Entity

Time filter

Source Type

ACA
Barcelona, Spain

News Article
Site: http://www.materialstoday.com/news/

In a new study, researchers from the Cambridge Crystallographic Data Centre (CCDC) in the UK and the US Department of Energy’s (DOE’s) Argonne National Laboratory have teamed up to capture neon within a porous crystalline framework. Neon is the most unreactive element and is a key component in semiconductor manufacturing, but it has never been studied within an organic or metal-organic framework (MOF) until now. These new results, which include critical studies carried out at the Advanced Photon Source (APS), a DOE Office of Science user facility at Argonne, also point the way towards a more economical and greener industrial process for neon production. Although best known for its iconic use in neon signs, industrial applications of neon have recently become dominated by its use in excimer lasers to produce semiconductors. Despite being the fifth most abundant element in the atmosphere, the cost of pure neon gas has risen significantly over the years, increasing the demand for better ways to separate and isolate the gas. In 2015, CCDC scientists presented a talk at the annual American Crystallographic Association (ACA) meeting on the array of elements that have been studied within an organic or metal-organic environment. They challenged the crystallographic community to find the next and possibly last element to be added to the Cambridge Structural Database (CSD). A chance encounter at that meeting with Andrey Yakovenko, a beamline scientist at the APS, resulted in a collaborative project to capture neon – the 95th element to be observed in the CSD. Neon’s low reactivity, along with the weak scattering of X-rays due to its relatively low number of electrons, means that conclusive experimental observation of neon captured within a crystalline framework is very challenging. By conducting in situ high pressure gas flow experiments at X-Ray Science Division beamline 17-BM at the APS using the X-ray powder diffraction technique at low temperatures, the researchers have now managed to elucidate the structure of two different metal-organic frameworks (MOFs) with neon gas captured inside them. “This is a really exciting moment representing the latest new element to be added to the CSD and quite possibly the last given the experimental and safety challenges associated with the other elements yet to be studied” said Peter Wood, senior research scientist at the CCDC and lead author of a paper on this work in Chemical Communications. “More importantly, the structures reported here show the first observation of a genuine interaction between neon and a transition metal, suggesting the potential for future design of selective neon capture frameworks.” The structure of neon captured within a MOF known as NiMOF-74, a porous framework built from nickel metal centers and organic linkers, shows clear nickel-to-neon interactions forming at low temperatures. These interactions are significantly shorter than would be expected from a typical weak contact. “These fascinating results show the great capabilities of the scientific program at 17-BM and the Advanced Photon Source,” said Yakovenko. “Previously we have been doing experiments at our beamline using other much heavier, and therefore easily detectable, noble gases such as xenon and krypton. However, after meeting co-authors Pete, Colin, Amy and Suzanna at the ACA meeting, we decided to perform these much more complicated experiments using the very light and inert gas – neon. In fact, only by using a combination of in situ X-ray powder diffraction measurements, low temperature and high pressure have we been able to conclusively identify the neon atom positions beyond reasonable doubt”. “This is a really elegant piece of in situ crystallography research and it is particularly pleasing to see the collaboration coming about through discussions at an annual ACA meeting,” said Chris Cahill, past president of the ACA and professor of chemistry at George Washington University. This story is adapted from material from the Cambridge Crystallographic Data Centre, with editorial changes made by Materials Today. The views expressed in this article do not necessarily represent those of Elsevier. Link to original source.


News Article
Site: http://www.nature.com/nature/current_issue/

Mice were bred in specified-pathogen-free facilities at the University Hospital Zurich and Washington University, and housed in groups of 3–5, under a 12 h light/12 h dark cycle (from 7 a.m. to 7 p.m.) at 21 ± 1 °C, with sterilized chow food (Kliba No. 3431, Provimi Kliba) and water ad libitum. Animal care and experimental protocols were in accordance with the Swiss Animal Protection Law, and approved by the Veterinary Office of the Canton of Zurich (permits 123, 130/2008, 41/2012 and 90/2013). The following mice were used in the present study: C57BL/6J, PrnpZH1/ZH1 (ref. 3), co-isogenic C57BL/6J PrnpZH3/ZH3 and PrnpWT/WT control mice6 and Schwann cell-specifc DhhCre::Gpr126fl/fl mutants3, 4. Mice of both genders were used for experiments unless specified. Archival tissues from previous studies1, 6 were also analysed in the current study. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment except where stated. Sciatic nerves from postnatal day 2–5 were dissected using microsurgical techniques. Nerves were dissociated in serum-free DMEM supplemented with 0.05% collagenase IV (Worthington) for 1 h in the incubator. Sciatic nerves were mechanically dissociated using fire-polished Pasteur pipettes. Cells were filtered in a 40-μM cell strainer and washed in Schwann cell culture medium (DMEM, Pen-Strep, Glutamax, FBS 10%) by centrifugation at 300g for 10 min. Resuspended cells were plated on 3.5 cm Petri dishes previously coated with poly-l-lysine 0.01% (w/v) and laminin (1 mg/ml). Laminin (Cat. No: L2020; from Engelbreth-Holm-Swarm murine sarcoma basement membrane) and poly- l-lysine were obtained from Sigma-Aldrich. Full-length recombinant PrP (recPrP, residues 23–231) and globular domain (GD, residues 121–231) were purified as previously described21, 22, 23. The generation of the GST fusion FT-PrP expression vector (pGEX-KG FT-PrP) was described previously; a modified purification protocol was used24. The FT-PrP expression vector was transformed into BL21 (DE3) strain of Escherichia coli (Invitrogen). Bacteria were grown in Luria-Bertani medium to an OD of 0.6, and the expression of the fusion protein was induced with 0.5 mM isopropyl-1-thio-β-d-galactopyranoside (AppliChem). Cells were then grown for another 4 h at 37 °C and 100 rpm shaking. Cells were pelleted at 5,000g for 20 min at 4 °C (Sorvall centrifuge, DuPont). The pellet was resuspended on ice in lysis buffer (phosphate-buffered saline supplemented with complete protease inhibitors (EDTA-free, Roche), phenylmethyl sulfonyl fluoride (Sigma) and 150 μM lysozyme (Sigma)) and incubated on ice for 30 min. Triton-X 100 (1%), MgCl (10 mM) and DNase I (5 μg/ml, Roche) were added, and the lysate was incubated on ice for 30 min. The lysate was than centrifuged for 20 min at 10,000g at 4 °C. Glutathione sepharose beads were washed with PBS and incubated with the cell lysate for 1 h at 4 °C on a rotating device. Beads were packed into a column and washed with PBS until a stable baseline was reached as monitored by absorbance at A using an ÄKTAprime (GE healthcare). The fusion protein was cleaved on the beads with 5 U/ml Thrombin (GE Healthcare) for 1 h at room temperature under agitation. For thrombin removal, benzamidine sepharose beads were added and incubated for 1 h at 4 °C on a rotating wheel. Protein preparations were analysed by 12% NuPAGE gels followed by Coomassie- or silver-staining. To achieve a higher purity of the protein, we next applied the protein to a sulfopropyl (SP) sepharose column equilibrated with 50 mM Tris-HCl buffer, pH 8.5. Elution was performed with a linear NaCl gradient of 0–1,000 mM. Fractions containing the protein were collected and concentrated (AMICON; MWCO 3500). The protein was then injected in 500 μl portions into a size-exclusion chromatography system (TSK-GEL G2000SW column (Tosoh Bioscience)) and eluted with a linear gradient using PBS. Pure fractions were combined, concentrated and stored at −20 °C. The purity of FT-PrP was >95–98% as judged by a silver-stained 12% NuPAGE gel. SW10 cells and clones derived from them were all grown in DMEM medium supplemented with 10% fetal bovine serum (FBS), penicillin-streptomycin and Glutamax (all obtained from Invitrogen). HEK293T cells, its clonal variant HEK293(H) cells and clones derived therefrom overexpressing various GPCRs were grown in DMEM-F12 medium supplemented with 10% FCS, penicillin-streptomycin and Glutamax (all obtained from Invitrogen). All cell lines were regularly monitored for mycoplasma contamination. The authenticity of SW10 and its derivatives was established by monitoring the expression of Schwann-cell specific markers (Extended Data Fig. 6a). Human Gpr126 (NM_020455), Gpr124, Gpr64, Gpr56, Gpr133, Gpr56 and Gpr176 expression plasmids (pCGpr126-V5, pCGpr124-V5, pCGpr65-V5, pCGpr56-V5, pCGpr133-V5, pCGpr56-V5 and pCGpr176-V5) were generated by PCR amplification of the respective cDNA followed by TOPO cloning into the pCDNA3.1/V5-His-TOPO vector. The cDNA was in frame with the V5 tag (sequence: GKPIPNPLLGLDST) at the C terminus. HEKGPR126 and HEKGPR176 cells were generated by transfecting 1 μg of plasmid into one well of a subconfluent 6-well plate using 3 μl Fugene (Roche) according to the manufacturer’s protocol. Twenty-four hours after transfection, cells were transferred to a 10-cm dish and grown in selective medium containing 0.4 mg/ml G418 (Invitrogen) until emergence of resistant colonies. A limiting dilution was carried out to obtain clonal lines. Membrane expression of the transgene was assessed in the selected clones by confocal microscopy using 1:100 diluted anti-V5 antibody (Invitrogen) and the Cytofix/Cytoperm kit (Pharmingen Cat. Nr. 554714), according to the manufacturer’s protocol. Cerebellar granule neurons were generated from 7–8-day-old PrnpZH1/ZH1 mice as described previously25. Cultures were plated at 350,000 cells per cm2 in Basal Medium Eagle (BME) (Invitrogen) with 10% (v/v) FCS and maintained at 37 °C in 5% CO . pCDNA-PrPC was generated by cloning murine PrPC into pCDNA3.1 vector as described previously26. A site-specific mutagenesis kit (Stratagene) was used to induce alanine substitutions of QPSPG and KKRPK domains in PrPC. Primers used for generating the Ala-QPSPG plasmid were: forward, GTG GAA GCC GGT ATC CCG GGG CGG CAG CCG CTG CAG GCA ACC GTT ACC C; reverse, GGG TAA CGG TTG CCT GCA GCG GCT GCC GCC CCG GGA TAC CGG CTT CCA C. Primers for Ala-KKRPK were: forward, CTA TGT GGA CTG ATG TCG GCC TCT GCG CAG CGG CGC CAG CGC CTG GAG GGT GGA ACA CCG; reverse, CGG TGT TCC ACC CTC CAG GCG CTG GCG CCG CTG CGC AGA GGC CGA CAT CAG TCC ACA TAG. Transfections were performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. 3 μg of DNA was used per well of a 6-well plate. Cells were washed 24 h after transfection using PBS, and fresh medium was added to the cells. HEK293T and HEKGPR126 cells growing in T75 flasks at 50% density were treated with recombinant FT or GD (2 μM, 20 min). Cells were washed twice in PBS and lysed in IP buffer: 1% Triton X-100 in PBS, 1× protease inhibitors (Roche) and Phospho stop (Roche) for 20 min on ice followed by centrifugation at 5000 rpm for 5 min at 4 °C. BCA assays were performed to quantify the amount of protein, and 500 μg of protein was used for immunoprecipitations. 2 μg anti-V5 antibody was added to the cell lysate and incubated on a wheel rotator overnight at 4 °C. On the following day, Protein G dynabeads (Invitrogen) were added to the samples and incubated for a further 3 h on the wheel at 4 °C. Beads were washed three times for 5 min each using the IP buffer followed by addition of 2× sample buffer containing DTT (1 mM final). Samples were heated at 95 °C for 5 min, loaded on 4–12% Novex Bis-tris gels (Invitrogen), and migrated for 1.5 h at 150 V followed by western blotting. Immunoprecipitations were performed by adding 2 μg of POM2 antibody to 500 μl of cell medium and incubating overnight on a wheel rotator at 4 °C. Protein G beads were then added, and incubation on a wheel rotator at 4 °C was performed again. RNA extraction and quantitative PCR were performed as described previously1. The following primers were used: EGR2 forward: 5′-AATGGCTTGGGACTGACTTG-3′; EGR2 reverse: 5′-GCCAGAGAAACCTCCATT-3′; GAPDH forward: 5′-CCACCCCAGCAAGGAGAC-3′; GAPDH reverse: 5′-GAAATTGTGAGGGAGATGCT-3′. Adult zebrafish were maintained in the Washington University Zebrafish Consortium facility ( http://zebrafishfacility.wustl.edu/) and all experiments were performed in compliance with institutional protocols. Embryos were collected from harem matings or in vitro fertilization, raised at 28.5 °C, and staged according to standard protocols27. The gpr126st49 and gpr126st63 mutants were described previously7, 8. gpr126st63 or gpr126st49 mutants were collected from homozygous mutant crosses and wild-type larvae were collected from AB* strain crosses and raised to 50 hpf. FT treatment of gpr126 mutants was performed as previously described15. Briefly, egg water was replaced with either 20 μM FT in egg water or egg water containing an equivalent volume of DMSO. At 55 hpf, larvae were washed twice and raised in egg water to 5 dpf. Wild-type and gpr126 larvae were fixed in 2% paraformaldehyde plus 1% tricholoroacetic acid in phosphate buffered saline, and Mbp and acetylated tubulin immunostaining was performed as described previously8, 28. Expression scoring was performed with observers blinded to treatment according to the following rubric: strong, strong and consistent expression throughout PLLn; some, weak but consistent expression in PLLn; weak, weak and patchy expression in PLLn; none, no expression in PLLn. n = three independent replicate gpr126st63 assays and one gpr126st49 assay. n = 87 DMSO-treated gpr126st63 larvae, 81 Prp-FT-treated gpr126st63 larvae, 27 DMSO-treated gpr126st49 larvae, 25 Prp-FT-treated gpr126st49 larvae. Fluorescent nerve images were analysed using the Fiji software29. A rectangular region-of-interest (ROI) was drawn longitudinally over the fluorescent nerve. The longitudinal grey-scale histogram of the myelin basic protein (Mbp) was normalized pixel-by-pixel to the corresponding intensity of the acetylated tubulin (AcTub). The size of the measured ROIs was kept constant across different treatment modalities. SW10 cells were grown in P75 flasks at 50% density, rinsed with PBS, and detached from culture flasks with dissociation buffer containing EDTA (GIBCO). After detaching, cells were washed to remove residual EDTA and counted using a Neubauer chamber. Batches of 105 SW10 cells were transferred to FACS tubes, treated with HA-tagged recombinant peptides for 20 min, washed, and incubated with Alexa-488 conjugated anti-HA antibody for 30 min. After further washes and centrifugations, cells were resuspended in 200 μl FACS buffer (PBS +10% FBS) and analysed with a FACS Canto II cytofluorimeter (BD Biosciences). Data were analysed using FloJo software. Schwann cells were lysed in cell-lysis buffer (Tris-HCl 20 mM, NaCl 137 mM, Triton-X-100 1%) supplemented with protease inhibitor cocktail (Roche complete mini). The lysate was homogenized by passing several times through a 26G syringe, and cleared by centrifugation at 8,000g, 4 °C for 2 min. in a tabletop centrifuge (Eppendorf 5415R). Protein concentration was measured with the BCA assay (Thermo Scientific). 10 μg total protein was boiled in 4 × LDS (Invitrogen) at 95 °C for 5 min. After a short centrifugation, samples were loaded on a gradient of 4–12% Novex Bis-Tris Gel (Invitrogen) for electrophoresis at constant voltage of 200 V. Gels were transferred to PVDF membranes with the iBlot system (Life technologies). Membranes were blocked with 5% Top-Block (Sigma) in PBS-T for 1h at room temperature. Primary antibody was incubated overnight in PBS-T with 5% Top-Block. Membranes were washed three times with PBS-T for 10 min and incubated for 1 h with secondary antibodies coupled to horseradish peroxidase at room temperature. After three washes with PBS-T, the membranes were developed with a Crescendo chemiluminescence substrate system (Millipore). Signals were detected using a Stella 3200 imaging system (Raytest). Monoclonal antibodies against PrPC were obtained and used as described previously4. Fab3 and Fab71 antibodies were generated using the phage display technology and their epitopes were mapped with overlapping peptides. Anti AKT, p-AKT were obtained from Cell signaling and used at 1:2,000 dilutions for western blotting. The anti-p75NGF receptor antibody was obtained from Abcam and used at a 1:200 dilution for immunofluorescence. Anti V5 antibody was from Invitrogen and used at a dilution of 1:500 for western blot and 2 μg antibody was used for immunoprecipitation on 500 μg of cell lysate. In the direct cAMP ELISA assay, cAMP levels were assessed with a colorimetric competitive immunoassay (Enzo Life Sciences). Quantitative determination of intracellular cAMP was performed in cells or tissues lysed in 0.1 M HCl to stop endogenous phosphodiesterase activity and to stabilize the released cAMP. SW10 or HEK293T cells (100,000 cells per well) were plated in 6-well plates to ~50% density. Cells were treated with conditioned medium or recombinant peptides (2 μM, unless specified) for 20 min unless otherwise mentioned. Cells were lysed with 0.1 M HCl lysis buffer (Direct cAMP ELISA kit, Enzo). To ensure complete detachment of cells, cell scrapers were used. Lysates were homogenized with a 26G needle and syringe before clearing by centrifugation at 600g for 10 min. The subsequent steps were performed according to the manufacturer’s protocol based on competition of sample cAMP with a cAMP-alkaline phosphatase conjugate. To measure in vivo cAMP changes, BL6, PrnpZH3/ZH3 or PrnpZH1/ZH1 mice were intravenously injected with 600 μg of either FT or, as a control, uncharged FT ( ). Twenty minutes after infusion, mice were killed and all organs were collected. For cAMP assays, organs were homogenized in 0.1 M HCl. Subsequent steps were performed according to the manufacturer’s protocols as described above. Cyclic AMP levels were calculated using a cAMP standard curve in the case of ELISA based assay. Finally, cAMP concentrations were normalized to total protein content in each sample. cAMP changes are represented as fold changes to the respective controls. For each experiment, at least three independent biological replicates were used. For in vivo assays, groups of 8–16 mice were used for each experiment. For normalization purposes, the median value of the respective control sample was defined as 1. All measurements within each panel were normalized to this control value. For in vivo assays, sample sets were coded and investigators were blinded to their identities. The assignment of codes to sample identities was performed only after the cAMP values were plotted for each set. We designed two CRISPR short-guide RNA (sgRNAs) against exon 2 of Gpr126 (upper Guide CCTGTGTTCCTCTCTCAGGT and lower Guide AACAGGAACAGCAGGGCGCT). The DNA sequences corresponding to the sgRNAs were cloned into expression plasmids and transfected with EGFP-expressing Cas9-nickase plasmids. Single EGFP-expressing Schwann cells were isolated with a FACS sorter (Aria III). To determine the exact sequence of indels induced by genome editing, we amplified the sgRNA-targeted locus by PCR and subcloned the fragments into blunt-TOPO vectors. Ten colonies per cell line were sequenced and showed distinct indels on each allele. A clonal subline devoid of Gpr126 was used for further studies. This cell line possessed insertions on both the alleles; a 49-bp insertion at position 118 and a 5-bp insertion at position 84 on each allele. Both insertions led to a frameshift and to the generation of premature stop codons leading to early translation termination. Luciferase reporter constructs were generated containing a 1.3-kB sequence upstream of the transcription-starting site of Egr2. SW10 Schwann cells were transfected with Egr2 reporter construct and a renilla plasmid using lipofectamine 2000. After one day in vitro, Schwann cells were treated with recombinant full-length PrP (23–231), the globular domain of PrP (121–231) or PBS control. Luciferase activity was measured 24 h after stimulation with Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s recommendations. Results were normalized to renilla transfection controls. Glass coverslips were placed in 12-well plates (Thermo Scientific) and coated with 0.01% w/v Poly-l-lysine solution (Sigma) overnight at room temperature. Coverslips were washed three times with ddH O and dried for 2 h in a laminar-flow hood. Schwann cells were seeded and cultured at 50% density. Cells were treated with recombinant FT-PrP, full length recPrP or C1-PrP for 20 min, and washed with serum-free DMEM. Cells were further washed with PBS followed by fixation with 4% paraformaldehyde. Fixed cells were incubated in blocking buffer (PBS+10% FBS) for 1 h. Cells were treated with various primary antibodies followed by washes and incubation with Alexa 488 and Alexa 647 tagged rabbit or mouse secondary antibodies (Life Technologies). Imaging was performed by Leica SP2 confocal microscope using a 20× objective; images were processed by Image J software. Transmission electron microscopy was performed as previously described6. Briefly, mice under deep anaesthesia were subjected to transcardial perfusion with PBS heparin and sciatic nerves were fixed in situ with 2.5% glutaraldehyde plus 2% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4 and embedded in Epon. Ultrathin sections were mounted on copper grids coated with Formvar membrane and contrasted with uranyl acetate/lead citrate. Micrographs were acquired using a Hitachi H-7650 electron microscope (Hitachi High-Tech, Japan) operating at 80 kV. Brightness and contrast were adjusted using Photoshop. For quantification of Remak bundles and onion bulb-like structures, images were captured at 1,500× magnification and axon numbers and abnormal onion bulb-like structures were counted manually. Quantification was performed in a blinded fashion by assigning numbers to the images and upon completion of quantification genotypes were revealed. HA-tagged and untagged synthetic peptides were produced by EZ Biosciences. A stock solution of 2 mM was prepared by dissolving the peptides in PBS and they were used at a final concentration of 2 μM unless specified. The sequences of all the peptides used in this study can be found in Extended Data Table 1.


News Article
Site: http://www.spie.org/x2358.xml

Quantum dot photosensitizers as a new paradigm for photochemical activation Interfacial triplet-triplet energy transfer is used to significantly extend the exciton lifetime of cadmium selenide nanocrystals in an experimental demonstration of their molecular-like photochemistry. Photosensitizers are an essential component of solar energy conversion processes, in which they are used to generate the highly reactive excited states that enable energy conversion (e.g., photochemical upconversion).1, 2 Typically, molecular triplet photosensitizers are used for such applications, but to improve the solar energy conversion process, the identification and preparation of next-generation triplet photosensitizers is required. However, the design of such photosensitizers—suitable for solar energy conversion and photocatalytic applications—remains a challenge.3 Semiconductor nanocrystals are stable light-emitting materials that can be systematically tuned to produce intense absorptions and photoluminescence. Futhermore, semiconductor nanocrystals offer several advantages over molecular photosensitizers, e.g., simple preparative synthesis, photochemical stability, size-tunable electronic and photophysical properties, high molar extinction coefficients, and trivial post-synthetic functionalization. Moreover, the inherently large, energy-consuming singlet-triplet gaps that are characteristic of molecular sensitizers can be avoided with the use of semiconductor nanocrystals that feature closely spaced excited-state energy levels.4 The characteristic broadband light absorption properties of these materials can be extended into the near-IR and can thus potentially be exploited for numerous triplet excited-state reactions, such as photoredox catalysis, singlet oxygen generation, photochemical upconversion, and excited state electron transfer. In this work,5 we have investigated the possibility of using quantum dots as effective alternatives to molecular triplet photosensitizers. With our experiments, we show definitively that triplet energy transfer proceeds rapidly and efficiently from energized semiconductor nanocrystals to surface-anchored molecular acceptors. In particular, we find that cadmium selenide (CdSe) quantum dots can serve as effective surrogates for molecular triplet sensitizers and can easily transfer their triplet excitons to organic acceptors (see Figure 1). These semiconductor nanomaterials are thus highly suited to energy-conversion applications. Figure 1. Artistic illustration of quantum dot-to-molecule triplet energy transfer and example subsequent reactions. The nanoparticle-to-solution triplet exciton transfer methodology we used in our experiments is shown in Figure 2. Quantum dots are typically capped with a ligand shell, and in our experiments we used oleic acid (OA) to ensure solubility of the dots (while also preventing inter-particle aggregation). This ligand periphery also serves as an insulating layer that prevents collisional quenching with the freely diffusing molecules in the solution. As a consequence, bimolecular energy transfer cannot proceed in the solution within the approximately 30ns-lifetime of CdSe excitons. To circumvent this limitation, we modified the CdSe surfaces by replacing some of the native OA ligands with molecular triplet acceptors that bear a carboxylic acid moiety, e.g., 9-anthracene carboxylic acid (ACA). We then purified the resultant nanocrystals by successive preciptation/centrifugation washing cycles that provided the desired donor/acceptors (termed CdSe/ACA). Figure 2. Schematic representation of the quantum dot-to-solution triplet energy transfer process. ). Cl: Chlorine. Ph: Phenyl. PDT: Photodynamic therapy. Schematic representation of the quantum dot-to-solution triplet energy transfer process. 5 The associated energy (E) levels, as well as the various triplet-triplet energy transfer (TTET) and decay pathways investigated in this study are also depicted. Cadmium selenide (CdSe) nanocrystals—capped with oleic acid (OA)—are used as the light-absorbing triplet sensitizer, in conjunction with 9-anthracenecarboxylic acid (ACA) as the triplet acceptor. The long-lived ACA triplets enable exothermic triplet energy transfer to freely diffusing 2-chlorobisphenylethynylanthracene (CBPEA) and dioxygen (O). Cl: Chlorine. Ph: Phenyl. PDT: Photodynamic therapy. Since the energy transfer process in our experiments takes place at the molecule–nanoparticle interface (i.e., resembling an intramolecular process), the dynamics occur on ultrafast timescales. To monitor the photoinduced processes in these materials, we used femtosecond transient absorption spectroscopy to observe the excited-state dynamics following a 500nm laser pulse (100fs full width at half-maximum, 0.2μJ). We find—see Figure 3(a)—that direct triplet-triplet energy transfer (TTET) between the CdSe excited states and the surface-anchored molecular acceptors occurs within hundreds of picoseconds after the laser pulse (with an average rate constant of 2.0×109s−1) and with a nearly quantitative yield. Consequently, the CdSe photoluminescence was completely quenched, and the CdSe exciton ground-state recovery correlated with the molecular ACA triplet excited-state (3ACA*) signal growth (which occurred at a rate of 2.2×109s−1). Figure 3. (a) Ultrafast differential transient absorption (TA) spectra of CdSe-OA quantum dots suspended in toluene. These spectra were obtained upon selective excitation of CdSe, with the use of a 500nm laser pulse. The inset shows the TA kinetics for the growth of the molecular ACA triplet excited state (3ACA*) at 441nm. ΔA: Change in absorbance. 〈k〉 : Average TTET rate constant. (b) TA difference spectra (from a 1mJ laser pulse with 505nm excitation wavelength, 5–7ns full width at half-maximum) measured at selected delay times after the laser pulse for CdSe/ACA CBPEA in deaerated toluene (at concentrations of 5 and 6μM, respectively) at room temperature. The inset illustrates the triplet energy transfer reaction between 3ACA* and CBPEA. It shows TA decay kinetics at 430nm (red), as well as the rise and decay at 490nm (blue) along with their biexponential fits (solid and dashed lines, respectively). (a) Ultrafast differential transient absorption (TA) spectra of CdSe-OA quantum dots suspended in toluene. These spectra were obtained upon selective excitation of CdSe, with the use of a 500nm laser pulse. The inset shows the TA kinetics for the growth of the molecular ACA triplet excited state (ACA*) at 441nm. ΔA: Change in absorbance. 〈k〉: Average TTET rate constant. (b) TA difference spectra (from a 1mJ laser pulse with 505nm excitation wavelength, 5–7ns full width at half-maximum) measured at selected delay times after the laser pulse for CdSe/ACA CBPEA in deaerated toluene (at concentrations of 5 and 6μM, respectively) at room temperature. The inset illustrates the triplet energy transfer reaction betweenACA* and CBPEA. It shows TA decay kinetics at 430nm (red), as well as the rise and decay at 490nm (blue) along with their biexponential fits (solid and dashed lines, respectively). 5 The 3ACA* has an extremely long lifetime because of the strongly spin-forbidden nature of the T # S transition (i.e., between the lowest energy triplet excited state and the singlet ground state). Our results also show the decay of the 3ACA* excited states that formed on the CdSe surfaces had lifetimes on the order of milliseconds. This result represents a remarkable six-order-of-magnitude increase from the initial CdSe excited-state lifetime. Such a long excited-state lifetime is promising for numerous applications because it provides the opportunity for additional chemical reactivity within the bulk solution. As a proof of concept, we used a secondary freely diffusing molecular triplet acceptor—2-chlorobisphenylethynylanthracene (CBPEA)—in solution (toluene), to demonstrate the extraction of triplet energy from the CdSe surface. We observed—see Figure 3(b)—near-quantitative TTET between the 3ACA* and the triplet excited CPBEA (3CPBEA*) states, which can thus enable highly efficient triplet energy extraction from the initially prepared CdSe excitons. Our results also show that once the triplet exciton energy is transferred to the freely diffusing acceptors in a deoxygenated solution, they eventually undergo triplet-triplet annihilation. This leads to upconverted emission from the 1CBPEA* (at 490nm), with a lifetime of hundreds of microseconds, as shown in Figure 4(a). Moreover, in an aerated solution of CdSe/ACA we detected the characteristic photoluminescence (centered at 1277nm) of singlet oxygen (1O ), which results from the quenching of 3ACA* by freely diffusing ground-state oxygen. In contrast—see Figure 4(b)—we observed no such signal when we used CdSe nanoparticles that were devoid of ACA ligands. This work therefore represents the first example of 1O sensitization by semiconductor nanocrystals via a mechanism other than Förster energy transfer. Figure 4. (a) Delayed fluorescence (DF) spectra of triplet-sensitized upconversion emission that occurred as a result of TTET from CdSe/ 3ACA* to CBPEA, followed by triplet-triplet annihilation. The inset shows the emission decay kinetics of the integrated delayed emission. (b) Near-IR singlet oxygen phosphorescence emission from CdSe-OA and CdSE-OA/ACA in aerated toluene (both at a concentration of 4μM), under 505nm excitation at room temperature. (a) Delayed fluorescence (DF) spectra of triplet-sensitized upconversion emission that occurred as a result of TTET from CdSe/ACA* to CBPEA, followed by triplet-triplet annihilation. The inset shows the emission decay kinetics of the integrated delayed emission. (b) Near-IR singlet oxygen phosphorescence emission from CdSe-OA and CdSE-OA/ACA in aerated toluene (both at a concentration of 4μM), under 505nm excitation at room temperature. 5 In summary, we have conducted proof-of-concept experiments in which we show that CdSe quantum dots are effective surrogates for more-ubiquitous molecular triplet photosensitizers in energy conversion processes. The high photostability, broad absorption spectra, and tunable optical properties of such quantum dots give rise to their superior properties. We have also demonstrated that the behavior of semiconductor quantum dots mimics the classical behavior of molecular triplets, and that triplet excitons in nanocrystals can be efficiently transferred to a bulk solution through successive (and nearly quantitative) triplet energy transfer steps. This photofunctionality may be exploited for numerous triplet excited-state reactions, including photoredox catalysis, singlet oxygen generation, photochemical upconversion, and excited-state electron transfer. Our current research activities include generalizing this approach across a range of semiconductor nanocrystalline materials, probing the ‘molecular’ nature of these materials, and applying these long-lived excited states in a range of photoactivated chemistry. This work was supported by the US Air Force Office of Scientific Research (FA9550-13-1-0106) and the Ultrafast Initiative of the US Department of Energy, Office of Science, Office of Basic Energy Sciences, through Argonne National Laboratory (under contract DE-AC02-06CH11357). Department of Chemistry North Carolina State University (NCSU) Cédric Mongin received his PhD in organic chemistry (on photoswitchable molecular cages) from the University of Bordeaux, France, in 2013. Since 2014 he has been a postdoctoral researcher in the Castellano research group at NCSU, where his research focuses on the exploitation of semiconductor quantum dots as promising triplet sensitizers. He will begin his independent career later this year, as a faculty member in chemistry at the École Normale Supérieure de Cachan, France. Sofia Garakyaraghi received her BS in chemistry (with a minor in mathematics) from the College of William and Mary in 2013. She is currently a PhD candidate under the guidance of Felix Castellano. She is studying the excited-state dynamics of various molecular- and nanocrystal-based systems with the use of ultrafast spectroscopy. Felix (Phil) Castellano earned a BA from Clark University in 1991 and a PhD from Johns Hopkins University in 1996 (both in chemistry). Following a National Institutes of Health postdoctoral fellowship at the University of Maryland's School of Medicine, he accepted a position as assistant professor at Bowling Green State University in 1998. He was promoted to associate professor in 2004, to professor in 2006, and was appointed director of the Center for Photochemical Sciences in 2011. In 2013 he moved his research program to NCSU, where he is currently a professor. He was appointed as a fellow of the Royal Society of Chemistry in 2015. His current research focuses on metal-organic chromophore photophysics and energy transfer, photochemical upconversion phenomena, solar fuel photocatalysis, energy transduction at semiconductor/molecular interfaces, and excited-state electron transfer processes. 2. T. F. Schulze, T. W. Schmidt, Photochemical upconversion: present status and prospects for its application to solar energy conversion, Energy Environ. Sci. 8, p. 103-125, 2015. 5. C. Mongin, S. Garakyaraghi, N. Razgoniaeva, M. Zamkov, F. N. Castellano, Direct observation of triplet energy transfer from semiconductor nanocrystals, Science 351, p. 369-372, 2016.


News Article | January 13, 2014
Site: techcrunch.com

Venture investors may have turned their attention to earlier stage ad-tech companies at the right time now that big investments and strong IPOs could give their valuations a boost. On Monday morning, Turn announced an $80 million Series E round, which included investments by Fidelity Investments and BlackRock, in the latest sign that investors are returning to embrace the sector. September and October 2013 saw two big public offerings for RocketFuel and Criteo, which were both embraced by public investors at the time. Thanks to this attention from massive investment managers, early-stage ad-tech companies may have more leverage at the bargaining table. The word that public investors are embracing the ad space is good news for venture investors who continued to invest billions in the sector in the face of initially tepid public-market response. Investors had been concerned by the lack of enthusiasm for an earlier wave of companies like Millennial Media, which is down 68.8 percent from its high as of market close on Monday, or YuMe Inc., which priced well below its target when it made its initial offering in April 2013. As these advertising companies got the cold shoulder from public markets, funding declined, and investors moved more heavily into earlier-stage investments in 2012 and 2013, according to data from CrunchBase. For public investors, these later-stage investments represent an opportunity to buy earlier and for a bigger pop than if they were to invest in those companies for the first time at their public offerings. Given the number of early-stage companies that are coming to market, investors interested in the sector will have plenty to choose from. Despite falling commitments, investors still poured $1.52 billion into 331 companies in 2013, down from $1.93 billion in 2012, but still up from the $1.02 billion invested in 2009, according to CrunchBase data. “There is continual innovation going on in the ad-tech space. Every 12-to18 months you see a new wave coming in,” said Jeff Crowe, a managing partner with Norwest Venture Partners and an investor in Turn. As public investors have grown more comfortable with advertising technologies through public investments, they’re getting a better understanding of the opportunities presented by private companies, Crowe said. He declined to comment on whether Turn benefited from the phenomenon. Now, however, a host of companies stand to benefit through renewed interest in their own public offerings. “You’re going to see more IPOs coming out of the sector,” Crowe said. “There were half a dozen in the last 12 months, and you could easily see a half a dozen more in the next 12 months.”


News Article | October 26, 2015
Site: uk.reuters.com

The deal is valued at $3.4 billion, according to Reuters calculations. Ctrip's U.S.-listed shares were up 28 percent at record $94.66 in early trading, while Qunar was up 20 percent at near five-month high of $49.71. Overseas spending by Chinese tourists is expected to rise 23 percent this year to $229 billion, and will nearly double to $422 billion by 2020, according to a report by consultancies China Luxury Advisors and the Fung Business Intelligence Centre. (bit.ly/1H4r6t4) The deal would also improve profitability at both the companies after a pricing war, involving heavy promotions and discounts to customers, has hurt the Chinese online travel sector over the past couple of years. Ctrip's adjusted operating margin fell to 4.8 percent in 2014 from 23.6 percent a year earlier, while that of Qunar deteriorated to a negative 46 percent from negative 10 percent. "This deal significantly increases the likelihood of a profitability improvement trajectory over the next couple of years for both companies ... Ctrip and Qunar are likely to have 70-80 percent of the hotel and air ticket market," Summit Research analyst Henry Guo wrote in a note to clients. Ctrip.com will own roughly 45 percent of Qunar and Baidu will take a 25 percent stake in Ctrip.com. Ctrip.com has a market valuation of $10.6 billion, while Qunar is valued at $5.2 billion. Bloomberg earlier on Monday reported the plan to merge, citing unidentified people familiar with the matter. Such mergers are becoming increasingly common in China's tech sector as a way of dealing with fierce competition between rival companies. Earlier this month, Meituan.com and Dianping Holdings - which provide online reviews and deals for restaurants and retail and leisure businesses - said they would merge after being fierce rivals for years. Didi Dache and Kuaidi Dache, two leading taxi-hailing firms, combined in a share swap worth $6 billion earlier this year. Four Ctrip.com representatives will join Qunar's board of directors, including CEO Liang and Chief Operating Officer Jane Sun. Baidu's Chief Executive Robin Li and Tony Yip, the firm's head of investments, have been appointed to Ctrip.com's board. JPMorgan advised Ctrip on the deal. Baidu was advised by Williams Capital Advisors, LLC.

Discover hidden collaborations