome Atlas (TCGA). Since the activity level and not the gene expression of ID2 is the determinant of its modulatory function that is, the extent to which it modulates the transcriptional network of HIF2α, we used an algorithm called Virtual Inference of Protein-activity by Enriched Regulon analysis (VIPER) to infer the activity of ID2 protein from its gene expression profile26. VIPER method allows the computational inference of protein activity, on an individual sample basis, from gene expression profile data. It uses the expression of genes that are most directly regulated by a given protein, such as the targets of a transcription factor (TF), as an accurate reporter of its activity. We defined the targets of ID2 by running ARACNe algorithm on 548 gene expression profiles and use the inferred 106 targets to determine its activity (Supplementary Table 3). We applied CINDy on 277 targets of HIF2α represented in Ingenuity pathway analysis (IPA) and for which gene expression data was available (Supplementary Table 4). Of these 277 targets, 77 are significantly modulated by ID2 activity (P value ≤ 0.05). Among the set of target genes whose expression was significantly positively correlated (P value ≤ 0.05) with the expression of HIF2α irrespective of the activity of ID2, that is, correlation was significant for samples with both high and low activity of ID2, the average expression of target genes for a given expression of HIF2α was higher when the activity of ID2 was high. The same set of target gene were more correlated in high ID2 activity samples compared to any set of random genes of same size (Fig. 5a), whereas they were not in ID2 low activity samples (Fig. 5b). We selected 25% of all samples with the highest/lowest ID2 activity to calculate the correlation between HIF2α and its targets. To determine whether regulation of ID2 by hypoxia might impact the correlation between high ID2 activity and HIF2α shown in Fig. 5a, b we compared the effects of ID2 activity versus ID2 expression for the transcriptional connection between HIF2α and its targets. We selected 25% of all patients (n = 548) in TCGA with high ID2 activity and 25% of patients with low ID2 activity and tested the enrichment of significantly positively correlated targets of HIF2α in each of the groups. This resulted in significant enrichment (P value < 0.001) in high ID2 activity but showed no significant enrichment (P value = 0.093) in low ID2 activity samples. Moreover, the difference in the enrichment score (∆ES) in these two groups was statistically significant (P value < 0.05). This significance is calculated by randomly selecting the same number of genes as the positively correlated targets of HIF2α, and calculating the ∆ES for these randomly selected genes, giving ∆ES . We repeated this step 1,000 times to obtain 1,000 ∆ES that are used to build the null distribution (Extended Data Fig. 9b). We used the null distribution to estimate P value calculated as (number of ∆ES > ∆ES )/1,000. Enrichment was observed only when ID2 activity was high but not when ID2 activity was low, thus suggesting that ID2 activity directionally impacts the regulation of targets of HIF2α by HIF2α. Consistently, the significant ∆ES using ID2 activity suggests that ID2 activity is determinant of correlation between HIF2α and its targets. Conversely, when we performed similar analysis using ID2 expression instead of ID2 activity, we found significant enrichment of positively correlated targets of HIF2α both in samples with high expression (P value = 0.025) and low expression of ID2 (P value = 0.048). Given the significant enrichment in both groups, we did not observe any significant difference in the enrichment score in the two groups (P value of ∆ES = 0.338). Thus, while the determination of the ID2 activity and its effects upon the HIF2α-targets connection by VIPER and CINDy allowed us to determine the unidirectional positive link between high ID2 activity and HIF2α transcription, a similar analysis performed using ID2 expression contemplates the dual connection between ID2 and HIF2α. To test if expression of DYRK1A and DYRK1B is a predictor of prognosis, we divided the patients into two cohorts based on their relative expression compared to the mean expression of all patients in GBM. First cohort contained the patients with high expression of both DYRK1A and DYRK1B (n = 101) and the other cohort contained patients with low expression (n = 128). We used average expression for both DYRK1A and DYRK1B, which individually divide the patient cohort into half and half. However, when we use the condition that patients should display higher or lower average expression of both these genes, then we select approximately 19% for high expression and 24% for low expression. Selection of these patients was entirely dependent on the overall expression of these genes in the entire cohort rather than a predefined cutoff. Kaplan–Meier survival analysis showed the significant survival benefit for the patients having the high expression of both DYRK1A and DYRK1B (P value = 0.004) compared to the patients with low expression. When similar analysis was performed using only the expression of DYRK1A or DYRK1B alone, the prediction was either non-significant (DYRK1A) or less significant (DYRK1B, P value = 0.008) when compared to the predictions using the expression of both genes. Results in graphs are expressed as means ± s.d. or means ± s.e.m., as indicated in figure legends, for the indicated number of observations. Statistical significance was determined by the Student’s t-test (two-tailed, unequal variance). P value < 0.05 is considered significant and is indicated in figure legends.


Del Campo J.,University Pompeu Fabra | Del Campo J.,University of British Columbia | Sieracki M.E.,Bigelow Laboratory for Ocean Sciences | Molestina R.,American Type Culture Collection | And 5 more authors.
Trends in Ecology and Evolution | Year: 2014

Understanding the origin and evolution of the eukaryotic cell and the full diversity of eukaryotes is relevant to many biological disciplines. However, our current understanding of eukaryotic genomes is extremely biased, leading to a skewed view of eukaryotic biology. We argue that a phylogeny-driven initiative to cover the full eukaryotic diversity is needed to overcome this bias. We encourage the community: (i) to sequence a representative of the neglected groups available at public culture collections, (ii) to increase our culturing efforts, and (iii) to embrace single cell genomics to access organisms refractory to propagation in culture. We hope that the community will welcome this proposal, explore the approaches suggested, and join efforts to sequence the full diversity of eukaryotes. © 2014 Elsevier Ltd. Source


Patent
American Type Culture Collection | Date: 2010-05-10

The present invention relates generally to the identification of biological markers associated with an increased risk of developing Diabetes, as well as methods of using such biological markers in diagnosis and prognosis of Diabetes. The biological markers of the invention may indicate new targets for therapy or constitute new therapeutics for the treatment or prevention of Diabetes.


News Article
Site: http://www.nature.com/nature/current_issue/

Filipin III was from Sigma. Amplex Red cholesterol assay kit was from Invitrogen. IL-2 was from Promega. For the flow cytometric analysis, anti-mCD4 (RM4-5), anti-mCD8 (53-6.7), anti-mCD3ε (145-2C11), anti-IFNγ (XMG1.2), anti-TNFα (MP6-XT22), anti-granzyme B (NGZB), anti-CD44 (IM7), anti-CD69 (H1.2F3), anti-PD-1 (J43), anti-CTLA-4 (UC10-4B9), anti-Ki-67 (16A8), anti-FoxP3 (FJK-16 s), anti-Gr1 (RB6-8C5), anti-CD11b (M1/70) and anti-CD45 (30-F11) were purchased from eBioscience. For western blots, anti-pCD3ζ, anti-CD3ζ, anti-pZAP70, anti-ZAP70, anti-pLAT, anti-LAT, anti-pERK1/2 and anti-ERK1/2 were from Cell Signaling Technology. Avasimibe was from Selleck. MβCD-cholesterol and MβCD were from Sigma. Lovastatin was from Sigma. U18666A was from Merck. K604 was chemically synthesized in F.-J. Nan’s laboratory. CP113,818 was a research gift from P. Fabre. MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was from Promega. B16F10, Lewis lung carcinoma and EL-4 cell lines were originally obtained from the American Type Culture Collection, and proved mycoplasma-free. Listeria monocytogenes was provided by Q. Leng. C57BL/6 mice were purchased from SLAC. OT-I TCR transgenic mice were from the Jackson Laboratory. CD4cre transgenic mice was described previously31. InGeneious Labs produced homozygous Acat1flox/flox mouse. To produce this mouse, the Acat1 loxP construct was made by inserting two loxP sites covering Acat1 exon 14, which includes His460 known to be essential for the enzymatic activity32. The construct was injected into embryonic stem cells. The correctly targeted clones as determined by Southern blot and diagnostic PCR were injected into C57BL/6 blastocysts. To remove the Neo marker, the mice were further backcrossed to the C57BL/6 Frt mice. Through mouse crossing, the wild-type Acat1 allele (Acat1+/+), heterozygous Acat1 loxP allele (Acat1flox/+) and homozygous Acat1 loxP allele (Acat1flox/flox) were obtained and confirmed by using diagnostic PCR. Acat1flox/flox mice were crossed with CD4cre transgenic mice to get Acat1CKO mice with ACAT1 deficiency in T cells. Acat1CKO mice were further crossed with OT-I TCR transgenic mice to get Acat1CKO OT-I mice. Animal experiments using Acat1CKO mice were controlled by their littermates with normal ACAT1 expression (Acat1flox/flox). Animal experiments using Acat1CKO OT-I mice were controlled by their littermate with normal ACAT1 and OT-I TCR expression (Acat1flox/flox OT-I). Acat2−/− mice were purchased from Jackson Laboratory. All mice were maintained in pathogen-free facilities at the Institute of Biochemistry and Cell Biology. All animal experiments used mice with matched age and sex. Animals were randomly allocated to experimental groups. The animal experiments performed with a blinded manner were described below. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. The maximal tumour measurements/volumes are in accordance with the IACUC. All human studies have been approved by the Research Ethical Committee from ChangZheng Hospital, Shanghai, China. Informed consent was obtained from all study subjects. Total RNA was extracted with Trizol (Life technology) from the indicated cells and subjected to quantitative reverse transcription PCR (qRT–PCR) using gene specific primers (5′–3′): Acat1 (forward, GAAACCGGCTGTCAAAATCTGG; reverse, TGTGACCATTTCTGTATGTGTCC); Acat2 (forward, ACAAGACAGACCTCTTCCCTC; reverse, ATGGTTCGGAAATGTTCACC); Nceh (forward, TTGAATACAGGCTAGTCCCACA; reverse, CAACGTAGGTAAACTGTTGTCCC); Srebp1 (forward, GCAGCCACCATCTAGCCTG; reverse, CAGCAGTGAGTCTGCCTTGAT); Srebp2 (forward, GCAGCAACGGGACCATTCT; reverse, CCCCATGACTAAGTCCTTCAACT); Acaca (forward, ATGGGCGGAATGGTCTCTTTC; reverse, TGGGGACCTTGTCTTCATCAT); Fasn (forward, GGAGGTGGTGATAGCCGGTAT; reverse, TGGGTAATCCATAGAGCCCAG); Hmgcs (forward, AACTGGTGCAGAAATCTCTAGC; reverse, GGTTGAATAGCTCAGAACTAGCC); Hmgcr (forward, AGCTTGCCCGAATTGTATGTG; reverse, TCTGTTGTGAACCATGTGACTTC); Sqle (forward, ATAAGAAATGCGGGGATGTCAC; reverse, ATATCCGAGAAGGCAGCGAAC); Ldlr (forward, TGACTCAGACGAACAAGGCTG, reverse, ATCTAGGCAATCTCGGTCTCC); Idol (forward, TGCAGGCGTCTAGGGATCAT; reverse, GTTTAAGGCGGTAAGGTGCCA); Abca1 (forward, AAAACCGCAGACATCCTTCAG; reverse, CATACCGAAACTCGTTCACCC); Abcg1 (forward, CTTTCCTACTCTGTACCCGAGG; reverse, CGGGGCATTCCATTGATAAGG); Ifng (forward, ATGAACGCTACACACTGCATC; reverse, CCATCCTTTTGCCAGTTCCTC). Three methods were used to measure the cholesterol level of T cells. Filipin III was dissolved in ethanol to reach the final concentration of 5 mg ml−1. Cells were fixed with 4% paraformaldehyde (PFA) and stained with 50 μg ml−1 filipin III for 30 min at 4 °C. Images were collected using a Leica SP8 confocal microscope and analysed using a Leica LAS AF software. The total cellular cholesterol level was quantified using the Amplex Red cholesterol assay kit (Invitrogen). To quantify the intracellular cholesterol, CD8+ T cells were fixed with 0.1% glutaraldehyde and then treated with 2 U ml−1 cholesterol oxidase for 15 min to oxidize the plasma membrane cholesterol. The intracellular cholesterol was then extracted with methanol/chloroform (vol/vol, 1: 2), and quantified using the Amplex Red cholesterol assay kit. The value of the plasma membrane cholesterol was obtained by subtracting the intracellular cholesterol from the total cellular cholesterol. Plasma membrane cholesterol level was measured as previously described33. The plasma membrane of CD8+ T cells was biotinylated by 1 mg ml−1 sulfo-NHS-S-biotin, and then the cells were lysed by passing 13 times through a ball-bearing homogenizer. Plasma membrane was isolated from the supernatant of homogenate by streptavidin magnetic beads. Lipids were extracted with hexane/isopropanol (vol/vol, 3: 2), and then were used for measurement of unesterified cholesterol with Amplex Red Cholesterol Assay Kit and choline-containing phospholipids with EnzyChrom Phospholipid Assay Kit. The relative plasma membrane cholesterol level was normalized to the total phospholipids. To deplete cholesterol from the plasma membrane, CD8+ T cells were treated with 0.1–1 mM MβCD for 5 min at 37 °C, and then washed three times with PBS. To add cholesterol to the plasma membrane, CD8+ T cells were incubated with the culture medium supplied with 1–20 μg ml−1 MβCD-coated cholesterol at 37 °C for 15 min. The cells were then washed three times with PBS. Peripheral T cells were isolated from mouse spleen and draining lymph nodes by a CD8+ or CD4+ T-cell negative selection kit (Stem cell). To analyse the tumour-infiltrating T cells, tumours were first digested by collagenase IV (sigma), and tumour-infiltrating leukocytes were isolated by 40–70% Percoll (GE) gradient centrifugation. To measure the effector function of CD8+ T cells, the isolated cells were first stimulated with 1 μM ionomycin and 50 ng ml−1 phorbol 12-myristate 13-acetate (PMA) for 4 h in the presence of 5 μg ml−1 BFA, and then stained with PERCP-conjugated anti-CD8a. Next, cells were fixed with 4% PFA and stained with FITC-conjugated anti-granzyme B, allophycocyanin (APC)-conjugated anti-IFNγ and phycoerythrin (PE)-conjugated anti-TNFα. In general, to gate the cytokine or granule-producing cells, T cells without stimulation or stained with isotype control antibody were used as negative controls. This gating strategy is applicable for most of the flow cytometric analyses. To detect the MDSC cells in the tumour, the Percoll-isolated leukocyte were stained with anti-CD45, anti-CD11b and anti-Ly6G (Gr1), the CD45+ population was gated, after which the MDSC population (CD11b+ Gr1+) in CD45+ were gated. A pan T-cell isolation kit (Miltenyi biotech) was used to deplete T cells from splenocytes isolated from C57BL/6 mice. The T-cell-depleted splenocytes were pulsed with antigenic peptides for 2 h and washed three times. SIINFEKL (OVA or N4), SAINFEKL (A2), SIITFEKL (T4), SIIGFEKL (G4) are four types of agonist antigens with strong to weak TCR affinities. RTYTYEKL (Catnb) is a self-antigen of OT-I TCR. SIIRFEKL (R4) supports the positive selection of OT-I T cells and thus mimics a self-antigen. The T-cell-depleted and antigen-pulsed splenocytes were co-incubated with Acat1CKO OT-I T cells or wild-type OT-I T cells for 24 h. Cytokine production of CD8+ T cells was measured by intracellular staining and flow cytometric analysis. To generate mature CTLs, splenocytes isolated from Acat1CKO OT-I mice or wild-type OT-I mice were stimulated with OVA (N4) for 3 days in the presence of 10 ng ml−1 IL-2. Cells were centrifuged and cultured in fresh medium containing 10 ng ml−1 IL-2 for 2 more days, after which most of the cells in the culture were CTLs. To measure CD8+ T-cell cytotoxicity, EL-4 cells were pulsed with 2 nM antigenic peptide (N4, A2, T4, G4, R4 or Catnb) for 30 min. After washing EL-4 cells and CTLs three times with PBS, we mixed CTLs and antigen-pulsed EL-4 cells (1 × 105) in the killing medium (phenol-free RPMI 1640, 2% FBS), at the ratios of 1:1, 2:1 and 5:1, respectively. After 4 h, the cytotoxic efficiency was measured by quantifying the release of endogenous lactate dehydrogenase (LDH) from EL-4 cells using a CytoTox 96 Non-Radioactive Cytotoxicity kit (Promega). Human peripheral blood mononuclear cells from healthy donators were stimulated with 5 μg ml−1 phytohaemagglutinin (Sigma) for 2 days and then rested for 1 day. Cells were pretreated with vehicle (DMSO), CP113,818 or avasimibe for 12 h and then stimulated with 5 μg ml−1 plate-bound anti-CD3 and anti-CD28 antibodies for 24 h. Intracellular staining and flow cytometry were used to measure cytokine productions of CD8+ T cells. Oxygen consumption rates and extracellular acidification rates were measured in nonbuffered DMEM (sigma) containing either 25 mM or 10 mM glucose, 2 mM l-glutamine, and 1 mM sodium pyruvate, under basal conditions and in response to 1 μM oligomycin (to block ATP synthesis), 1.5 μM FCCP (to uncouple ATP synthesis from the electron transport chain), 0.5 μM rotenone and antimycin A (to block complex I and III of the electron transport chain, respectively), and 200 μM etomoxir (to block mitochondrial fatty acid oxidation) on the XF-24 or XF-96 Extracellular Flux Analyzers (Seahorse Bioscience) according to the manufacturer’s recommendations. B16F10 cells (5 × 103) in 100 μl media containing avasimibe or DMSO were cultured for 24, 48 or 72 h. MTS reagent (20 μl) (CellTiter 96 AQueous One Solution Cell Proliferation Assay, Promega) was added into each well. After a 2–3-h incubation, the absorbance at 490 nm was measured. The effect of avasimibe on cell viability was obtained by normalizing the absorbance of avasimibe-treated cells with that of the DMSO-treated cells. The viability value of DMSO-treated cells was set as 1. L. monocytogenes (2 × 104–7 × 104 colony-forming units (CFU)) expressing a truncated OVA protein were intravenously injected into Acat1CKO and littermate wild-type mice aged 8–10 weeks. On day 6, T cells isolated from spleens were stimulated with 50 ng ml−1 PMA and 1 μM ionomycin for 4 h in the presence of brefeldin A and then assessed by flow cytometry to detect IFNγ production. At the same time, the serum IFNγ level was assessed by ELISA. To detect the antigen-specific response of CD8+ T cells, the splenocytes were stimulated with 1 μM OVA peptide for 24 h. IFNγ production was analysed as mentioned above. To detect the L. monocytogens titre in the livers of infected mice, the livers were homogenized in 10 ml 0.2% (vol/vol) Nonidet P-40 in PBS, and the organ homogenates were diluted and plated on agar plates to determine the CFU of L. monocytogenes. Investigator was blinded to group allocation during the experiment and when assessing the outcome. B16F10 cells were washed three times with PBS, and filtered through a 40-μm strainer. In a skin melanoma model, B16F10 cells (2 × 105) were subcutaneously injected into the dorsal part of mice (aged 8–10 weeks). From day 10, tumour size was measured every 2 days, and animal survival rate was recorded every day. Tumour size was calculated as length × width. Mice with tumour size larger than 20 mm at the longest axis were euthanized for ethical consideration. To analyse effector function of tumour-infiltrating T cells, mice were euthanized on day 16. In the avasimibe therapy, melanoma-bearing mice with similar tumour size were randomly divided into two groups. From day 10, avasimibe was injected intraperitoneally to the mice at the dose of 15 mg kg−1 every 2 days. In a lung-metastatic melanoma model, B16F10 cells (2 × 105) were intravenously injected into mice (aged 8–10 weeks). Animal survival rate was recorded every day. To study tumour growth, mice were euthanized on day 20 and tumour numbers on lungs were counted. Lung-infiltrating T cells were isolated and analysed as mentioned above. In the lung-metastatic melanoma model, investigator was blinded to group allocation during the experiment and when assessing the outcome. B16F10-OVA cells (2 × 105) were injected subcutaneously into C57BL/6 mice at age 8–10 weeks. On day 16, the naive wild-type or Acat1CKO OT-I CD8+ T cells were isolated and labelled with live cell dye CFSE or CTDR (Cell Tracker Deep Red, Life Technologies), respectively. The labelled wild-type and CKO cells were mixed together at a 1:1 ratio, and 1 × 107 mixed cells per mouse were injected intravenously into the B16F10-OVA-bearing mice. After 12 h, blood, spleens, inguinal lymph nodes (draining) and mesenteric lymph nodes (non-draining) of the mice were collected. Single-cell suspensions from these tissues were stained with the anti-CD8a antibody, and the ratio of transferred cells in CD8+ populations was analysed using flow cytometry. The Lewis lung carcinoma cells were washed twice with PBS and filtered through a 40-μm strainer. After which, the Lewis lung carcinoma cells (2 × 106) were intravenously injected into wild-type or Acat1CKO mice at age 8–10 weeks. To detect the tumour multiplicity in the lung, the mice were euthanized at day 35 after tumour inoculation and tumour numbers in the lung were counted. In the avasimibe therapy, mice were randomly divided into two groups. From days 10 to 35 after tumour inoculation, avasimibe was delivered to the mice by intragastric administration at the dose of 15 mg kg−1 every 3 days. B16F10-OVA cells (2 × 105) were injected subcutaneously into C57BL/6 mice at age 8–10 weeks. On day 10, melanoma-bearing mice with similar tumour size were randomly divided into three groups (n = 9–10) and respectively received PBS, wild-type OT-I CTLs (1.5 × 106) or Acat1CKO OT-I CTLs (1.5 × 106) by intravenous injection. From day 13, the tumour size was measured every two days, and the animal survival rate was recorded every day. Tumour size was calculated as length × width. Mice with tumour size larger than 20 mm at the longest axis were euthanized for ethical consideration. B16F10 cells (2 × 105) were injected subcutaneously into C57BL/6 mice at age 8–12 weeks. On day 10, melanoma-bearing mice with similar tumour size were randomly divided into four groups (n = 8–10) and received PBS, avasimibe, anti-PD-1 antibody or both avasimibe and anti-PD-1 antibody, respectively. Avasimibe was delivered every 2 days at the dose of 15 mg kg−1 by intragastric administration. Anti-PD-1 antibody (RMP1-14, Bio X Cell, 200 μg per injection) was injected intraperitoneally every 3 days. The tumour size and survival were measured as mentioned above. Mice with tumour size larger than 20 mm at the longest axis were euthanized for ethical consideration. Super-resolution STORM imaging was performed on a custom modified Nikon N-STORM microscope equipped with a motorized inverted microscope ECLIPSE Ti-E, an Apochromat TIRF 100 × oil immersion lens with a numerical aperture of 1.49 (Nikon), an electron multiplying charge-coupled device (EMCCD) camera (iXon3 DU-897E, Andor Technology), a quad band filter composed of a quad line beam splitter (zt405/488/561/640rpc TIRF, Chroma Technology Corporation) and a quad line emission filter (brightline HC 446, 523, 600, 677, Semrock, Inc.). The TIRF angle was adjusted to oblique incidence excitation at the value of 3,950–4,000, allowing the capture of images at about 1 μm depth of samples. The focus was kept stable during acquisition using Nikon focus system. For the excitation of Alexa647, the 647 nm continuous wave visible fibre laser was used, and the 405 nm diode laser (CUBE 405-100C, Coherent Inc.) was used for switching back the fluorophores from dark to the fluorescent state. The integration time of the EMCCD camera was 90–95 frames per second. To image TCR distribution in the plasma membrane, naive CD8+ T cells or activated CD8+ T cells (stimulated with 10 μg ml−1 anti-CD3 for 10 min at 37 °C) were placed in Ibidi 35 mm μ-Dish and fixed with 4% PFA, followed by surface staining with 5 μg ml−1 anti-mCD3ε (145-2C11) for 4 h at 4 °C, then the cells were stained with 2 μg ml−1 Alexa 647-conjugated goat anti-hamster IgG (the secondary antibody) for 2 h at 4 °C after washing with PBS ten times. Before imaging, the buffer in the dish was replaced with the imaging buffer contained 100 mM β-mercaptoethanolamin (MEA) for a sufficient blinking of fluorophores. Super-resolution images were reconstructed from a series of 20,000–25,000 frames using the N-STORM analysis module of NIS Elements AR (Laboratory imaging s.r.o.). Molecule distribution and cluster position were analysed with MATLAB (MathWorks) based on Ripley’s K function. L(r) − r represents the efficiency of molecule clustering, and r value represents cluster radius. The r value at the maximum L(r) − r value represents the cluster size with the highest probability34. Planar lipid bilayers (PLBs) containing biotinylated lipids were prepared to bind biotin-conjugated stimulating antibody by streptavidin as previously described35, 36. Biotinylated liposomes were prepared by sonicating 1,2-dioleoyl-sn-glycero-3-phosphocholine and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-cap-biotin (25:1 molar ratio, Avanti Polar Lipids) in PBS at a total lipid concentration of 5 mM. PLBs were formed in Lab-Tek chambers (NalgeNunc) in which the cover glasses were replaced with nanostrip-washed coverslips. Coverslips were incubated with 0.1 mM biotinylated liposomes in PBS for 20 min. After washing with 10 ml PBS, PLBs were incubated with 20 nM streptavidin for 20 min, and excessive streptavidin was removed by washing with 10 ml PBS. Streptavidin-containing PLBs were incubated with 20 nM bionylated anti-mCD3ε (145-2C11) (Biolegend). Excessive antibody was removed by washing with PBS. Next, PLBs were treated with 5% FBS in PBS for 30 min at 37 °C and washed thoroughly for TIRFM of T cells. Adhesion ligands necessary for immunological synapse formation were provided by treating the bilayer with serum. Freshly isolated mouse splenocytes were stained with Alexa568-anti-mTCRβ Fab and FITC-anti-mCD8 and washed twice. Anti-mTCRβ antibody was labelled with Alexa568-NHS ester (Molecular probes) and digested to get Fab fragments with Pierce Fab Micro Preparation Kit (Thermo). Cells were then placed on anti-mCD3ε-containing PLBs to crosslink TCR. Time-lapse TIRFM images were acquired on a heated stage with a 3-s interval time at 37 °C, 5% CO , using a Zeiss Axio Observer SD microscopy equipped with a TIRF port, Evolve 512 EMCCD camera and Zeiss Alpha Plan-Apochromat 100 × oil lens. The acquisition was controlled by ZEN system 2012 software. An OPSL laser 488 nm and a DPSS laser 561 nm were used. Field of 512 × 512 pixels was used to capture 6–8 CD8+ T cells per image. Results of synapse formation and TCR movements were the population averages of all CD8+ T cells from 2–3 individual images. The movements of TCR microclusters were splitted into directed, confined and random movement using the method described37. To sort the three movements, the MSD plot of each TCR microcluster was fitted with three functions as described37. The ones with good fit (square of correlation coefficients (R2) ≥ 0.33) were selected for further classification. For a certain TCR microcluster, the movement is defined as random if s.d. < 0.010. The distinction of directed and confined movement depends on which function fit better in the population of those s.d. ≥ 0.010. Images were analysed with Image Pro Plus software (Media Cybernetics), ImageJ (NIH) and MATLAB (MathWorks). In the granule polarization imaging, CTLs stained with Alexa568-anti-mTCRβ Fab were placed on anti-mCD3ε-containing PLBs for indicated time and fixed with 4% PFA. After the permabilization, cells were stained with Alexa488-anti-mCD107a (1D4B) antibody. Three-dimensional spinning-disc confocal microscopy was used to image the granules polarized at 0–2 μm distance from the synapse. The total granule volumes were quantified with Imaris software. The degranulation level was measured as previously described38. OT-I CTLs were mixed with OVA pulsed EL4 cells at 1:1 ratio. The mixed cells were then cultured in the medium supplemented with 1 μg ml−1 Alexa488-anti-CD107a antibody and 2 μM monensin for 1, 2 and 4 h. After which, cells were washed with PBS and further stained with PE–Cy7-anti-CD8a antibody. Flow cytometry was used for assessing the surface and internalized CD107a levels. MATLAB code used to perform STORM and TIRFM data analysis can be accessed by contacting W.L. (liuwanli@biomed.tsinghua.edu.cn). All sample sizes are large enough to ensure proper statistical analysis. Statistical analyses were performed using GraphPad Prism (GraphPad Software, Inc.). Statistical significance was determined as indicated in the figure legends. P < 0.05 was considered significant; *P < 0.05; **P < 0.01; ***P < 0.001. All t-test analyses are two-tailed unpaired t-tests. The replicates in Figs 2, 3b, i, k–o, 4a, b, e–j, l, m and Extended Data Figs 1a, 3a–c, g–l, 4f, 5a–e, 6, 7g, 8, 9e, h, j and 10 were biological replicates. The replicates in Figs 1, 3c, d, p, Fig. 4o, p and Extended Data Figs 1b–i, 2, 3d–f, m, n, 4b–e, 5f, g, 7a, b, i–l and 9a–c were technical replicates. The centre values shown in all figures are average values.


News Article | August 31, 2016
Site: http://www.chromatographytechniques.com/rss-feeds/all/rss.xml/all

Cell lines are cultured cells that are commonly used in medical research. New results from Uppsala University show that such cells are not always what they are assumed to be. Using genetic analyses, the researchers showed that a commonly used cell line which was established in Uppsala, Sweden, almost 50 years ago does not originate from the patient it is claimed to stem from. The findings are published today in the journal Science Translational Medicine. A cell line consists of cultured cells that often originate from a tumor. In contrast to other cultured cells, such tumour cells can divide indefinitely and a cell line can therefore be cultured for many years. It is also easy to study, simple to handle and results can be obtained with high reproducibility. Cell lines are therefore indispensable in medical research and a large number of cell lines exist that originate from many different tumour types. Researchers studying the brain tumor type glioma often use a cell line called U87MG that was established at Uppsala University almost 50 years ago. It is presently publicly available from the American Type Culture Collection (ATCC), where researchers can order it to use it in their studies. Bengt Westermark is senior professor at the Department of Immunology, Genetics and Pathology, which is the present name for the department where U87MG was established. His research group has often used the original U87MG line and their experience led them to question the authenticity of the ATCC cell line. Marie Allen, an expert in DNA fingerprinting, works at the same department. DNA fingerprinting is an important tool for determining genetic identity, for instance in crime scene investigations. "Marie and her colleagues helped us genetically compare the cell lines with each other. We found that the U87MG cell line from ATCC had a different DNA profile than the original cell line in Uppsala," says Bengt Westermark. When the cell line was established in the 1960s, material from the original tumor was saved as thin sections on microscope slides. Using a very sensitive DNA analysis technique that can also be employed when only very small amounts of DNA from old tissue are available, the researchers could compare the two current cell lines with the tumor from which the cell line was established. "The comparison showed that the Uppsala cell line was genetically identical with the original tumour whereas the U87MG cell line from ATCC had a different, unknown origin. We don't know at which point during the fifty years of culturing the mix-up occurred but we have been able to show that the ATCC U87MG line is most likely from a human glioma tumor," says Bengt Westermark. Many scientific journals require researchers who report results based on cell line experiments to use DNA profiling to establish the identity of the used cells. The new findings show that proper identification of a cell line also requires that the DNA profile matches the tissue of origin. This is essential if one wants to claim that the cells, and thereby the research results, are true representatives of the original tumor.

Discover hidden collaborations